ID: 1121083099

View in Genome Browser
Species Human (GRCh38)
Location 14:91124534-91124556
Sequence CTGAAGAAAGTGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121083095_1121083099 -5 Left 1121083095 14:91124516-91124538 CCACGAGTTCTCTGAGGCCTGAA 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG 0: 1
1: 0
2: 2
3: 41
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121083099 Original CRISPR CTGAAGAAAGTGCTGGTGGA AGG Intronic
900624336 1:3601195-3601217 CTGGAGAGAGTGCTGGTGGCCGG - Intronic
900714915 1:4138056-4138078 CTCCAGAAAGTGCTGGTGGAAGG - Intergenic
900998199 1:6134153-6134175 CTGAAGAAACTGCGGGATGAGGG - Exonic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901306207 1:8234850-8234872 GTGAAGACAGTGTTGATGGAAGG + Intergenic
901830367 1:11888448-11888470 GTGGAGAAAGGGCTGGTGCAAGG - Intergenic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
902943070 1:19814458-19814480 CAGAAGAGAGTCCTGGAGGAGGG + Exonic
903766053 1:25735035-25735057 TTGAAGAAAGGGCTGGAGGCTGG + Intronic
904948464 1:34216458-34216480 CTGAACAAAGTGCTGGTGTTGGG + Intronic
905328088 1:37172221-37172243 CTGCTGGGAGTGCTGGTGGAAGG - Intergenic
906251352 1:44313164-44313186 CTGCAGCAAGTGCTGGAGGTAGG - Exonic
907126452 1:52055225-52055247 CTGAAGGAAGTGATGTTAGACGG + Exonic
907258525 1:53198005-53198027 TTTAAGAAAGTACTGGGGGAGGG - Intronic
908013134 1:59803597-59803619 CAGAAGTTAGTGCTGGTGGTGGG - Intergenic
911256763 1:95642005-95642027 TTGTGGAAAGTGTTGGTGGAAGG + Intergenic
912833502 1:112974324-112974346 CTGAAAAAAGTTCAGGTGGGAGG + Intergenic
916258771 1:162819478-162819500 CTGATGGAAGTGATGGTGGGAGG + Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
917598915 1:176556440-176556462 CTGAATCAGGTGCTGTTGGAAGG + Exonic
918825185 1:189314971-189314993 CTAAAAAAAATGCTGGTGAAGGG - Intergenic
919013749 1:192000836-192000858 CTGAAGAAATCGGTGGTGCAAGG + Intergenic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
920906554 1:210175123-210175145 CTGAAGATATTACTGGTTGATGG - Intergenic
921354926 1:214276912-214276934 CTGAACAAAGTGCAGTAGGAAGG - Intergenic
922725371 1:227920613-227920635 CTGAAGACAGTGCTGGTGTTGGG + Exonic
922976876 1:229792452-229792474 CTGAGGACAGTGCAGGTGAATGG + Intergenic
924367181 1:243307285-243307307 CTAAAGAAAGGGCTGGGGAATGG - Intronic
1063322262 10:5061270-5061292 CTGAAGAAGGAGCTGGTGACAGG + Intronic
1063696515 10:8340738-8340760 CTTAAGAAAGTGGGAGTGGATGG - Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065520944 10:26571618-26571640 CTGAAGAAAGAATTGGTGAATGG - Intergenic
1065555560 10:26912226-26912248 CAGAAGAAAGTGCTCGAGGAAGG + Intergenic
1065746563 10:28847807-28847829 TGGAAGAATGTTCTGGTGGACGG + Intronic
1066574328 10:36809066-36809088 CAGAAGAAAGTGCTCTAGGAAGG - Intergenic
1067842489 10:49691987-49692009 CTGAAGACACTCCTGGAGGATGG - Intronic
1068776748 10:60875472-60875494 CTGCAGAAAGTTCTACTGGATGG + Intronic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1069246949 10:66218436-66218458 CTGAAGGAAGTCATGTTGGAAGG + Intronic
1070384091 10:75908308-75908330 TGCAAGAAGGTGCTGGTGGAGGG - Intronic
1070432268 10:76352788-76352810 CTGAAAGAAGTGGTTGTGGATGG + Intronic
1070440777 10:76441072-76441094 ATGAAGAAGGTGTTGATGGAAGG - Intronic
1070649754 10:78226548-78226570 CTGCAGAAAGTTCCAGTGGACGG + Intergenic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1075359442 10:121816949-121816971 CTGAAGAAAGTGCCAATGCAAGG + Intronic
1076679996 10:132166867-132166889 CTGAAGACAGAGCTGTTGGCAGG - Intronic
1078725540 11:13927296-13927318 CTTAAGCAATTGCTGGTGGAAGG - Intergenic
1079324307 11:19478347-19478369 CTGCAAAAATTGCTGATGGAAGG + Intronic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080871095 11:36237681-36237703 TTGCAGAAAGAGCTGGTGGAGGG + Intergenic
1081541901 11:44040679-44040701 CAGAGGTAAGTGCTGGTGGCAGG + Intergenic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1082928829 11:58578956-58578978 CTGAAGGAAGGGGTGGGGGAGGG + Intergenic
1083424265 11:62574981-62575003 CTGCAGGAAGTTCTGGGGGAGGG + Intronic
1083781312 11:64919354-64919376 AAGAAGAAACTGCTTGTGGAAGG + Intronic
1084382004 11:68818517-68818539 CTGAAGTTATAGCTGGTGGAAGG - Intronic
1084427541 11:69093911-69093933 CTGAAGACAGTGAGGATGGACGG + Intergenic
1084578059 11:70003568-70003590 CTTAATAAATTGTTGGTGGATGG + Intergenic
1084967673 11:72752829-72752851 TTGAAGAATGTGGTGGAGGAAGG - Intronic
1086003293 11:82004939-82004961 GTGAAGAAAGTGCTAGTGTTGGG + Intergenic
1086442751 11:86845611-86845633 CTGAAGTAAGTCCTGATGCAGGG - Intronic
1086959620 11:92969267-92969289 CTGGAGAAGGTGCTGATGGTAGG - Intergenic
1088143420 11:106646433-106646455 ATGAAGAAATTGCTGGATGAAGG + Intergenic
1088317300 11:108520295-108520317 CCACAGAAAGTGGTGGTGGATGG - Intronic
1088536759 11:110869911-110869933 TTGAAGAAGGTGCTGGTGACTGG + Intergenic
1088544520 11:110946174-110946196 CTTGAGAAAGTGCTGCTGGCTGG - Intergenic
1090010307 11:123040174-123040196 CTGAAGAGAATACTGATGGATGG + Intergenic
1090635005 11:128685605-128685627 CTGAAGAAAGTGCGCCTGGGCGG + Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091761710 12:3091853-3091875 CTGAAGACTGTGTTGGAGGAGGG + Intronic
1092197006 12:6555695-6555717 CTGCAGCAAGCGCTGGAGGAGGG - Exonic
1092218126 12:6696410-6696432 AGGAGGAAGGTGCTGGTGGATGG - Intronic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1092671771 12:10869926-10869948 CTGAAGATAGTGCTCTTGGCTGG - Intronic
1093005335 12:14045015-14045037 TTGCAGAAAGTTCTGTTGGACGG - Intergenic
1093495409 12:19751439-19751461 CTGAAGAAACTGCTCTTGGGAGG + Intergenic
1094049953 12:26207999-26208021 CAAAAGAAAGTGGTGGTGGTGGG + Intronic
1094309077 12:29057686-29057708 CTGAAAACGGTGCTGGTGAAAGG + Intergenic
1096570127 12:52518089-52518111 CTGAAGAAGGTGCGTGTGGGTGG - Exonic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097042339 12:56163417-56163439 CTAAAGGAAGGGCTGGTGAAAGG - Exonic
1098209069 12:68143465-68143487 CTGAAGAAGGTCCTGCTGGTTGG + Intergenic
1098345362 12:69497227-69497249 ATGAAGAAAGAGTTGGTGAAAGG + Intronic
1098367290 12:69717770-69717792 CTGAAGAAAAACCTGTTGGAAGG + Intergenic
1099193071 12:79580888-79580910 ATGAGGAAAGTGTTGGTTGATGG - Intronic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1101509296 12:105378566-105378588 CTGAAGAAAATATTGGTGAATGG + Intronic
1103283807 12:119783681-119783703 CAGCAGAAAGTGCAGGTAGACGG - Intronic
1103559105 12:121783100-121783122 CTGCAGAAAGTTCTACTGGACGG + Intronic
1104668301 12:130663090-130663112 CTGCAGAACCTGCTGGTTGAAGG - Intronic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1105612288 13:21978872-21978894 CTGGAGAAAGTGCAGGTGAGTGG - Intergenic
1105965555 13:25380918-25380940 CTGAAAAAAATGCTGGAGGGAGG - Intronic
1106774239 13:32993268-32993290 CAGAAGAAAGTGATGGGGAAAGG - Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1109568539 13:64153413-64153435 ATTAAGAAAGAGCTGGTAGATGG + Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1111949003 13:94694951-94694973 CTGAAGAAAGTGTTTCTGGAAGG + Intergenic
1112197833 13:97242894-97242916 CTGAAATTGGTGCTGGTGGAAGG + Intronic
1112513713 13:100033490-100033512 CTCAGGAAAGTTCTGATGGAAGG + Intergenic
1113890650 13:113733438-113733460 GTCAAGCAAGTGCTGGTGGGTGG - Intronic
1114553329 14:23546875-23546897 CTAAAGAAGGGGCTGGTGGGCGG - Intronic
1114745414 14:25140853-25140875 CTGAAGAAACTTCTGGAGGAAGG - Intergenic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1117221982 14:53615667-53615689 CTGCAGAAAGTTCTATTGGATGG - Intergenic
1117234783 14:53760984-53761006 ATGCAGAAAGTGGTGGTGGGAGG + Intergenic
1118087166 14:62431222-62431244 CTGGAGACAGTTCTGGTGGAAGG + Intergenic
1119502799 14:75145006-75145028 CTGAAGAAAGGGCTGGTCTTCGG + Intronic
1120922958 14:89771870-89771892 GTGAAGACAGTGCTGGTGGGGGG - Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121949930 14:98162903-98162925 CCGAAGAGAGGGCGGGTGGAAGG - Intergenic
1124374599 15:29122164-29122186 CTGCACAAAGTTCTCGTGGATGG + Exonic
1124420272 15:29515028-29515050 TTGAAGAAAGTGTTCGTGGTAGG - Intronic
1125552255 15:40554217-40554239 AGGAAGAAATTGCTGGTGGGCGG - Intronic
1125729722 15:41886355-41886377 CTGAAGCAGGATCTGGTGGAGGG + Exonic
1126932999 15:53675821-53675843 TTGAATAAAGTGCTGGGTGAGGG + Intronic
1127988930 15:64096604-64096626 CTAAAGAAAGAACTGGTGGGCGG - Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1131630663 15:94173661-94173683 CAGAAAAAAGTGCTGGTAGTGGG + Intergenic
1132344361 15:101099422-101099444 CTGCAGGAGGTGCCGGTGGAAGG - Intergenic
1133100630 16:3477356-3477378 CTCAAGGAAATGCTGGTGGCTGG - Intronic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134112088 16:11522019-11522041 CTGCAGGACGTCCTGGTGGAGGG - Exonic
1135630543 16:24032890-24032912 CTGAAAACAGTGGTGGTGCATGG - Intronic
1138569390 16:57859409-57859431 ATGAAGCAAGTGCTGGAGGAAGG - Intronic
1139913303 16:70412064-70412086 CTGAAGAAAGAGCAGGTTGTTGG - Intronic
1140069243 16:71634824-71634846 CAGATGCAAGTGGTGGTGGAAGG + Intronic
1140632765 16:76873625-76873647 TTGAACCAAGTGCTGCTGGACGG + Intergenic
1140968878 16:79993845-79993867 GTGAAGAAAGTGCCTGAGGATGG + Intergenic
1141093304 16:81145372-81145394 CTGTAGAAAGTTCTATTGGATGG + Intergenic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141269072 16:82522528-82522550 CTGAAGTAAATGGTGGTGGAGGG + Intergenic
1142051319 16:87959979-87960001 CTGAAGAAAGTGCCGGTGAGAGG + Intronic
1142812677 17:2402437-2402459 CTGAAGCCAGTTCTGGAGGAGGG + Intergenic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143172218 17:4936942-4936964 CTGGAGGCAGTGCAGGTGGAAGG - Intergenic
1143404612 17:6668918-6668940 ATGCAGTAAGTGTTGGTGGAAGG + Intergenic
1143993718 17:10988924-10988946 CTTTAGAAAGTGCTGGGGGCAGG + Intergenic
1144807209 17:17976030-17976052 CTGGAGAAACTCCTGGTGCAGGG - Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1147262430 17:39216465-39216487 CTTAATAAAGTGCTTGTTGAAGG + Intronic
1147310264 17:39591988-39592010 CTCAAGCATGTGCTGGTGGGTGG + Intergenic
1147343570 17:39771174-39771196 CTGAAGTCACTGCTGGTGGTGGG - Intronic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1148353544 17:46958450-46958472 CTGAAGGAAGTGCTGACGGCAGG + Intronic
1150045767 17:61912012-61912034 ATGAAGAAAGTCTTGGAGGAAGG - Exonic
1151245082 17:72788216-72788238 ATGAAGAAATTTCTGGTCGAGGG - Intronic
1151361410 17:73591416-73591438 CGGAAGAGTGTGCTGGTGGCCGG - Intronic
1151382024 17:73732425-73732447 CAGATGAGAGTGCTGGTGGCAGG - Intergenic
1153063219 18:1015285-1015307 CAGAAGGCAGTTCTGGTGGAAGG + Intergenic
1154345920 18:13543433-13543455 CTGAAGAGTGTGCTGGAGGCAGG + Intronic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157285057 18:46372104-46372126 CTGATGACAGTGCTGGTGGCTGG + Intronic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1159882894 18:73876359-73876381 CTCAGAAAAGTGATGGTGGAGGG - Intergenic
1160042433 18:75358074-75358096 TTGCAGAAAGTGCTACTGGATGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162178994 19:8854078-8854100 CTGCAGAAAGTTCTATTGGATGG + Intronic
1163641005 19:18461942-18461964 CTATAGACAGTGCTGGTGGGAGG + Intronic
1163675639 19:18654071-18654093 CTGATGAAAGGGTGGGTGGATGG - Intronic
1163713978 19:18863517-18863539 GAGCAGAAGGTGCTGGTGGAGGG + Exonic
1164518074 19:28953437-28953459 CTGAAGAACTGCCTGGTGGATGG + Intergenic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1167677294 19:50895214-50895236 CTGGAGAAAGTGCTTGGGAATGG + Intergenic
925105687 2:1289138-1289160 CTGAAGATAATGCTAGTGGCAGG - Intronic
925843772 2:8017611-8017633 CTGCAGACAGTGATGGTGGCAGG + Intergenic
926124660 2:10264752-10264774 CTCAGGAATGTGCGGGTGGAAGG - Intergenic
927561527 2:24077052-24077074 CTGAGGAAAGTGGTGGAGGTGGG + Intronic
927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG + Exonic
928123762 2:28602359-28602381 CAGAAGATGGTGGTGGTGGAGGG - Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930212482 2:48655590-48655612 CTGATCAAAGTACTGGTGGCAGG - Intronic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931196092 2:60053615-60053637 GAGGAGAAAGTGCTGGTGGAGGG - Intergenic
931771708 2:65503278-65503300 CTGAAGAAAGTGCTGTGGAAAGG - Intergenic
932619439 2:73257138-73257160 CTGAGGACAGGGCTGGTGCAGGG + Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
937299544 2:120830672-120830694 CTGGAGAATGTGCAGGTGGCTGG + Intronic
938973068 2:136449673-136449695 CTGAAGCAATTGCTTGTGCATGG + Intergenic
939130052 2:138224218-138224240 CTCAAGAAAGTGCTTTTGGCTGG - Intergenic
941779306 2:169427001-169427023 CCGGAGAAAGTGGAGGTGGAGGG + Intergenic
942330652 2:174820521-174820543 GTGAAGAAAGTGATGTTGCAAGG - Intronic
942659335 2:178247508-178247530 CCCAGGACAGTGCTGGTGGATGG + Intronic
944143259 2:196479690-196479712 CTGGAGAGGTTGCTGGTGGAGGG - Intronic
945056073 2:205870088-205870110 CTGCAGAAGGTGCTATTGGATGG - Intergenic
945484208 2:210375681-210375703 GTGAAGGAAGAGCTGGAGGAAGG + Intergenic
945541705 2:211095878-211095900 ATGAAGAAATGGCTGGTTGACGG - Intergenic
945811954 2:214559500-214559522 CTTAAGAAAGTGGTGGGAGAAGG - Intronic
946018013 2:216619757-216619779 CTGATGAAATTGCTGCTGGGTGG - Intergenic
946254918 2:218435349-218435371 GAGAAGCAAGTGGTGGTGGAAGG + Exonic
948889910 2:240902482-240902504 CTGAAGAAAGTTCATGTGCAGGG + Intergenic
948892891 2:240915824-240915846 CTGAAGAAGGTGCTGGGGGCAGG + Intergenic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
1168766319 20:383794-383816 ATGAAGACAGTGCTAGTGGGAGG - Intronic
1168900947 20:1364335-1364357 CTGGAAAAAGTGATGGTTGATGG + Intronic
1169860817 20:10150575-10150597 GGGAAAAAAGTCCTGGTGGAAGG + Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171128664 20:22627767-22627789 CAGAACAAACTGGTGGTGGAAGG + Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1172030468 20:31978551-31978573 CTGCAGAAAGTTCTACTGGATGG - Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173144899 20:40515991-40516013 CTGAAGAAGGAGCTGGGCGAGGG - Intergenic
1173393061 20:42652407-42652429 CTGAGGAATGTGCTGAGGGATGG + Intronic
1173656912 20:44705760-44705782 CTGATGAAGGTGCTCTTGGATGG + Intergenic
1173857171 20:46257933-46257955 CAGAAGAAAGTGCTGTAGGGAGG + Intronic
1174107303 20:48171864-48171886 ATGAAGAAACAGCTGGTGGCTGG - Intergenic
1174429306 20:50456348-50456370 CTGAAGAAAGTTCTAGAGGGTGG - Intergenic
1174544232 20:51313475-51313497 AGGAAGGAAGTGCTGGGGGAAGG - Intergenic
1175166678 20:57048953-57048975 ATGAAGACAGAGCTGGTTGAAGG + Intergenic
1177917166 21:27103171-27103193 CTGAAGAACATTCTGGTAGAGGG + Intergenic
1179019102 21:37622058-37622080 CAGAACAAAGTGCTCCTGGATGG - Exonic
1179258233 21:39736265-39736287 CTGAAGGAACTGTTGATGGAGGG - Intergenic
1179820088 21:43931682-43931704 CTGACGACAGTGCCGGTGGCTGG - Intronic
1182098537 22:27642083-27642105 CTGAGGAATCTGCTGGGGGAGGG - Intergenic
1182541296 22:31044103-31044125 CAAAAGAAGGTGCTGGGGGATGG - Intergenic
1183221430 22:36516197-36516219 ATGAAGAAAGTACTGGAAGAAGG + Intronic
1183475492 22:38033802-38033824 CTGACGACAGTGCCCGTGGAAGG + Intronic
1183972643 22:41489505-41489527 GGGAAGAAAGTGCTGGGGCAGGG - Intronic
1184952353 22:47852805-47852827 AGGATGAAAGGGCTGGTGGAGGG + Intergenic
950682591 3:14595375-14595397 CTGAAGAGTGTGCTGGAGCAGGG - Intergenic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
954778012 3:53037193-53037215 CTGCAGCAAGTGCTTGAGGAGGG - Intronic
954880796 3:53834735-53834757 AGGAAGAAAGTGCTGCTGGGAGG - Intronic
954884746 3:53862799-53862821 CTAAAGCAAGTGGTGGAGGAAGG + Intronic
956885423 3:73554149-73554171 CAGAAGAAAGGCCTGGTGAAGGG + Intronic
961148049 3:124611796-124611818 CTGAAGGAAGTTCTTGTGGCTGG - Intronic
961520992 3:127467312-127467334 CAGAAGAAAGTGCCTGGGGATGG - Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
966725930 3:183108628-183108650 CTGAAGAAAATACTGGGGGGAGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
968284909 3:197502825-197502847 CTGAACAATGTCCTGGGGGATGG + Intergenic
969232364 4:5840505-5840527 CTGCAGAAAGCGCTGCTTGATGG - Intronic
969433411 4:7169329-7169351 CTGCAGGAAGTGGTGGTGGTGGG + Intergenic
969538766 4:7772872-7772894 CTGAAGAAAGCGCTGGCGGGCGG - Exonic
969847417 4:9930235-9930257 CTGATGAAAGTGATGGTGAAGGG - Intronic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
974098481 4:57391057-57391079 CTGAAAAATGTGCAGGTGAATGG - Intergenic
974219022 4:58941958-58941980 ATAAAGAAAGTGCTGGTGGGTGG + Intergenic
974373852 4:61051042-61051064 CTGAAGAAAAGGCATGTGGATGG - Intergenic
975945656 4:79702886-79702908 CTGAAGAAAGACGTGGTGGTGGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976143598 4:82019258-82019280 ATGATGAAAGAGATGGTGGAAGG + Intronic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
979977431 4:127214169-127214191 CATAAGAAACTGCTGGTGTAAGG - Intergenic
980191314 4:129528808-129528830 CTAAGGAAAGAGCTTGTGGAAGG - Intergenic
980305758 4:131059693-131059715 CTGAAGTAAGTCCTGGTACAAGG + Intergenic
982099455 4:151953799-151953821 CTGAGACAAGTGCTGGTGGCTGG - Intergenic
983159963 4:164400549-164400571 CTGAATAAAATCCTAGTGGAGGG - Intergenic
983551490 4:169021880-169021902 GAAAAGAAAGTGCAGGTGGAGGG + Intergenic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
983954921 4:173686330-173686352 CAGAGGAATGTCCTGGTGGATGG - Intergenic
984140742 4:176001781-176001803 CAGAGGAAGGTGCTGGTGCAGGG - Intronic
984981617 4:185287483-185287505 CTGTAGAAAGTTCTACTGGATGG - Intronic
986470282 5:8066939-8066961 TTGGAGAAGGTGCTGGTGGTGGG + Intergenic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
986738252 5:10683148-10683170 CTGAAGAAAGTGCCAGTGTTGGG - Intronic
987394777 5:17412901-17412923 TTGAAGACAGAGCAGGTGGACGG - Intergenic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
990749123 5:58993594-58993616 TTGAAGAAAGTTCTGCTGGAAGG - Intronic
990816047 5:59786162-59786184 CTGCAGAAAGAGCTGATCGATGG - Intronic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991931359 5:71756069-71756091 CTCAAGAAGTGGCTGGTGGATGG - Intergenic
994218589 5:97167697-97167719 CAGAAGAGAGTGCTGATGCACGG - Exonic
995360141 5:111287635-111287657 CTTTAAAAAGTGTTGGTGGAAGG + Intronic
995904305 5:117105177-117105199 ATGAAGACAGTGCTGGTAGGGGG + Intergenic
999237390 5:150107140-150107162 CTGAATAAATTGCTTTTGGAGGG - Intronic
1000570482 5:162906886-162906908 ATGAAGAAAGTGCTTGTGCTGGG - Intergenic
1000987462 5:167876272-167876294 CTGAAACAAGGGCTGGGGGAAGG + Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004008583 6:11659176-11659198 CTGAAGAATGTCCAAGTGGAAGG + Intergenic
1005297980 6:24445560-24445582 CTGAAACAAGTGCTGCTGGTTGG - Exonic
1005440304 6:25860403-25860425 CTGCAGACTGTACTGGTGGATGG - Intronic
1005590017 6:27313039-27313061 CTGAGCCAAGTGCTTGTGGAGGG - Intergenic
1006269084 6:32950114-32950136 CTGAAGGAAGTCATGGTGGAGGG - Intronic
1006888326 6:37400765-37400787 CTGGAGAAAATGCAGCTGGATGG + Intergenic
1008875261 6:56319093-56319115 CTGAAGAAAGTGTTGAGAGAAGG - Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010642009 6:78340549-78340571 CTGCAGAAAGTCCTGATAGATGG - Intergenic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1012491655 6:99788962-99788984 CTGGAGAGAGTGGTGGTGGCGGG - Intergenic
1012875804 6:104724296-104724318 CTCAAGAAAGGGGTGTTGGAAGG - Intergenic
1013601991 6:111713540-111713562 CTGAAGAAAGTGTGGGGGGGTGG - Intronic
1013635981 6:112029681-112029703 ATGAAGAATGTGCTGGTTTAAGG - Intergenic
1014723536 6:124948989-124949011 CTGAAGAAAGTGGGGGGGGGGGG + Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017722308 6:157252418-157252440 CTGAAGAAACTGCTAATGAAGGG + Intergenic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1019988005 7:4672239-4672261 CTGCAGAAAGTTCTGTTGGACGG - Intergenic
1020361223 7:7328821-7328843 CTGAAGTAGGAGTTGGTGGAAGG - Intergenic
1021435868 7:20614640-20614662 TTGCAGAAAGTTCTGTTGGATGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022184706 7:27956020-27956042 ATTAAGAAAGTGCTGGAGGAAGG + Intronic
1022370174 7:29763721-29763743 ATGAAGAAAGATCTGGTGAAAGG - Intergenic
1022838342 7:34137993-34138015 CTGAAGAGAGTGCTATTAGATGG - Intronic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1023730185 7:43184517-43184539 CTAAAGAAATGGCTGGTGGCTGG + Intronic
1023757672 7:43434750-43434772 AAGAAGAAAGTTCTTGTGGAGGG + Intronic
1025248653 7:57337085-57337107 CAGATGAAAGTGCAGGTGGGTGG - Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1026072756 7:67137172-67137194 TTCTAGAAAGTGCTGGAGGAAGG - Intronic
1026704127 7:72675036-72675058 TTCTAGAAAGTGCTGGAGGAAGG + Intronic
1027423658 7:78040976-78040998 TTCAACAAAGTGCTGGTGGAGGG - Intronic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1031878009 7:127163555-127163577 CTGAAGAAAGTGGTTATGGAAGG - Intronic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1032430265 7:131855326-131855348 TTGAGGAAAGAGCTGGTGGTGGG - Intergenic
1033742083 7:144283577-144283599 CCAAAGAAGGTGCTGGTTGAGGG + Intergenic
1033751819 7:144366037-144366059 CCAAAGAAGGTGCTGGTTGAGGG - Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033843942 7:145409361-145409383 CTGAAGAAAGTGCCTGCAGAGGG + Intergenic
1034747566 7:153536683-153536705 CTGATGAGAGTGTTGGTGGCTGG - Intergenic
1035290828 7:157837432-157837454 CTGATGGAAGAGGTGGTGGAGGG + Intronic
1035426139 7:158775671-158775693 AAGAAGGAAGTGCAGGTGGAAGG - Intronic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1036059615 8:5301375-5301397 TTGGAGAAAGAGGTGGTGGAGGG + Intergenic
1038839315 8:31166303-31166325 CAGAAGAATGTGATGTTGGAAGG + Intronic
1038881099 8:31612793-31612815 CTGAATAATGTGCTGTTGTATGG + Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1040696193 8:50001926-50001948 AGAAAGAAAGTGCTTGTGGAAGG + Intronic
1042577749 8:70239600-70239622 CTGAATCAAGTGCTGGGGGGCGG - Intronic
1044461246 8:92446964-92446986 ATGCAGTAAGTGCTGATGGAGGG + Intergenic
1046315173 8:112491409-112491431 CTTTAGAAAGTGGAGGTGGATGG + Intronic
1048114944 8:131510694-131510716 ATGAAGAAAGTACTGGTAGAGGG - Intergenic
1048132170 8:131710114-131710136 CTCAGGAAAGGGCTGGTAGAGGG - Intergenic
1048720578 8:137319780-137319802 GAGAAGAAAGTGGTGGTGGTAGG - Intergenic
1049249099 8:141578646-141578668 CTTCAGAATGGGCTGGTGGAAGG - Intergenic
1051838133 9:21363624-21363646 CTGAAGAAAAAGGTGCTGGAAGG + Intergenic
1051839425 9:21378631-21378653 CTGAAGAAAAAGCCGGTGGAAGG + Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1054740335 9:68800147-68800169 CTGAAAATAGTGATGGTGAAGGG + Intronic
1054818405 9:69497661-69497683 CTGAAGAAAGAGCAGGTCCATGG - Intronic
1056121536 9:83493274-83493296 CTTGAGGAAGTTCTGGTGGAGGG - Intronic
1057307438 9:93920472-93920494 GTGAAGAAGGTGCTGGGTGATGG + Intergenic
1057838770 9:98468168-98468190 CTGAAGAACGTGCTTCTGGAGGG + Intronic
1057972731 9:99573104-99573126 CTTAAAAAAGTGGGGGTGGAGGG - Intergenic
1059620844 9:116003798-116003820 CTCAAGAAATTGGTGATGGATGG - Intergenic
1060990278 9:127845050-127845072 CTGAGGAATGTGCCGGGGGAAGG + Intronic
1061045144 9:128160744-128160766 CTGAAGGAAGTGGTGGAGCAAGG - Intronic
1061238036 9:129353268-129353290 CTGATGAAGGGGCTGGTGGGAGG + Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062185148 9:135214266-135214288 CAGAGGAAGGTGCTGGTGCAGGG + Intergenic
1186801911 X:13101456-13101478 CTCAAAAGAGTGGTGGTGGAGGG + Intergenic
1186942744 X:14528893-14528915 CTGAAGAAAGCTCAGTTGGAAGG + Intergenic
1187187813 X:17003889-17003911 CTGAACAAAGTTCTGGAAGAAGG - Intronic
1188491777 X:30745495-30745517 CTGAAGGAAGGGCTGGAGGCTGG - Intergenic
1189280458 X:39817213-39817235 TGGAAGAAATTGCTGCTGGAAGG + Intergenic
1189537134 X:41947068-41947090 CTAAAGGAAATGCTGGAGGAGGG + Intergenic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190623067 X:52307993-52308015 CTGAAGCAACTGCAGCTGGAGGG + Intergenic
1192124438 X:68488754-68488776 CTCAAGAAAGCGATGGGGGAGGG + Intergenic
1192204160 X:69085229-69085251 CTGAAGAAAATTGGGGTGGAAGG + Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1194331664 X:92590868-92590890 CTGAAGCAATTGTTAGTGGAAGG + Intronic
1196286922 X:113893601-113893623 TTGAAGAAAGTGCTGGTTCTAGG - Intergenic
1197734370 X:129839868-129839890 TTGAAGATAGGGCTGGAGGAGGG - Intronic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1198414928 X:136410354-136410376 CTGAACATGGTGCTGGTGGGAGG + Intronic
1199679688 X:150216055-150216077 CTGCAGACAGTGCTGGTCCAGGG + Intergenic
1199695543 X:150340994-150341016 CTGCAGACAGTGCTGGTCCAGGG - Intergenic
1200051090 X:153432171-153432193 TGGAAGAAAGTGCAGGTGGCAGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1200971604 Y:9158484-9158506 CTGATGAAATGGCTGTTGGAGGG + Intergenic
1202139414 Y:21705813-21705835 CTGATGAAATGGCTGTTGGAGGG - Intergenic