ID: 1121085011

View in Genome Browser
Species Human (GRCh38)
Location 14:91139251-91139273
Sequence GAGAACAAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 1, 1: 13, 2: 150, 3: 1057, 4: 3984}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121085011_1121085019 23 Left 1121085011 14:91139251-91139273 CCTTCCTCCTCCTCCTTGTTCTC 0: 1
1: 13
2: 150
3: 1057
4: 3984
Right 1121085019 14:91139297-91139319 GATGACCACTGCCATTGGTAAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1121085011_1121085020 27 Left 1121085011 14:91139251-91139273 CCTTCCTCCTCCTCCTTGTTCTC 0: 1
1: 13
2: 150
3: 1057
4: 3984
Right 1121085020 14:91139301-91139323 ACCACTGCCATTGGTAAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 121
1121085011_1121085018 18 Left 1121085011 14:91139251-91139273 CCTTCCTCCTCCTCCTTGTTCTC 0: 1
1: 13
2: 150
3: 1057
4: 3984
Right 1121085018 14:91139292-91139314 TGCATGATGACCACTGCCATTGG 0: 1
1: 0
2: 2
3: 13
4: 155
1121085011_1121085022 28 Left 1121085011 14:91139251-91139273 CCTTCCTCCTCCTCCTTGTTCTC 0: 1
1: 13
2: 150
3: 1057
4: 3984
Right 1121085022 14:91139302-91139324 CCACTGCCATTGGTAAGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121085011 Original CRISPR GAGAACAAGGAGGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr