ID: 1121088795

View in Genome Browser
Species Human (GRCh38)
Location 14:91167204-91167226
Sequence CTCTGGGTATGGTGGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121088795_1121088803 -1 Left 1121088795 14:91167204-91167226 CCCTTCTCCCACCATACCCAGAG 0: 1
1: 0
2: 2
3: 29
4: 370
Right 1121088803 14:91167226-91167248 GCTCCGACCAGCCAGCCTGGTGG 0: 1
1: 1
2: 0
3: 11
4: 157
1121088795_1121088802 -4 Left 1121088795 14:91167204-91167226 CCCTTCTCCCACCATACCCAGAG 0: 1
1: 0
2: 2
3: 29
4: 370
Right 1121088802 14:91167223-91167245 AGAGCTCCGACCAGCCAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1121088795_1121088807 10 Left 1121088795 14:91167204-91167226 CCCTTCTCCCACCATACCCAGAG 0: 1
1: 0
2: 2
3: 29
4: 370
Right 1121088807 14:91167237-91167259 CCAGCCTGGTGGTCCTGCCCAGG 0: 1
1: 0
2: 3
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121088795 Original CRISPR CTCTGGGTATGGTGGGAGAA GGG (reversed) Exonic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901868577 1:12123918-12123940 TTGTGGGTATGGTCTGAGAAGGG + Intronic
902090867 1:13902139-13902161 CTCTGGATTTGGTGAGATAATGG + Intergenic
902183456 1:14707365-14707387 CTCTGGTTATTGTGACAGAAAGG - Intronic
902320101 1:15656425-15656447 CTGTGTGTATTGTGAGAGAATGG + Intronic
902511118 1:16967555-16967577 CTCTGGGCAGGGTGGCAGAGGGG + Intronic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
903422045 1:23225095-23225117 CTCTGGTCAAGGGGGGAGAACGG - Intergenic
903811991 1:26039738-26039760 CTCAGGGTGGGGTGGGAGACAGG - Intronic
903973752 1:27136284-27136306 CTCTGGGTCTGCTGGGAGCAGGG + Intronic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904521736 1:31101184-31101206 CTGTGCGTGTGCTGGGAGAAAGG - Intergenic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905286953 1:36887158-36887180 TTCTGTGTATGGTGGGAGGCAGG - Intronic
905641513 1:39593107-39593129 CTCTGGCTGCTGTGGGAGAATGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905904829 1:41611065-41611087 CTCAGGGTGTGGGGGCAGAAGGG + Intronic
906299746 1:44673473-44673495 CTCTGGGAATTCTGGCAGAAGGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906409856 1:45569705-45569727 CTATGGGTTTGGTGCTAGAATGG + Intronic
906528827 1:46511754-46511776 CTCTGGGCAGGGTGGGGGAGGGG + Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907626224 1:56032700-56032722 CTCTGGGTCTGGGAGGATAATGG + Intergenic
908178411 1:61579159-61579181 CTTTGGGAATGGTTGGACAATGG - Intergenic
908686310 1:66723891-66723913 CTCTGGGTTTGCTTGGAGATAGG - Intronic
908756857 1:67476898-67476920 CTTTGTGTATGGTGTGAGAAAGG - Intergenic
911069662 1:93822646-93822668 CTTTGGATATGGCTGGAGAAAGG + Intronic
915240305 1:154516417-154516439 ATATGGGGGTGGTGGGAGAATGG + Intronic
915536093 1:156536463-156536485 GTCTGGGGAGGGTAGGAGAAGGG + Intronic
915777125 1:158502005-158502027 CTCTGGCTGAGGCGGGAGAATGG - Intergenic
916350464 1:163843852-163843874 CTCTAAGGATGGTGGGACAAAGG - Intergenic
916917349 1:169422860-169422882 CTCTGAGTATAGTTGAAGAAGGG - Intronic
916937563 1:169645247-169645269 GTATGCGTGTGGTGGGAGAAAGG - Intergenic
917639594 1:176970066-176970088 CTGTGGGTATTGTGTGAGACAGG - Intronic
919420605 1:197365492-197365514 CTCTGGGGAGGGGGGGAGAAGGG + Intronic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922702486 1:227769979-227770001 CACTGGGTCTGGCGGGAGAGTGG + Intronic
923092057 1:230748207-230748229 CTCTGGGAATGGGGGGTGCATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923582377 1:235230474-235230496 TTCTGGGAATGGTAGAAGAAAGG - Intronic
924058528 1:240146958-240146980 CTCAGGGTAAGGTGGAAGACGGG + Intronic
924321588 1:242855910-242855932 CTCTGGGGACTGGGGGAGAAGGG - Intergenic
1062985151 10:1761531-1761553 CTCTCGGGAGGGTGGGAGGAGGG + Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065382335 10:25102785-25102807 TTCTGGGTGGGGTGGGGGAAGGG + Intergenic
1066323983 10:34336295-34336317 ATCTGGGAATGGTGGAAGCATGG - Intronic
1067335066 10:45354662-45354684 CTCAGAATATGGTGGGGGAATGG + Intergenic
1067854771 10:49782899-49782921 CTCTGAGGATGGTGGAAGGAAGG - Intergenic
1068062622 10:52088028-52088050 CCCTAGGTAGGGTGGGAGTATGG - Intronic
1069283000 10:66678864-66678886 TTATGTGTTTGGTGGGAGAAAGG + Intronic
1069625752 10:69866804-69866826 CTCTGGGAATGGGAGGAGCACGG + Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1071854889 10:89614202-89614224 CACTGGATAGGATGGGAGAAGGG + Intronic
1072321119 10:94251147-94251169 ATCGGGGTATGGTTAGAGAAGGG + Intronic
1072449764 10:95530716-95530738 CTCTGGCTAAGCTGGGAGGAGGG - Intronic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072623579 10:97096708-97096730 TTCTGGGTTTGCTGGGGGAAGGG - Intronic
1072924020 10:99600344-99600366 CCCTGGGTATGGTGGGAGGTAGG - Intergenic
1073585751 10:104708405-104708427 GTCTGGGTCTCTTGGGAGAAAGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075613038 10:123868695-123868717 CTATGGTTATGTTGGGAGTAGGG - Intronic
1076257598 10:129040593-129040615 CTCTGGCTATGGTTGGATCATGG - Intergenic
1076981629 11:207831-207853 CACTGGGTGTGGTGGGGGCAGGG + Intronic
1078192308 11:9101347-9101369 CTCTCCATAAGGTGGGAGAAAGG + Intronic
1078355743 11:10630185-10630207 CTCTGGATGAGGTGGGTGAACGG + Intronic
1078468491 11:11568497-11568519 CTCTGGTTAAGGGGGGAAAAAGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079712314 11:23701162-23701184 CTCGGGGTATGGAGAGATAAAGG - Intergenic
1079888302 11:26016952-26016974 CACTGGTTGTGGTGGGGGAATGG - Intergenic
1081802533 11:45869788-45869810 CTCTGGGTCAGCTGGGAGAGCGG + Exonic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1083887728 11:65581037-65581059 ATCTGGGAATGGTAGGAGAGGGG - Exonic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1086417892 11:86607368-86607390 CAATGAGTATGGTGGGAAAAGGG - Intronic
1088139242 11:106595638-106595660 CTCTGGGGGAGGTGGAAGAAAGG + Intergenic
1089010716 11:115129553-115129575 CTCTGGGAATTGTGGGATACAGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089378569 11:118011943-118011965 GCCTGGCTATGCTGGGAGAATGG + Intergenic
1089527484 11:119107005-119107027 GTCTGGGGGTGTTGGGAGAAGGG + Intronic
1090088174 11:123669746-123669768 CCATGGTGATGGTGGGAGAAGGG + Intergenic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1090977100 11:131687767-131687789 CCCTGGGTCTGGTGGCGGAAGGG + Intronic
1091822958 12:3490470-3490492 ATCTGGCGATGGTGGGGGAAGGG + Intronic
1092667849 12:10824963-10824985 CTTTGGGTTTTCTGGGAGAATGG + Intronic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096579186 12:52573522-52573544 CTCTGGGTATGGAGGGGGCCGGG - Exonic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1100297175 12:93273939-93273961 CCCTGGGAATGGTGGGAGGGAGG - Intergenic
1102563328 12:113778429-113778451 CTCTGTGTGTGGTGGGAGAGGGG + Intergenic
1102987969 12:117294112-117294134 AACTGGGTATGTAGGGAGAATGG - Intronic
1104382683 12:128321503-128321525 CTCTGGCTATAAAGGGAGAAAGG + Intronic
1105686881 13:22792912-22792934 CTCGGGATGTGGAGGGAGAAAGG + Intergenic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1109231579 13:59764231-59764253 CTCCTGGAAGGGTGGGAGAAAGG + Intronic
1109309032 13:60671322-60671344 CACTAGGTAGGGAGGGAGAAAGG - Intergenic
1109398946 13:61798980-61799002 CTCTGGTTATTGTTGGAAAATGG - Intergenic
1110924678 13:81136749-81136771 CTCTGGGGATGAGGGGTGAAAGG + Intergenic
1110989972 13:82028045-82028067 GTCTGTGTATGGTGTAAGAAAGG - Intergenic
1111316045 13:86561140-86561162 CTCTGGCTATGGTGTCTGAATGG + Intergenic
1112205047 13:97316359-97316381 CTCTGGCTACTGTGTGAGAATGG - Intronic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115200236 14:30845363-30845385 CTTTGTATATGGTGAGAGAAAGG + Intergenic
1117183545 14:53217348-53217370 CTCTGTGTCTAGTGGGAGAGGGG - Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1117659442 14:57988320-57988342 CCCTGGCTATTCTGGGAGAATGG - Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121363639 14:93286640-93286662 ATTTGGGCATGGTAGGAGAAGGG - Intronic
1121695848 14:95911269-95911291 CTCAGCTGATGGTGGGAGAAGGG - Intergenic
1122645715 14:103192439-103192461 CTCTGGGCATGGGGAGGGAATGG - Intergenic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1127289770 15:57559837-57559859 CTCTGGGTCTGTTGGGGGGATGG + Intergenic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127600798 15:60534589-60534611 CTCTCGGTAAGGTGGTAGAAGGG + Intronic
1128748115 15:70129273-70129295 CTCTGTGTATGCTGGGAGTTTGG - Intergenic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129094396 15:73188000-73188022 GTCTGGATTTGGTAGGAGAAAGG - Intronic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129612958 15:77074826-77074848 GTCTGGGGATGATGGGAGGATGG + Intronic
1129754186 15:78086379-78086401 ACCTGTGTTTGGTGGGAGAAGGG + Intronic
1130044102 15:80430779-80430801 TTCTGTGTATTGTGGGAGAGAGG - Intronic
1130133250 15:81160959-81160981 CTTTGGGAAGGGTGGGAGAATGG + Intronic
1130743949 15:86630626-86630648 CTCTGGCTCAGGTGAGAGAAGGG - Intronic
1132384893 15:101393367-101393389 ATCTGGGAATGGCGGGAGAGAGG - Exonic
1132563413 16:609326-609348 CACTGGGGATGGTGGGGGACAGG + Intronic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1133070067 16:3240367-3240389 CTCTGGGGAATGGGGGAGAATGG + Intergenic
1133433462 16:5758771-5758793 TTTTGGATAGGGTGGGAGAAAGG + Intergenic
1135743637 16:24997824-24997846 CTCTGGAAATGCTGGGTGAAGGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136445119 16:30312489-30312511 CACTGGTAGTGGTGGGAGAAGGG - Intergenic
1137079601 16:36029716-36029738 CTCTGGGGATGGTTGTGGAATGG + Intergenic
1137434666 16:48445622-48445644 AGCTGGGTATGGTGGGAGCCGGG + Intronic
1137589798 16:49686622-49686644 GCCTGGGTGTGGTGGGAGAGGGG - Intronic
1137672424 16:50286845-50286867 CTCTGGGTATGGTGTGAGGTAGG - Intronic
1137725696 16:50655217-50655239 CTCTGGGTGTGGGGCCAGAAAGG - Intergenic
1137731781 16:50695059-50695081 CTCTGAGCATGATGGGAGCACGG + Intronic
1137920813 16:52486561-52486583 CTCCAGTTTTGGTGGGAGAATGG + Intronic
1138381463 16:56605819-56605841 TGCTGGGAATGCTGGGAGAATGG - Intergenic
1138477532 16:57280947-57280969 TTCCTGGTATGGTGGGAGGAAGG - Intronic
1141288813 16:82698354-82698376 CTCTGTAGATGGTGGGAAAAAGG + Intronic
1141370603 16:83482813-83482835 CCATGGGCAGGGTGGGAGAAGGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143149470 17:4798695-4798717 ACCTGGATATGGTGGGGGAAAGG - Intergenic
1143875585 17:9988304-9988326 TTCTGGGTAGGAAGGGAGAAGGG - Intronic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1145074287 17:19838573-19838595 CTCTGGGAATACTGGGGGAAAGG + Exonic
1145982130 17:29019137-29019159 TTCTGTGTTTGGTGGGTGAAAGG - Intronic
1146393710 17:32444851-32444873 CTCAGCGTAGGGTGGGAGAGTGG + Intronic
1146427192 17:32752248-32752270 TTTTGGGTATGGTGAGAGACAGG - Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1149407425 17:56368056-56368078 CTCTGGATCTGATGGCAGAATGG - Intronic
1149526362 17:57359092-57359114 CTCCGGGAGTGGCGGGAGAAAGG - Intronic
1152056495 17:78031936-78031958 CTCTGTGTATGTTGTGAGTATGG - Intronic
1152629415 17:81403385-81403407 CTGGGGTTATTGTGGGAGAAAGG + Intronic
1152923396 17:83076993-83077015 CTCGGGGTCTGGTGGTACAAGGG + Intergenic
1153097907 18:1429844-1429866 CACTGCGTATGGGGGTAGAAAGG - Intergenic
1153439875 18:5104479-5104501 CTCTGGGGAAGGTGGTAGGAAGG - Intergenic
1154093028 18:11382250-11382272 CTCTGTGCATGGGGGGAGAGGGG + Intergenic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1154158773 18:11964630-11964652 CTCTGGGAGTGGTGGTAGTAGGG - Intergenic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155860839 18:30897359-30897381 CTCTGAGTTTGGTGGAAAAAAGG + Intergenic
1156030458 18:32706958-32706980 TTCTGGGTTTGGTGGGGCAATGG + Intronic
1156646957 18:39175439-39175461 CACTGGGTATAGTGGGTGATAGG + Intergenic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157390766 18:47301524-47301546 TTCTGTGTATGGTGTGAGATAGG + Intergenic
1157552807 18:48593094-48593116 CTCTGTATCTGGTGGGAGCATGG + Intronic
1157581898 18:48778545-48778567 CTCTGGGCATGTTGGCAGAAGGG + Intronic
1158308922 18:56138113-56138135 CTAGGGCTATGGTGGCAGAAAGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159009501 18:63045306-63045328 CTTGGGGTAAGGTTGGAGAAAGG + Intergenic
1160224998 18:77005614-77005636 TTCTGAGAATGGTGGGAGCAGGG + Intronic
1160793802 19:934672-934694 CTCTGGGTCTTGCGGGAGACGGG + Intronic
1160877886 19:1305886-1305908 CTCTGGGGATGGTGGGGGGGGGG - Intergenic
1161118344 19:2511844-2511866 CCCTGGGGAGGGTGGGAGAGGGG + Exonic
1161684196 19:5695051-5695073 CTCTGGGCATGGTGGGTGGCAGG - Intronic
1162107528 19:8379072-8379094 CTCTGGGTTTGATGGGAGGGAGG + Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1164389784 19:27808009-27808031 TTTTGGATATGGTGGGAGATAGG - Intergenic
1165365361 19:35361929-35361951 ATCTAGGTGGGGTGGGAGAAAGG + Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166673610 19:44725933-44725955 CTCTGGGTGTGGTGCGGGCAGGG - Intergenic
1167812850 19:51850040-51850062 TTCTGGGGATGGGGAGAGAAGGG + Intergenic
925534134 2:4898714-4898736 CTTTAGGTATTTTGGGAGAATGG - Intergenic
927311655 2:21638531-21638553 TTCAGGATCTGGTGGGAGAAAGG + Intergenic
927877808 2:26670490-26670512 CTCTAGAGAAGGTGGGAGAAGGG + Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928932129 2:36635818-36635840 CTCTGGGTAAGATGGAAGACTGG + Intronic
929687236 2:44045305-44045327 CCCTGGGTAGGATGGGAGGAGGG - Intergenic
931075193 2:58702987-58703009 CTCCTGGTATGATGAGAGAAGGG - Intergenic
932581455 2:72995002-72995024 CCCAGGGTGTGGTGGGAGCAGGG - Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
934654770 2:96111709-96111731 CTCTGGAAATGGTGGTGGAAAGG - Intergenic
935332723 2:101988788-101988810 CTCTGGGTCTCGTGGGAGGGGGG + Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937300998 2:120841729-120841751 CTCAGAGTATGGTGGGGGAGAGG + Intronic
938386003 2:130867885-130867907 CGCTGCGTGTGGTGGGAGCAAGG + Intronic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
939724204 2:145694911-145694933 TTCTGGGTCAGTTGGGAGAAAGG - Intergenic
939998018 2:148938489-148938511 CTCTCTTTTTGGTGGGAGAAGGG + Intronic
940000913 2:148965373-148965395 CACTGGTTGTGATGGGAGAAGGG + Intronic
940204629 2:151189233-151189255 GTGTGTGTATGGTGGTAGAATGG - Intergenic
940207345 2:151217546-151217568 CTCAGGGTGTGGTGGGGGAGGGG + Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940834653 2:158507554-158507576 CTCTGCTTTTGGAGGGAGAATGG + Intronic
941012977 2:160322304-160322326 CTCTGAGTATGGAAGAAGAAGGG + Intronic
942735472 2:179106337-179106359 CTTTGGGTAGGATGTGAGAAGGG + Exonic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
945053921 2:205851258-205851280 CTCATGGAATGTTGGGAGAATGG - Intergenic
946096798 2:217281489-217281511 GGCTGGGTGTGGTGGGAGACCGG - Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
947366691 2:229403733-229403755 ATATGGGTATGGTGGGTGTAGGG + Intronic
948070136 2:235114208-235114230 CTCTGCCTAGGGTGGGAGGAAGG - Intergenic
948831091 2:240598586-240598608 CTCGGGGTGGGGTGTGAGAAGGG + Intronic
1169274575 20:4224856-4224878 GTCTCTGTATGGTGGGAGGAGGG - Intronic
1169451704 20:5717528-5717550 TTCTAGGTTTGGTGGGAGACGGG - Intergenic
1169514872 20:6304693-6304715 CTCAGTTTATGGTGGGATAAAGG - Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1169649091 20:7846823-7846845 ATCTGGTTTTGGTGGAAGAAGGG - Intergenic
1169992277 20:11516668-11516690 ATCTGGGTGTGGTGAGATAATGG + Intergenic
1170728316 20:18948974-18948996 GTCTGGCCATGGTGGGAGGATGG + Intergenic
1172832177 20:37845381-37845403 CTCTGTGAATGCTGGGAGAGTGG - Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174461248 20:50684502-50684524 CTCTGGGCAAGGTGGGACCAGGG + Intronic
1174556398 20:51398432-51398454 CTCAGGGTTGGGCGGGAGAAGGG - Intronic
1175134085 20:56809979-56810001 CTGTTGGTTAGGTGGGAGAAGGG - Intergenic
1175436967 20:58959775-58959797 GTCTGTGTATGGTTGGGGAATGG - Intergenic
1175648387 20:60695423-60695445 ATCAGGGTCTGGTGGGAGAGTGG - Intergenic
1176876445 21:14134761-14134783 CTTTGTATATGGTGGGAGACAGG - Intronic
1178245777 21:30950668-30950690 CTCTGTGTATGGTGTGAGGTAGG - Intergenic
1178600558 21:33990856-33990878 CTCTGGGAATGGTGAGAGCTGGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179896110 21:44364638-44364660 CTCAGGGTGTGCTGGGAGAATGG + Intronic
1179925617 21:44532504-44532526 TTTGGGGTATGGTGGGAGAGAGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181914339 22:26267527-26267549 CTCTGGGTAAAGAGGGAGTAGGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1183281061 22:36932935-36932957 CACTGGGGAGGGCGGGAGAAGGG + Intronic
1184070738 22:42144720-42144742 CCCAGGGTAGGGTGGTAGAAAGG + Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185323854 22:50216126-50216148 CTCTGGGTTTCTAGGGAGAATGG + Intronic
949537359 3:5006273-5006295 CTCTGGGTGTGCGGGGAGCAGGG - Intergenic
949790586 3:7787690-7787712 CTCTGGGTATAATGAGAAAATGG - Intergenic
949961416 3:9315286-9315308 TTCTGGGATTGGTGGGAGAGAGG - Intronic
952734143 3:36671636-36671658 TTTTGTGTATGTTGGGAGAAAGG - Intergenic
953099692 3:39811771-39811793 CTGCGTGTATGGTGGTAGAAGGG + Intronic
953675093 3:44994834-44994856 TGCTGGCTATGGTGGAAGAATGG + Intronic
954056111 3:48027359-48027381 CTCTGGGCTTGGTGGGAGTTGGG - Intronic
954220710 3:49151952-49151974 GTCTGCCTATGGTGGGAAAAGGG + Intergenic
955802319 3:62699112-62699134 CTCGGGATAGGGTGGGAGAGGGG - Intronic
956808140 3:72837238-72837260 CTCTGGGTATGGGGAGTGGAGGG + Intronic
958068428 3:88576527-88576549 GTCTGGGTATTGTGGAACAATGG + Intergenic
959014897 3:101122681-101122703 CTCATGGTATAGTTGGAGAAGGG + Intergenic
959138414 3:102454407-102454429 TTCAGGGCATGGTGGGAGACAGG - Intronic
960013760 3:112862060-112862082 GTCTGTGTGTGGTGGGGGAATGG - Intergenic
960123304 3:113969519-113969541 TTTTGTGTATGGTGAGAGAAAGG + Intronic
960565766 3:119130193-119130215 CACTGGGACTGGTTGGAGAATGG + Intronic
960964017 3:123092130-123092152 CCCTGAGTATGGTGGGATCAGGG + Intronic
962915177 3:139894716-139894738 GGTTGGGTATGGTGGGAGACAGG + Intergenic
962920508 3:139946364-139946386 CTCTGGGTTTGGTGGTAGACAGG + Intronic
964480352 3:157133080-157133102 CTTTGTGTGTGGTGGAAGAAGGG - Intergenic
965903786 3:173677258-173677280 CTTTGGGTCTGGTGAGAGACAGG - Intronic
969315846 4:6380966-6380988 CCCTGGGTCTGGTGGGAGGTGGG - Intronic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971233472 4:24819639-24819661 CTCTAGGCATGGTGGCAGAGAGG - Intronic
972050398 4:34725335-34725357 CTCTTGGTTTAGTGGGAAAAAGG - Intergenic
972434749 4:39022248-39022270 CTTTGGCTATGGGTGGAGAAAGG - Intronic
972685216 4:41346014-41346036 CTCTGGGTATGTGGGGGGAAGGG - Intergenic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
975552276 4:75625950-75625972 ACCTGGGTTTGGTTGGAGAAGGG - Exonic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
979792949 4:124808975-124808997 CTCTGTGAAAGGTGAGAGAAGGG + Intergenic
980709886 4:136551285-136551307 CACTGGGTATTGTGGGTGACTGG - Intergenic
986598795 5:9450500-9450522 CTATGATTATGGAGGGAGAATGG - Intronic
987434740 5:17881320-17881342 CTCTGGGGATACTGGGGGAAAGG - Intergenic
987704910 5:21450342-21450364 CTCTGAGTATTCAGGGAGAAGGG + Intergenic
988022235 5:25635849-25635871 TTTTGTGTATGGTGTGAGAAAGG + Intergenic
988396445 5:30702064-30702086 TTCTTCGTATGGTGGCAGAAAGG - Intergenic
988990796 5:36668849-36668871 CTCTCCCTATGGTGTGAGAAGGG + Intronic
990362810 5:55038518-55038540 GTCTGGGTATGAGGGGATAAAGG - Intergenic
992190764 5:74289450-74289472 CTCTGGGTATGTTGACAGCAAGG + Intergenic
992563519 5:77975203-77975225 CTCTGTGTGTGGTAGCAGAAAGG - Intergenic
992954982 5:81899170-81899192 AGCTGGGGATGTTGGGAGAATGG + Intergenic
993311722 5:86340522-86340544 ATCTGTATATGGTAGGAGAAAGG - Intergenic
993677351 5:90832769-90832791 TTCTGTGTATGGTGAGAGATAGG + Intronic
993689580 5:90982826-90982848 CTCTGCATGTGGTGGGAGGAGGG + Intronic
996234606 5:121109967-121109989 CATTAGGTATCGTGGGAGAAAGG - Intergenic
996324582 5:122258529-122258551 CTCTGCGTAGGGAGGGAGAGTGG + Intergenic
996620988 5:125502376-125502398 TTCTGGATATGGTGTGATAAAGG + Intergenic
997227605 5:132220864-132220886 GTCTTGCTCTGGTGGGAGAAGGG + Intronic
997511500 5:134457910-134457932 CTCTGGCTTTGGGTGGAGAATGG + Intergenic
998229145 5:140348343-140348365 CTCTGGCGAGGGTGGGGGAAAGG - Intergenic
998496911 5:142598798-142598820 CCACGGCTATGGTGGGAGAAGGG + Intronic
999231811 5:150066140-150066162 CTCTTGGGATGGTGGAAGGAGGG - Intronic
999317507 5:150593847-150593869 GTCTGGGTTTGGTGGGTAAATGG + Intergenic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
1001847338 5:174933824-174933846 GTCTGGGTATGCTGGTAGAGAGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003342722 6:5237372-5237394 CTCTGGGGATGATGGGAGACAGG - Intronic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1004878681 6:19983692-19983714 CTCGGAGAATGCTGGGAGAAAGG + Intergenic
1005741403 6:28794257-28794279 CTCTGGATATGAGGGAAGAAAGG + Intergenic
1005855372 6:29857952-29857974 TTCTGTATATGGTGGGAGACAGG - Intergenic
1006415616 6:33902056-33902078 CTCTGGGAATTGGGGGAAAAGGG + Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007397816 6:41587451-41587473 GGCAGGGTATGGTGGGAGAGGGG - Exonic
1008250685 6:49236133-49236155 CTCTGGGGACCCTGGGAGAAGGG - Intergenic
1010308699 6:74356275-74356297 CTCTGAGTCTGTTTGGAGAAAGG + Intergenic
1010379013 6:75205729-75205751 CTCTGGGAATGATGGGGGTAGGG + Intronic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014074436 6:117220184-117220206 CTCAGGTGATGGTGGTAGAAGGG + Intergenic
1014227453 6:118864206-118864228 CTCGGGGAATGGTGGGAGTGGGG - Intronic
1014510750 6:122319009-122319031 CACTGGGTATAGTGGGACACAGG + Intergenic
1018292815 6:162310334-162310356 CTCTGGCTATGGTGGGGAACTGG - Intronic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018665419 6:166132443-166132465 TTCTGGCTATGGAGGGAGATGGG - Intergenic
1018799261 6:167210045-167210067 TCCTGGGCATGGTGGGAGGAAGG - Intergenic
1019114224 6:169744632-169744654 CTCAGGGTAGGGAGGAAGAAAGG - Intronic
1019409674 7:901030-901052 GTCTTGGGGTGGTGGGAGAAGGG + Intronic
1019498734 7:1353697-1353719 CTCGGGATATGGTGGGATAAAGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023408664 7:39864106-39864128 CTCTGGGGGTGATGGGAGACAGG - Intergenic
1024441413 7:49422983-49423005 CTCTGGTTTTGGTGGGGGTATGG + Intergenic
1024655919 7:51451332-51451354 CACTGGGAATACTGGGAGAAAGG + Intergenic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1028327758 7:89547885-89547907 CTTTGGGTTTTGTTGGAGAAAGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029095571 7:98082580-98082602 ATCTCTGTCTGGTGGGAGAACGG - Intergenic
1029436295 7:100565826-100565848 CTCTGGGGATGGTGGGGGTCAGG - Exonic
1030706842 7:112701590-112701612 CTCTGGTCATTGTGGGGGAAGGG + Intergenic
1031508499 7:122618490-122618512 AATAGGGTATGGTGGGAGAAGGG + Intronic
1031526911 7:122833507-122833529 AGCTGGGTGTGGTGGGAGGACGG - Intronic
1034279905 7:149846030-149846052 CTCTCGGCATGGTGAGATAAGGG - Intronic
1037010207 8:13832500-13832522 TTCTGTGTATGGTGTAAGAAAGG + Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1038048568 8:23788284-23788306 CACTGTGTAGGGTGGGAGGAGGG + Intergenic
1038612360 8:29068636-29068658 CTCTGGGAATGGTGGCGGACGGG - Exonic
1038724643 8:30069695-30069717 CTCTGGTAACGGTGGGAAAATGG + Exonic
1041390530 8:57343640-57343662 CTCTGGGCAGGCTGAGAGAATGG - Intergenic
1042598399 8:70473573-70473595 GTCTGGGGCTGGGGGGAGAAGGG - Intergenic
1043486642 8:80704592-80704614 CTCTGGGGGTGGTGGGGGAAAGG + Intronic
1046697432 8:117357637-117357659 GGCTGGGTTTGGTAGGAGAATGG + Intergenic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1047641797 8:126828559-126828581 CTATGGGTGTGGTGGGAGTTGGG - Intergenic
1047649834 8:126908706-126908728 CTATGGATGTTGTGGGAGAATGG + Intergenic
1047758043 8:127933637-127933659 CTCTGGGTTTGGTGGGACCTTGG + Intergenic
1047996314 8:130339940-130339962 CTCTGTGTATGGTGGAAGTGAGG - Intronic
1049172383 8:141169604-141169626 CTCTGGGGAGGGAGGGAGAGAGG - Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049680454 8:143915720-143915742 CTCTGGGTAGACTGGGAGAGAGG + Exonic
1050165262 9:2758583-2758605 CTCTGGGTTGGGTGGCAGCAGGG + Intronic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1052043307 9:23766252-23766274 CTCTTGTTACAGTGGGAGAACGG - Intronic
1052699486 9:31920761-31920783 ATCTGGGGATGATGGGAGACAGG - Intergenic
1053312795 9:37029952-37029974 CTCTCGGGATGGTGGGGGAGGGG + Intronic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056514875 9:87340618-87340640 CTCAGGGTTGGCTGGGAGAATGG - Intergenic
1057002907 9:91529270-91529292 TTCTTGCTATGGTGGGAAAAGGG + Intergenic
1057495727 9:95559634-95559656 CTCTCAGTCTGGTGGGAGACAGG + Intergenic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1057971385 9:99561608-99561630 CCCTGGGGAGGGTGGGAGGATGG - Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060962449 9:127690645-127690667 GTCTGGGTATAGTGGAAGCAGGG - Intronic
1186621570 X:11246404-11246426 CACTGGGGACAGTGGGAGAAAGG + Intronic
1188811742 X:34659730-34659752 CTCTGGGGAAGGTGGCAGTAAGG + Intergenic
1189390213 X:40570284-40570306 CACTGGGGATGGGGAGAGAAGGG - Intergenic
1189415311 X:40807525-40807547 GGCTGGGAATGGTGGGAGAAAGG - Intergenic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1191838013 X:65486089-65486111 CTCTCAGTAGGGTGGGAGATAGG - Intronic
1193857120 X:86616935-86616957 TTCTGTATATGGTGTGAGAAAGG + Intronic
1194691171 X:96987108-96987130 GTCTGGGTCTGGTGAGAGAAGGG - Intronic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198022776 X:132675551-132675573 ATCTGGGTGGGCTGGGAGAATGG - Intronic
1202189966 Y:22231540-22231562 TTCTGGCTATGGTTGGAAAAGGG + Intergenic