ID: 1121091577

View in Genome Browser
Species Human (GRCh38)
Location 14:91186666-91186688
Sequence ATGCCCATGATGACTTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121091575_1121091577 24 Left 1121091575 14:91186619-91186641 CCATAAACAATGCTGTAATGAAC 0: 1
1: 6
2: 11
3: 56
4: 298
Right 1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 149
1121091576_1121091577 -1 Left 1121091576 14:91186644-91186666 CCTTATGACTAAGTTTGTGAACA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121091577 Original CRISPR ATGCCCATGATGACTTTGTT AGG Intronic
900750553 1:4394474-4394496 ACGCCCATGATGACTCTGGTGGG - Intergenic
902087513 1:13874797-13874819 GTCCCCATGATGACTTTTATGGG + Intergenic
907326744 1:53643317-53643339 AGGCCCATTATGACTTTGGTTGG + Intronic
908502346 1:64756823-64756845 ATGACCCTGATGGTTTTGTTTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909751319 1:79165206-79165228 ATGGAGATGATGAATTTGTTGGG + Intergenic
910993101 1:93076370-93076392 ATGCGCATAATGAATTTTTTGGG + Intergenic
911871131 1:103100724-103100746 TTGTCCATGTTGACTTTGCTGGG - Intronic
912472886 1:109917646-109917668 TTGCTCATGATGACATTGTCAGG - Intronic
912530048 1:110313965-110313987 ATGTCCAAAATGACTTTGTAAGG + Intergenic
912765559 1:112406525-112406547 ATGATAATGATGAATTTGTTGGG + Intronic
916570585 1:166022855-166022877 CTCCCCATGATGTCTTTGTTAGG + Intergenic
917065279 1:171086333-171086355 ATGCACATGATGCCTTTCATTGG - Intergenic
923489068 1:234466943-234466965 AGTCCCATGATGACTTCCTTAGG - Intronic
1064811894 10:19209319-19209341 ATGCAAAAGATGACTTTGATTGG + Exonic
1065369346 10:24967602-24967624 ATGCCTTTGATGACCTTGATTGG + Intergenic
1071151075 10:82635413-82635435 ATGCCCATGATGGAGTTGCTGGG + Intronic
1073433578 10:103502578-103502600 ATGCCCAATATGACTATATTTGG - Intronic
1073793713 10:106965068-106965090 AGGTCCTTGATGACATTGTTGGG - Intronic
1074158688 10:110819664-110819686 ATAGCCAAGATGACTCTGTTGGG + Intronic
1080212627 11:29804580-29804602 ATGACAATCATGACTTTGTCAGG + Intergenic
1083101958 11:60317461-60317483 ATGCCCATGATTAGTTTTGTTGG - Intergenic
1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG + Intronic
1084410875 11:69005306-69005328 ATCTCCATGGTGACTGTGTTGGG + Exonic
1085760950 11:79241143-79241165 AATACCATGATGAGTTTGTTTGG + Intronic
1086793539 11:91071554-91071576 AAGCCCATGAGCACTTTATTTGG + Intergenic
1088791528 11:113231340-113231362 TCCCCCAAGATGACTTTGTTTGG - Intronic
1088829307 11:113521919-113521941 ATGCCCAAGATGACTGTGCCTGG + Intergenic
1094005504 12:25745434-25745456 TTGTAAATGATGACTTTGTTAGG - Intergenic
1094107038 12:26824856-26824878 ACTCCCATGATGACTTTGATGGG - Intronic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1099722316 12:86380485-86380507 ATGATTATGATGACTTCGTTTGG + Intronic
1101039686 12:100742141-100742163 ATGTCCAGGCTTACTTTGTTAGG - Intronic
1103006635 12:117426101-117426123 CTGCCTATGAAGACTTTGTCCGG - Intronic
1105238414 13:18584667-18584689 TTTCCTATGATGGCTTTGTTTGG + Intergenic
1105900809 13:24751098-24751120 ATGGCCTTGATGACTTAATTTGG - Intergenic
1108048170 13:46402975-46402997 ATCCTCATGATAACCTTGTTTGG + Intronic
1108363540 13:49688869-49688891 ATGCCCATGTTGTCTTTGCTTGG - Intronic
1108983376 13:56548913-56548935 ATCCCCATGATATCTTTATTTGG - Intergenic
1109575848 13:64257159-64257181 ATCTCCATTATGTCTTTGTTAGG - Intergenic
1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG + Intergenic
1115413549 14:33103757-33103779 AAGCACAGGATGACTTTGTCCGG + Intronic
1116039315 14:39666630-39666652 CTGCCCTTGATGACATTGTGTGG + Intergenic
1116496351 14:45565233-45565255 ATGCCCATGTTGACACTGTTTGG + Intergenic
1120609401 14:86621950-86621972 TTGCCCATGATGAAATTGATGGG - Intergenic
1120727934 14:87966777-87966799 ATGCCCATGACTATTTTCTTAGG - Intronic
1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG + Intronic
1130596491 15:85253269-85253291 ATGCCCAGGATGATGTTCTTAGG + Intergenic
1134911176 16:18027959-18027981 TTCCCCATGATGCCTTTGATAGG - Intergenic
1138665006 16:58558989-58559011 ATCCCCATGATGGGATTGTTAGG - Intronic
1139380202 16:66525716-66525738 ATTCCCCTGAAGACCTTGTTGGG - Intronic
1143306235 17:5949078-5949100 ATGTCACTTATGACTTTGTTTGG + Intronic
1144215592 17:13052371-13052393 ATGCCCAAGATGATGGTGTTTGG + Intergenic
1144256061 17:13469928-13469950 ATGCCCTCTCTGACTTTGTTTGG + Intergenic
1147848080 17:43419417-43419439 ATGCTCATGAGAACTTTGTGAGG + Intergenic
1150487267 17:65552432-65552454 ATGCACACGATGACTTCCTTGGG + Intronic
1153145549 18:2027547-2027569 ATGTCCATGGTGGGTTTGTTGGG - Intergenic
1154511809 18:15112527-15112549 TTTCCTATGATGGCTTTGTTTGG + Intergenic
1155411008 18:25544874-25544896 ATGCCCATCATGGATTAGTTAGG - Intergenic
1155895397 18:31318835-31318857 ATGCAACTGATGACTTTATTTGG - Intronic
1158037965 18:53057187-53057209 CTGTTGATGATGACTTTGTTTGG + Intronic
1159401378 18:67940267-67940289 ATGGCAATAATGTCTTTGTTTGG - Intergenic
1166629879 19:44397058-44397080 CTGCTCATAATGACTTTGTGAGG - Intronic
1166637574 19:44464359-44464381 CTGCTCATAATGACTTTGTGAGG + Intergenic
1168589407 19:57620114-57620136 ATGTACATGCTGACTTTGGTGGG - Intronic
925115085 2:1371822-1371844 ATGCCCATAATGAGGTTGTGAGG - Intergenic
925749863 2:7078371-7078393 TTGCACAAGATGACATTGTTAGG + Intergenic
927112697 2:19875520-19875542 ATAGCCATGAAGACTTTGTGTGG + Intergenic
927341973 2:21992931-21992953 ATGGACATGAGGAATTTGTTGGG - Intergenic
928069228 2:28198091-28198113 ATGCTTATGTTGACTTGGTTTGG + Intronic
928622510 2:33105142-33105164 GTGCCTATGATGACTTTGGGAGG - Intronic
931920190 2:67006812-67006834 ATGCCCATATTCACTCTGTTCGG + Intergenic
934551939 2:95268048-95268070 ATGCCCAGGATGCTTTTGTAAGG - Intergenic
936773653 2:115945915-115945937 AGGCACATGAAGACTTTTTTGGG + Intergenic
937841962 2:126533352-126533374 GTGCCCATGAGTACTTTGGTTGG - Intergenic
938543877 2:132309439-132309461 TTGCTCATAATGACTTTGTGAGG + Intergenic
939903932 2:147886844-147886866 ATGCCAATGATAAAATTGTTAGG + Intronic
940855444 2:158725418-158725440 ATCCCCATTATGACTTTATCAGG - Intergenic
943398066 2:187367022-187367044 TTGCCCATAATGATATTGTTTGG - Intronic
945692760 2:213061441-213061463 ATGTCCATTATGACATTGATTGG - Intronic
948325780 2:237119623-237119645 ATGTCCAGGATAATTTTGTTAGG - Intergenic
1169669024 20:8074467-8074489 ATGACCCTGATGAATTTGGTTGG - Intergenic
1171215291 20:23348222-23348244 AGGCTCTTGATGACTATGTTGGG - Intergenic
1171365500 20:24620245-24620267 ATGCTCATGATTTCTTTGGTTGG + Intronic
1171955326 20:31457548-31457570 ATACCGATGATTACTTTTTTGGG - Intergenic
1172847925 20:37941002-37941024 ATGCGCATGATGATATGGTTTGG - Intronic
1174722101 20:52823822-52823844 ATGCTCATGTTTGCTTTGTTGGG - Intergenic
1176782402 21:13212948-13212970 TTTCCTATGATGGCTTTGTTTGG + Intergenic
1177980095 21:27902658-27902680 TTTCCCATGATGGCTTTGTTTGG - Intergenic
1181819434 22:25463938-25463960 ATGCCCATGTTGAATATGTAAGG - Intergenic
1183444981 22:37847674-37847696 AGGACCATGAGGACATTGTTGGG + Intronic
949833677 3:8244803-8244825 AAGGCCATGATGACTTTCCTAGG + Intergenic
950204597 3:11069121-11069143 ATGCCTAGGCTGCCTTTGTTGGG + Intergenic
950365549 3:12480934-12480956 ATGCCCATGGTGTCATTGCTAGG - Intergenic
951489458 3:23253334-23253356 ATACCCATGATGACTGTGATAGG + Intronic
952224394 3:31359556-31359578 ATGCCAACGATGACTTTGCTAGG - Intergenic
952242262 3:31544114-31544136 ATGCACATGATGAATTTGGGTGG + Intronic
953040138 3:39249089-39249111 ATGGCCATGATGGCTAAGTTGGG - Intergenic
953154352 3:40355461-40355483 ATACCCAATATGACTGTGTTTGG + Intergenic
953193921 3:40714354-40714376 ATGAGCATGATGATTTTTTTAGG - Intergenic
955390920 3:58521660-58521682 ATGCCTTTGCTGAGTTTGTTTGG - Intronic
961910094 3:130305577-130305599 CTGACAATGATGACTTTGTTTGG + Intergenic
962141483 3:132795123-132795145 AAGCCCATGAGGCCTTTGCTGGG - Intergenic
962216970 3:133531097-133531119 AATCCCATGAGGAATTTGTTTGG - Intergenic
963832140 3:150019714-150019736 ATGGCAATGATGAGTTTATTCGG - Intronic
963938222 3:151076065-151076087 ATCCCCATGATGAATTTGGTGGG - Intergenic
963944997 3:151135946-151135968 ATGCGCATGAGGTCTTTTTTGGG + Intronic
964485643 3:157182923-157182945 ATGCCCATAATGCCTTTCTGAGG - Intergenic
966953022 3:184841538-184841560 GTGTCCATGATTACTTTTTTAGG + Intronic
967297824 3:187982620-187982642 ATGCTCATGATAACTCTGTGAGG - Intergenic
967532469 3:190564884-190564906 AGGCCCATGATGACTGAGTTTGG - Intronic
973033478 4:45374001-45374023 TTGCCCTTGATGACTTAGATTGG + Intergenic
974110810 4:57523412-57523434 ATGGACATGAGGAATTTGTTGGG + Intergenic
974156062 4:58074369-58074391 ATACCCATAATGAGATTGTTGGG - Intergenic
976025378 4:80681787-80681809 AAGCCCATGAATACTTTGTGGGG + Intronic
978228757 4:106371518-106371540 ATGTTCATGATGTTTTTGTTTGG + Intergenic
982822751 4:159964545-159964567 ATGTCCATTCTGTCTTTGTTGGG + Intergenic
984659226 4:182355311-182355333 ATCACCATGAAGACTTTGCTCGG - Intronic
988546244 5:32160768-32160790 TGGCCCATGATTACTTTTTTAGG - Intronic
990968717 5:61479347-61479369 TAGCCCATGAGGAATTTGTTGGG + Intronic
993176779 5:84496735-84496757 ATGCCCATGATTAGTTTATATGG - Intergenic
993952620 5:94194964-94194986 ATCCTCATGATGACTCTGTGGGG + Intronic
994164751 5:96597030-96597052 ATGCCCAATATGACTGTATTAGG - Intronic
996306395 5:122053039-122053061 ATGCCCATGTTTCTTTTGTTGGG + Intronic
1001924491 5:175626479-175626501 GTGTCCCTGATGACTTGGTTTGG - Intergenic
1003972841 6:11315507-11315529 ATGCCAAAGAAGAATTTGTTGGG + Intronic
1004636272 6:17471071-17471093 AGTCACATGATTACTTTGTTTGG - Intronic
1007291842 6:40793490-40793512 CTGACCATGATGCCTCTGTTGGG - Intergenic
1008912652 6:56752451-56752473 AGGCACAAGATAACTTTGTTGGG - Intronic
1012018870 6:93890340-93890362 ATGCTCATGTTGCCTTTTTTTGG + Intergenic
1018501400 6:164414376-164414398 ATGCCGATGATGACAGTGGTGGG - Intergenic
1020787804 7:12591839-12591861 ATCTCCATGATGACTTACTTAGG - Intronic
1023627331 7:42129269-42129291 TTGCCCATAATCACATTGTTAGG + Intronic
1024634146 7:51273514-51273536 ATGTCAATGATGACTTCCTTAGG - Intronic
1027450160 7:78322241-78322263 ATACCCATGATGAGATTGCTGGG - Intronic
1027929757 7:84517307-84517329 ATGCACATGATGCCTTTGGTGGG + Intergenic
1029147684 7:98458472-98458494 ATCCCCAGGCTGACTTTGGTGGG - Intergenic
1029807372 7:103010885-103010907 ATGCCCATGTTTCTTTTGTTGGG - Intronic
1031188296 7:118512228-118512250 ATCCCCAAGATGACTATATTTGG + Intergenic
1033142153 7:138837304-138837326 ATGCGGGTGATGGCTTTGTTTGG + Intronic
1040067678 8:43161386-43161408 ATGTTCATGATGACATTTTTGGG + Intronic
1040832148 8:51689168-51689190 ATGCCCAAGAAGACTCTGTGTGG - Intronic
1044222562 8:89686360-89686382 ATCCACATGCTGACTTTCTTGGG - Intergenic
1045128470 8:99121321-99121343 ATGGCGAGGAAGACTTTGTTGGG + Exonic
1049170052 8:141154303-141154325 ATGCACATGATGACTTGGAGAGG - Intronic
1049919059 9:346372-346394 ATGCCCTTGAAGACCTTGCTGGG - Intronic
1051630457 9:19135885-19135907 ATGCCCAGGAAGGCTTTCTTAGG - Intronic
1052788961 9:32856223-32856245 ATGCCAATTATGACATTATTTGG - Intergenic
1055090335 9:72358538-72358560 TTGCCCGTGATGCCTTTGTTTGG - Intronic
1055254106 9:74345601-74345623 ATTCCCATGATGTCTTTCTTGGG + Intergenic
1056805885 9:89728712-89728734 ATGAAGATGATGACTTTTTTAGG - Intergenic
1057176474 9:93004034-93004056 ATGCCCATGATGACTTCTGGAGG - Exonic
1058994064 9:110282404-110282426 GTGCCAATGAGGACTTTGCTAGG + Intergenic
1059761512 9:117342166-117342188 AGACCCAGGATGCCTTTGTTCGG - Intronic
1187358797 X:18604735-18604757 ATGCCTATGAGGACGTTGCTGGG - Exonic
1188295660 X:28445175-28445197 ATGCATATAATGACTTTGTGTGG + Intergenic
1189678153 X:43485545-43485567 ATGTCCTTGCTGACTTTTTTTGG - Intergenic
1192849657 X:74941930-74941952 ATGCCCATGTTTCTTTTGTTGGG + Intergenic
1195082201 X:101382103-101382125 ATTCCCAAGATGCTTTTGTTCGG + Intronic
1195942599 X:110178252-110178274 CAGCCCATGATGACTGTGATTGG + Intronic
1198082791 X:133254882-133254904 GTGCCCATGGTGATTTGGTTGGG - Intergenic
1198634439 X:138680215-138680237 ATCCTCCTGATGACTTTGATGGG - Intronic
1199688793 X:150290496-150290518 ATGCACCCCATGACTTTGTTGGG + Intergenic
1200367511 X:155682919-155682941 ATCCTCATGATGACTTTGAGGGG + Intergenic
1201617999 Y:15923184-15923206 CTACCCAAGATGACTTGGTTTGG + Intergenic