ID: 1121091783

View in Genome Browser
Species Human (GRCh38)
Location 14:91187986-91188008
Sequence CAGGGAAAACATAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 455}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121091783_1121091790 21 Left 1121091783 14:91187986-91188008 CCTTCCCTCTTATGTTTTCCCTG 0: 1
1: 0
2: 1
3: 41
4: 455
Right 1121091790 14:91188030-91188052 GTGCTGTAACCTAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 13
4: 149
1121091783_1121091791 22 Left 1121091783 14:91187986-91188008 CCTTCCCTCTTATGTTTTCCCTG 0: 1
1: 0
2: 1
3: 41
4: 455
Right 1121091791 14:91188031-91188053 TGCTGTAACCTAGAAGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121091783 Original CRISPR CAGGGAAAACATAAGAGGGA AGG (reversed) Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
901095765 1:6678136-6678158 CAAGTAAAACGGAAGAGGGATGG - Intronic
901588645 1:10319988-10320010 GAGGGAAGAAATAAGAGGGCAGG - Intronic
902039800 1:13484294-13484316 CAGAGAAAAACAAAGAGGGAAGG - Intronic
903331618 1:22599782-22599804 GAGGGAAAAGAAAGGAGGGAAGG + Intronic
903368230 1:22817974-22817996 CAGGGAAAAGATAAATGGGCTGG - Intronic
904903359 1:33875251-33875273 CAGGGCAAACATAAGGGGCGGGG + Intronic
905204407 1:36334901-36334923 CAGGCAAAGGATAAGAGTGAAGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
905898084 1:41561994-41562016 CAAGGAAGAAAGAAGAGGGAAGG + Intronic
906973541 1:50544727-50544749 GAGGGAAAACAAAGCAGGGAAGG + Intronic
907103575 1:51859680-51859702 TAGGAAAAACATCAGAGGGGAGG + Intronic
907133422 1:52117471-52117493 CAGGGAAAAAACCAGAGGGATGG + Intergenic
907922743 1:58928740-58928762 CTCTGAAAAGATAAGAGGGAGGG - Intergenic
908558595 1:65282681-65282703 CAGGAGACACATAAGAGGAAAGG - Intronic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908973256 1:69864133-69864155 AAGAGAGCACATAAGAGGGATGG - Intronic
909336528 1:74480997-74481019 CAGGGTACACATGAGTGGGAGGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910219801 1:84878843-84878865 CAAGGAAAACACCAGAGAGAGGG - Intronic
910591710 1:88933379-88933401 AAGGGAAAAGAGAGGAGGGAGGG + Intergenic
911645067 1:100328964-100328986 CAGGGAGAAAGAAAGAGGGAGGG - Intergenic
912758721 1:112346935-112346957 CAGGGAAAACCTCAGAGAAAAGG + Intergenic
913995414 1:143648451-143648473 CAGCGAAAACAAAAGTGAGATGG + Intergenic
914360857 1:146934741-146934763 CAGCGAAAACAAAAGTGAGATGG - Intergenic
914491728 1:148155896-148155918 CAGCGAAAACAAAAGTGAGATGG + Intergenic
914713875 1:150238222-150238244 AGGGGAAAAGAGAAGAGGGAGGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
917211518 1:172636592-172636614 CAGGAGGAAGATAAGAGGGAGGG - Intergenic
918187469 1:182141078-182141100 CAGGGAAAACAGCACAGAGAAGG + Intergenic
918293679 1:183134740-183134762 CAGAGAAGATATGAGAGGGAAGG + Exonic
918934334 1:190900768-190900790 CAGAAAAAAAATGAGAGGGAAGG + Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
920004632 1:202823980-202824002 GAAGGAAAGCAGAAGAGGGAAGG + Intronic
920288910 1:204902735-204902757 AAAGGAAAAAAGAAGAGGGAAGG + Intronic
921303746 1:213774694-213774716 CAAGCAAAGCATAAAAGGGAAGG - Intergenic
921513262 1:216058306-216058328 TAGGGAAAACCTAACAGAGATGG - Intronic
921551087 1:216536519-216536541 CAGGGAAATCATAAGTTGGGAGG - Intronic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923198460 1:231689988-231690010 AAGGGAGAACATAAGAGGGAGGG + Intronic
923639232 1:235736875-235736897 GAGGGAAAAAATAAGAGGAGCGG + Intronic
924277681 1:242404849-242404871 CAGGGAACAGATAAGAGGCATGG - Intronic
924525794 1:244846821-244846843 CAAGGAAAACCAAAGAGGGAGGG - Intronic
1062886981 10:1024166-1024188 AAGAGAAAACATCAGTGGGAAGG + Intronic
1063156305 10:3382218-3382240 GAGGGAAAAGAAGAGAGGGAGGG + Intergenic
1063374676 10:5547054-5547076 CAGACAAAACATAAAAGGGCGGG - Intergenic
1064122284 10:12630262-12630284 AAGGGGAAACAAAAGAGAGAAGG - Intronic
1064581782 10:16800035-16800057 CAGGGAAAATCTAAGAGAAAAGG + Intronic
1064796940 10:19022766-19022788 CAGGGAAAACAAAAGATTGTGGG - Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065225259 10:23537105-23537127 CTGGGAAAACCTAAGAGGCTAGG - Intergenic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065604191 10:27399390-27399412 CAGGGAAAGCATCACAGAGAAGG - Intronic
1065660838 10:28002828-28002850 CAGGGAGAAAGTAAGAGGCAAGG + Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1068833601 10:61526399-61526421 TAGGATAAACATAAGAGTGAAGG - Intergenic
1068941679 10:62686890-62686912 CAGGGAGAAAAAAAGAGGCAAGG + Intergenic
1069281342 10:66658495-66658517 CAGTGAAAATATAAGAGAGGAGG + Intronic
1069286883 10:66725989-66726011 CAGGAAAAACAAAAGCGGTATGG + Intronic
1070270359 10:74948140-74948162 CAGGGAAAACAAAAGAAGTCAGG + Intronic
1070397644 10:76025349-76025371 CAGGACAAGCATAGGAGGGATGG + Intronic
1070438622 10:76419244-76419266 CAGGGAATAGTTAGGAGGGAGGG - Intronic
1070460162 10:76658936-76658958 CATGTAAATTATAAGAGGGAGGG + Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071955312 10:90751312-90751334 GAGGGAAAAGGGAAGAGGGAGGG + Intronic
1074520875 10:114222716-114222738 TAGGGAAAATATTTGAGGGAAGG + Intronic
1074623729 10:115154567-115154589 CAAGGAAAACAAAAAAGGGCAGG - Intronic
1076500340 10:130931511-130931533 CACGGAAGAGATGAGAGGGAAGG + Intergenic
1077479850 11:2808427-2808449 CAGGGAAGACCTCCGAGGGAGGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078262278 11:9721165-9721187 AAGGGAAAAGGGAAGAGGGAAGG - Intronic
1078328887 11:10402402-10402424 CAGGGAAAAAAAAAGATGGGAGG + Intronic
1079325296 11:19486124-19486146 CTGGGCAAACATCAGAGGAAGGG - Intronic
1079730362 11:23933356-23933378 CAGGAAAAAGACAAAAGGGATGG - Intergenic
1079746879 11:24143675-24143697 CAGGCAAAATATAAAAGGAAGGG - Intergenic
1080218029 11:29867884-29867906 CAGGGAACATGTAACAGGGACGG - Intergenic
1080344699 11:31311351-31311373 CAGGGAAAATATAATTGGGTGGG + Intronic
1080357736 11:31471333-31471355 CAGGGAACACTTCAGAGGGAAGG - Intronic
1080742020 11:35074755-35074777 ATGGGAAGACATGAGAGGGAGGG + Intergenic
1081687231 11:45051545-45051567 CAGGGACGACAAGAGAGGGAAGG + Intergenic
1081956840 11:47100214-47100236 CAGGGAATAAATTTGAGGGAGGG - Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083619048 11:64039977-64039999 AAGGGAAAACAGAAGAGCCAGGG - Intronic
1084155655 11:67311271-67311293 CAGAGAAAGCATAGGAGGGGAGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086526945 11:87738775-87738797 GAGGGACAACAAAAGAGGAATGG - Intergenic
1086915382 11:92524069-92524091 CGGGGAAAAAGTAAGAAGGAGGG + Intronic
1086954188 11:92918851-92918873 CAGTGAAAACCAAGGAGGGAGGG + Intergenic
1087564295 11:99834778-99834800 CAGGGATAACAAAAGAGTAAGGG + Intronic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088371505 11:109093327-109093349 CAAGGAATACATTATAGGGAAGG - Intergenic
1088675513 11:112188689-112188711 CAGGGAAAGGTCAAGAGGGAAGG - Intronic
1088688400 11:112304368-112304390 CAGGAAAAACAAAGAAGGGAGGG - Intergenic
1089717441 11:120375371-120375393 AAGAGAAAACATAAAAGGAAAGG - Intronic
1089781117 11:120873980-120874002 GAGGGAGAAAATAAGAGGAATGG - Intronic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090164997 11:124537169-124537191 CAAAGAAAGCATAAGAGAGAAGG + Intergenic
1090350723 11:126106075-126106097 CATGGAGAACAGCAGAGGGAGGG - Intergenic
1091272355 11:134326583-134326605 AAGGGAATACATAAATGGGATGG - Intergenic
1091436297 12:475635-475657 CAGGGAAGAGATGAGAGAGAAGG - Intronic
1092132318 12:6121134-6121156 CAGGGAGGACTTCAGAGGGAGGG - Intronic
1092227350 12:6756434-6756456 GAGGGAAAAGACAAGAGGGATGG - Intronic
1092314798 12:7399174-7399196 AAAGGAAAAGAAAAGAGGGAGGG - Intronic
1092380765 12:7995200-7995222 CAGGGAGAAGATAAAAGGAAAGG - Intergenic
1095262805 12:40116835-40116857 CAAGGACAACATCAAAGGGATGG + Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097282643 12:57854200-57854222 CAGGGAAAACAGAGGAGGAGGGG + Intergenic
1099354817 12:81621072-81621094 CAGGGAGAAAATCAGAGAGAAGG + Intronic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099633298 12:85177874-85177896 CAGGGAAAACATAATAGATATGG + Intronic
1099663746 12:85599299-85599321 CATGAAAAACATAATAGGTAGGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100556145 12:95695918-95695940 AAGAGAAAAGAAAAGAGGGAGGG - Intronic
1100653174 12:96612707-96612729 CATGGAAAACATAAAAAGGAAGG + Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1103197613 12:119058833-119058855 CAGGGGAAGCCTTAGAGGGAAGG - Intronic
1104036400 12:125100342-125100364 CAGGGAAAGAAAAAGAGAGAAGG - Intronic
1104812728 12:131628429-131628451 CTGGGAAGTCATAACAGGGAAGG + Intergenic
1105474684 13:20719962-20719984 CAGGAGAAAAACAAGAGGGAGGG - Intronic
1105800083 13:23895199-23895221 CAGGGGAACAAAAAGAGGGAAGG - Intronic
1105848944 13:24317795-24317817 CAGGGAAACAAAAAGAGGGAAGG + Intronic
1107619437 13:42211192-42211214 CAGGGAAAACTTCAGAGGGGAGG + Intronic
1107627798 13:42307673-42307695 CAGGGAGAACATAGGAGGAGTGG + Intronic
1107918212 13:45174723-45174745 CAGGGAGGACTTCAGAGGGAAGG + Intronic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1108852921 13:54757381-54757403 CAGGCAAGAGATTAGAGGGATGG + Intergenic
1109738379 13:66518172-66518194 CAGGAAAAACAGAGGAGGGGAGG + Intronic
1111039649 13:82730056-82730078 TAGGGAAAACATAAGATACAGGG - Intergenic
1112195785 13:97225006-97225028 AAGAGAAAAAACAAGAGGGAAGG + Intronic
1113178327 13:107594427-107594449 AAGAGAGAAGATAAGAGGGAAGG - Intronic
1114436950 14:22714444-22714466 TAGGAAAAACATGAGAGGGTGGG - Intergenic
1114487499 14:23071615-23071637 GAGGGGAAAGAAAAGAGGGAGGG + Intronic
1114942715 14:27634921-27634943 AATGAAAAACATTAGAGGGAGGG + Intergenic
1114970878 14:28026974-28026996 GAAGGAAAACAGAAGAGAGAAGG + Intergenic
1115945304 14:38653123-38653145 GATGGAATAGATAAGAGGGAAGG - Intergenic
1116201407 14:41802320-41802342 AAGAGAAAACATCAGAGGCAGGG + Intronic
1116232336 14:42233409-42233431 AAGTGAAAATATAAGAGGCAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117288302 14:54308574-54308596 CAGCCCACACATAAGAGGGAGGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117874591 14:60239012-60239034 CAGGGAAATCCTATGAGAGAAGG - Intergenic
1118043367 14:61940750-61940772 AAAGGAAAACCTGAGAGGGAGGG - Intergenic
1118099587 14:62581557-62581579 AAGGGATAACATATGAGGCAAGG - Intergenic
1118280061 14:64420169-64420191 CAGGGAGAAAGTGAGAGGGAGGG + Intronic
1119162487 14:72464645-72464667 CAGGGAAAACAGTAGATGAATGG - Intronic
1120648554 14:87102685-87102707 GAGGGAAAAAAGAAAAGGGAGGG - Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121454665 14:94030507-94030529 TAGGCATAAGATAAGAGGGAAGG + Intronic
1121990958 14:98556763-98556785 CAGGAAAAACATAAGAAATAGGG + Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122025439 14:98872570-98872592 AAGGGAAAATATCAGAGAGAGGG + Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124592122 15:31062942-31062964 CAGGGGAACCATCAGAGGCAGGG - Intronic
1125381006 15:39086567-39086589 CAGTGAAAACCAAAGAGGGGAGG + Intergenic
1126598525 15:50405606-50405628 AAGGGAGAAAAAAAGAGGGAAGG + Intergenic
1126832908 15:52627200-52627222 CAGAAAATACCTAAGAGGGAAGG + Intronic
1127045009 15:55016559-55016581 AAGGGAAGAAATGAGAGGGAGGG - Intergenic
1127653792 15:61036237-61036259 CAGGAAAGACATGACAGGGATGG + Intronic
1127929158 15:63579534-63579556 CAGGGAAAGGATATGAGGCAGGG - Intronic
1128469937 15:67943675-67943697 CATGGTATAGATAAGAGGGAAGG + Intergenic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130536808 15:84791468-84791490 CAGGGAAAAGATCAAAGTGAGGG + Intronic
1131671267 15:94621941-94621963 CAGGGAGAATATGAGAGGCAAGG + Intergenic
1134100963 16:11451139-11451161 CACGGAAAAAATAAGAGGGCTGG + Intronic
1134473367 16:14548657-14548679 CAGAGAAAACATCAGAGGCCGGG + Intronic
1134806083 16:17126573-17126595 CAAGGAAAATATAAGAGGGTGGG + Intronic
1135678606 16:24438349-24438371 GAGAGAAGACTTAAGAGGGAGGG + Intergenic
1135883064 16:26278137-26278159 CGGGGAGAATAAAAGAGGGAAGG + Intergenic
1136618964 16:31415385-31415407 CAGAGAGGACATCAGAGGGAAGG - Intronic
1137377829 16:47969174-47969196 CTGGGAAAAGAAAAGAGGGTGGG - Intergenic
1137781845 16:51103973-51103995 AAGGGAGAACAGAAAAGGGAAGG - Intergenic
1137813395 16:51374938-51374960 CAGGGAAAGTATAAGAGCAAGGG - Intergenic
1138250231 16:55496649-55496671 GAGGGAAAACACAATATGGATGG + Intronic
1138465137 16:57184975-57184997 CAGGGACACCATAAAATGGAAGG - Intronic
1138960422 16:62022663-62022685 CAGGGAATTCATAAAAGGGGAGG + Intronic
1140907664 16:79423050-79423072 CAGGTAAAGCCCAAGAGGGAGGG + Intergenic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1144625826 17:16844037-16844059 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1144880607 17:18428683-18428705 CAGGGAATAGAAGAGAGGGAGGG + Intergenic
1145151629 17:20515704-20515726 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1146048102 17:29527124-29527146 CAGGGAAAAAAAAAGAGGCTGGG + Intronic
1146140817 17:30366546-30366568 CTGGGAAATCCTAAGTGGGAGGG - Intergenic
1146162987 17:30569962-30569984 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1146663699 17:34682547-34682569 CAGTGAACACATCTGAGGGAGGG + Intergenic
1146747676 17:35346483-35346505 GAGGGAAATCGGAAGAGGGAAGG - Intergenic
1147124580 17:38357507-38357529 CAGGGAAAAGCCAAGAGGCATGG - Intronic
1147715283 17:42502741-42502763 GAAAGAAAACAAAAGAGGGAGGG - Intronic
1149017079 17:51920351-51920373 CAGGGAAATGATGAAAGGGAGGG + Intronic
1150537202 17:66055158-66055180 CAGGGAAAACCTGTGAGAGATGG + Intronic
1151096315 17:71503215-71503237 GAGGCAAAACAAAACAGGGATGG - Intergenic
1151179793 17:72318924-72318946 GAGGGAAAAGAAATGAGGGAAGG - Intergenic
1151532918 17:74718935-74718957 CAGGAAAAACATAAAAAGTATGG + Intronic
1152246145 17:79185529-79185551 CAGAGAAGACAAAAGAGGGATGG - Intronic
1153405737 18:4736468-4736490 CAGGGAAGACAAGAGAGGGTAGG - Intergenic
1155068929 18:22295876-22295898 AAGGGAAAGCAGAAGAGGAAAGG - Intergenic
1155310142 18:24515302-24515324 AAGAGAAAACATCAGAGGTAAGG - Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1157049500 18:44145306-44145328 CAGGGACAAGCTGAGAGGGAGGG + Intergenic
1157382760 18:47234860-47234882 CAGGGAAAAAAAAAAAGAGAGGG + Intronic
1159003004 18:62989616-62989638 CAGGGAGGACAAGAGAGGGAGGG - Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163209275 19:15828676-15828698 CCAGGAAAAGATAAGAGGGTGGG + Intergenic
1163511122 19:17735618-17735640 CAGCGGAAACTTAACAGGGATGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1165778308 19:38417825-38417847 CAGGGAAGACACCAGAGGAAGGG + Intronic
1166101701 19:40575513-40575535 GAGGGCAACCCTAAGAGGGAAGG + Exonic
1166143529 19:40818970-40818992 AGAGGAAAACATAAGAGGAAAGG + Intronic
1166184025 19:41127808-41127830 AGAGGAAAACATAAGAGGAAAGG - Intronic
1166845059 19:45722216-45722238 AAAGGAAAACTTAAAAGGGAGGG - Intronic
1168304796 19:55429578-55429600 GCGGGGAGACATAAGAGGGAGGG + Exonic
1168548702 19:57275553-57275575 CTCAGAAAAAATAAGAGGGATGG - Intergenic
925546037 2:5017726-5017748 CAGTGGAATCCTAAGAGGGAAGG + Intergenic
927225350 2:20759716-20759738 CAGAGAAGACATAACAGGGAGGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928714380 2:34043428-34043450 CAGGGAAGCAGTAAGAGGGAAGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930295864 2:49552862-49552884 CAGGGAAAAGATAATGGGAAAGG - Intergenic
930317563 2:49816327-49816349 TAGGGAAAAGATTAGGGGGATGG - Intergenic
931715137 2:65022841-65022863 CAGGGAAAACAAGGGAGTGAAGG - Exonic
933035583 2:77393375-77393397 ATGGGAAAACATAAGAGAAAAGG + Intronic
934931517 2:98429604-98429626 CAGGGGGAGGATAAGAGGGAGGG + Intergenic
935681742 2:105644295-105644317 CTGGGAAACCATAACTGGGACGG - Intergenic
935946851 2:108294394-108294416 AGGGGAAAACAGAAGAGAGAGGG - Intronic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937392326 2:121500425-121500447 AAGAGAAAAGAAAAGAGGGAAGG + Intronic
937406495 2:121634125-121634147 ATGGGAAAACTGAAGAGGGATGG - Intronic
937876523 2:126829894-126829916 CTGGGAAAACCTAAGTGGAATGG + Intergenic
940438856 2:153689920-153689942 CAGCGACAACAAAAGAGAGAGGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941158737 2:162010900-162010922 CTGGGGAAGCATAATAGGGAGGG - Intronic
941592279 2:167434712-167434734 AAGGGAAAAAATAAGGGGGGGGG - Intergenic
942033308 2:171985908-171985930 CAGGGAAAAAGTAAGAGGCCGGG - Intronic
942091239 2:172493441-172493463 CAGAGAACACTTTAGAGGGAAGG + Intronic
942377562 2:175353070-175353092 CAGTCAAAACAGAACAGGGAGGG - Intergenic
942572956 2:177331769-177331791 CAGGGAAAACATAAGAAAACTGG - Intronic
942692458 2:178600651-178600673 CAGGGAAAAGGTAACAGGTAAGG + Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943496646 2:188629160-188629182 CTGGGAAAATCTGAGAGGGAAGG + Intergenic
943852891 2:192750258-192750280 CAGGGAAAACATATAAAGGCTGG - Intergenic
944298233 2:198092008-198092030 CAGGTAAAACTAAAGAGGCAGGG - Intronic
944547041 2:200809385-200809407 CAGAGAAAAGATAAGTGGCAAGG + Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
947052980 2:226067697-226067719 AAGGAAAGACAAAAGAGGGAAGG - Intergenic
947099779 2:226607453-226607475 AAGGGCAAACATAAAAAGGACGG + Intergenic
947174694 2:227353114-227353136 AAGGGCAAAAATAAGAGAGAAGG - Intronic
947497458 2:230648352-230648374 CAAAGAAAAAAAAAGAGGGAGGG + Intergenic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948742268 2:240055760-240055782 GAGGGAAAACATATCAGGGAGGG + Intergenic
1168985741 20:2047203-2047225 CAGGGAAAAATTAAAAGGTATGG - Intergenic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1170663701 20:18366631-18366653 AAGGGAAAACAACTGAGGGAGGG + Intergenic
1171431798 20:25087616-25087638 CAGGGACAAAAGGAGAGGGAGGG + Intergenic
1172679803 20:36704505-36704527 GAAGGAAAACATTAGAGAGAGGG - Intronic
1173225017 20:41157490-41157512 GAGGGAAAACCAAATAGGGATGG - Intronic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1174013428 20:47469188-47469210 CAGAGAAAACAACAGAGGGAGGG + Intergenic
1175474000 20:59256346-59256368 CAAGAAAAACATAAGAAGGGAGG + Exonic
1175829032 20:61952007-61952029 CAGGGCAGACAAAAGAGGCATGG + Intergenic
1176740301 21:10595521-10595543 CAGGAACAAGAGAAGAGGGATGG + Intronic
1176901065 21:14442824-14442846 AATGGAAAACATAAGAAGGAAGG + Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177497878 21:21912797-21912819 AAGAGAAAACATCAGAGGTAAGG - Intergenic
1177683787 21:24410482-24410504 GATGGAAAAGATGAGAGGGAAGG - Intergenic
1178031724 21:28535297-28535319 GAAGGAAAACAAAAGGGGGAGGG + Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178379143 21:32093585-32093607 AAGGGAAAGGATAAGAGGAAGGG - Intergenic
1178500595 21:33122875-33122897 AATGGAAAACATGAGAGAGAGGG - Intergenic
1179778878 21:43686872-43686894 CAAGGAAAGCATAAGAAGAAAGG + Exonic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182829971 22:33297195-33297217 CAGGGAAAATGTAAGGGGGTAGG + Intronic
1182868973 22:33629233-33629255 CATGGAAGACATAACTGGGAAGG + Intronic
1183838937 22:40481482-40481504 CAGGGAAAACATAATAAATAAGG + Intronic
1184193650 22:42911718-42911740 CATGGCAAACATAAAAAGGAAGG + Intronic
1184447328 22:44556626-44556648 CAGGGAAAATAGAAGAGAAAAGG - Intergenic
949661677 3:6285947-6285969 AATGGAAAACAAAAGAGAGAAGG + Intergenic
951989338 3:28658432-28658454 CAAGAAAAGCATAGGAGGGATGG + Intergenic
956696548 3:71923539-71923561 CAGGGGAAACCTTACAGGGAGGG - Intergenic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957563985 3:81861685-81861707 CAGGGTAAACATAAAAGAGAGGG + Intergenic
958666702 3:97148850-97148872 CAGGGAACACATTTGAGGGGTGG + Intronic
959357484 3:105351137-105351159 CAGGTAAAACTTAATAAGGAAGG + Intergenic
960136762 3:114113528-114113550 GAGGCACAACCTAAGAGGGATGG - Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
962935476 3:140076672-140076694 CAGGGAAGACTTCAGAGAGAAGG - Intronic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963730873 3:148970813-148970835 CAGTTAAAAAATAAGGGGGAGGG - Intergenic
963800579 3:149672017-149672039 CAGGGAAGCCATAAGATGAAAGG - Intronic
964450064 3:156803534-156803556 CAGGGAAAAAATAAGTAGAATGG - Intergenic
964713320 3:159695358-159695380 TAGGGAAGACATAGGAGGAAGGG - Intronic
965504358 3:169496170-169496192 CATTGAAAACATATTAGGGATGG + Intronic
965567556 3:170136884-170136906 AAGAGAAAAGAAAAGAGGGAGGG + Intronic
965742294 3:171888425-171888447 CAGGTAAAGCTTCAGAGGGAAGG + Intronic
965972661 3:174581345-174581367 CAGGGAAGACTTCAGAGGAAAGG + Intronic
966182465 3:177199066-177199088 CAGGAAAACCATCAGAGGAAAGG + Intergenic
966285494 3:178290258-178290280 GAGGGAAAAAATAAAAAGGATGG + Intergenic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
966999732 3:185322489-185322511 CATGGAAAACAGAGTAGGGATGG - Intronic
967345765 3:188453717-188453739 CAGGGGAGACTTAATAGGGAAGG - Intronic
967526413 3:190499333-190499355 CACAGAAAACAGAAGAGGAAGGG - Intergenic
967967195 3:194971230-194971252 CAGGAAAAACATTGCAGGGATGG + Intergenic
967989007 3:195117679-195117701 CAGGGAAACAATAAGAATGAGGG + Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969353812 4:6613635-6613657 GAGGGAAAAGAAGAGAGGGATGG + Intronic
969892644 4:10274019-10274041 AAGGGAAAACTTGATAGGGAAGG + Intergenic
970161288 4:13192084-13192106 GAAGGAAAAAATAGGAGGGAAGG + Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
971246397 4:24932768-24932790 CAGGGAAAACATTAGTCAGAGGG + Intronic
971283727 4:25266482-25266504 TAGGAAAAAAATAAGAGGGCAGG - Intronic
971386997 4:26150015-26150037 CAGTGATAACATCAGAGGTATGG - Intergenic
971629877 4:28977281-28977303 CAGGCAGAAAATAAGAGGAAAGG - Intergenic
971720374 4:30237773-30237795 CAAGGAAAAAATAAGAGGAGAGG - Intergenic
972876840 4:43372744-43372766 GAGAGAAAAAACAAGAGGGAAGG - Intergenic
973184264 4:47306283-47306305 GAGGAAAAAGAAAAGAGGGATGG + Intronic
973662352 4:53121188-53121210 GAGGGAAAACATGACAGTGAAGG + Intronic
974840354 4:67292214-67292236 AAGGGAAAATATTAAAGGGAGGG + Intergenic
974994780 4:69141373-69141395 GAGGGAGAAAAGAAGAGGGAAGG - Intronic
975636992 4:76460282-76460304 CAGATTATACATAAGAGGGAAGG - Intronic
977143423 4:93404774-93404796 CAAGGAATAGATAAGAGGGAAGG + Intronic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
977874644 4:102134643-102134665 TAGGGAAAACAAAAGACAGAAGG - Intergenic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
981459987 4:145001996-145002018 CATGGAAAATAAAAGAAGGAAGG + Intronic
981618991 4:146672692-146672714 CTGGGAAAAAAGCAGAGGGAGGG + Intergenic
981948117 4:150373807-150373829 CAGGGAAAAGAGGAGAGGTAAGG - Intronic
982225926 4:153166499-153166521 GAAGGAAAAGAAAAGAGGGAGGG - Intronic
983361351 4:166727138-166727160 CAGGGAAGAAACAAGAGAGAGGG + Intergenic
983390274 4:167122061-167122083 AAAGGAAAAGAAAAGAGGGAGGG - Intronic
984775507 4:183478249-183478271 GAGGGAAAAGAAAGGAGGGAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985102235 4:186470002-186470024 CAAGGAAAAAAGAAGACGGAGGG + Intronic
985421380 4:189788303-189788325 AAGGGAAAAAAAGAGAGGGAAGG + Intergenic
985517827 5:356187-356209 CAGGCACAAAATAAGAGGGAAGG + Intronic
987343145 5:16956056-16956078 CAGGGAAAAAAAAAGAGGGGGGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988324484 5:29744449-29744471 AAGGGAAAGCAAAAGAGGTAAGG + Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
993143320 5:84062052-84062074 CATGGAAAACATGACATGGAGGG + Intronic
993330160 5:86589629-86589651 CAGGAAAAACATCTGAGGAATGG - Intergenic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994196595 5:96929437-96929459 GAAGGAAAAGAAAAGAGGGAGGG - Intronic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
994502158 5:100592863-100592885 TAGGAGAAACATAAGAGGCAAGG - Intergenic
996354494 5:122580914-122580936 AAGAGAAAAGAAAAGAGGGAAGG - Intergenic
996477781 5:123940926-123940948 CAAGGAAATCATAAGAAAGAAGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997333068 5:133081392-133081414 CAGTAAACACAAAAGAGGGAGGG - Intronic
997706838 5:135963448-135963470 ATGGGAAAACTTAATAGGGAAGG - Intergenic
998364610 5:141621169-141621191 CAGGGAAGAAATAAGGGGCAAGG + Exonic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
998932161 5:147193465-147193487 AAGGGAAAAAAAGAGAGGGAAGG + Intergenic
999279000 5:150352377-150352399 CAGGGAATGGCTAAGAGGGAGGG + Intergenic
999641820 5:153680159-153680181 CAGGGAAGACACAAGAGCTATGG + Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000273549 5:159710965-159710987 CAAGGAAAACCTAACAGGGCTGG - Intergenic
1001141034 5:169144263-169144285 CAAGGTAAACATGGGAGGGAAGG - Intronic
1002309393 5:178305675-178305697 GCGGGAAGACATAAGAGTGAAGG + Intronic
1003586693 6:7396172-7396194 CATAGAAAATGTAAGAGGGATGG + Intronic
1004117983 6:12789924-12789946 CAGTGAAAGAAAAAGAGGGAGGG - Intronic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1005574717 6:27180287-27180309 CCGGGAAAACATGAGAGATAGGG + Intergenic
1005960826 6:30691793-30691815 AAGGGAAAACATAAGATGTCTGG - Intergenic
1007478683 6:42135974-42135996 CAGGAAAAACAAGAGATGGAGGG - Intronic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1009590432 6:65662789-65662811 TAGAGAAAAAATAAAAGGGAAGG + Intronic
1009865335 6:69391230-69391252 CAGGGAACACTTAAAAGGAATGG - Intergenic
1009917789 6:70017618-70017640 AAGGGAAAACATAAGAAGCTGGG + Intronic
1010571700 6:77481031-77481053 CAAGGAAAAGGAAAGAGGGATGG + Intergenic
1011532863 6:88343183-88343205 CAGGGAAAAGATATGAGTGGGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012360664 6:98375152-98375174 CAGGGAAGAAAACAGAGGGAAGG - Intergenic
1012456755 6:99415428-99415450 CATGGAAAAGATGGGAGGGAAGG + Intronic
1013075069 6:106763989-106764011 CAGGGAAATCCCAAGAGAGAGGG + Intergenic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1016405288 6:143723637-143723659 CAGGGAAGAAATACCAGGGAAGG + Intronic
1017088782 6:150739883-150739905 CAGGGAAGATAAAAGAGAGAAGG + Intronic
1017170636 6:151451485-151451507 AAGGAAAAAAATAAGAGGAAAGG + Intronic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1019088530 6:169503468-169503490 CTGGGAAGAAATAAGAGTGAAGG + Intronic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1019952238 7:4383071-4383093 CAGGGAAAACTAATGCGGGAGGG - Intergenic
1020167264 7:5817708-5817730 CAGGGAAAAGATAGGACGCAGGG - Intergenic
1020279789 7:6644307-6644329 CAGGGAAAGGTTCAGAGGGAAGG + Intronic
1020594985 7:10195277-10195299 CAGGGAGACCATTAGTGGGAGGG - Intergenic
1021001177 7:15332053-15332075 GAGTGAAATCATAAGATGGAAGG + Intronic
1021026893 7:15679301-15679323 CAAGGAAAGGATAAAAGGGAGGG - Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021790487 7:24199848-24199870 CAGGAAAAACTCAAGAGGCAGGG - Intergenic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022100713 7:27167391-27167413 CAAGGAAAATATTAGGGGGAGGG - Intronic
1022158814 7:27687982-27688004 CAAGAAAAAAATAAGAGGGAGGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022478037 7:30724577-30724599 CAGGGAAAACACAACTGGAAAGG - Intronic
1022490818 7:30816209-30816231 TAGGGAAATAATATGAGGGAAGG + Intronic
1025802735 7:64802406-64802428 GAAGGAAAACAAAAGAGGAAAGG + Intronic
1026192237 7:68140087-68140109 GAGAGAAAGCAAAAGAGGGAGGG + Intergenic
1026332571 7:69365489-69365511 CAGGGAACAGGTAAGCGGGAAGG - Intergenic
1026904082 7:74052811-74052833 AAGGAAAAAGAAAAGAGGGAGGG + Intronic
1027232434 7:76280586-76280608 CATGCAAAACACAAGAGGGACGG - Intronic
1027671518 7:81105190-81105212 CAGGTAAAACATGAAAGAGATGG + Intergenic
1027787272 7:82596010-82596032 CAGGAAAGACAGAAGAGTGAAGG - Intergenic
1028188004 7:87811795-87811817 CAAGGAAAGCCTAACAGGGAAGG - Intronic
1029354853 7:100044178-100044200 AAGAGGAAACATCAGAGGGAAGG - Intergenic
1029510058 7:100988638-100988660 CAGGAAAAACAGAAGAGCTAAGG - Intronic
1030337858 7:108344942-108344964 GAGGGAGAAGATAAGAAGGAAGG + Intronic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031419572 7:121534520-121534542 CATGAAAAAAATAAGAAGGAGGG - Intergenic
1031801455 7:126251769-126251791 AAGGGAAAACTGAAGAGGAATGG - Intergenic
1032283841 7:130526697-130526719 AAGGGAAAGTATAAGAGGGGTGG + Intronic
1032528585 7:132600666-132600688 CAAGGAAAAAATGAGAGGCAGGG - Intronic
1033545674 7:142397894-142397916 CAAGGAAAACAAAATAGGGAAGG - Intergenic
1035613926 8:988680-988702 CAGGGAACACATCAGATGGAAGG - Intergenic
1037044062 8:14275567-14275589 TAGGGGAAACATAAAAGGAAAGG + Intronic
1037616065 8:20520004-20520026 GAGGGAAAAAATGAGAGAGAAGG - Intergenic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1039003401 8:33007027-33007049 CAGGAAAAACATTGAAGGGATGG - Intergenic
1040479390 8:47809806-47809828 CAGGGAAATCAAAACTGGGAAGG + Intronic
1040523379 8:48196972-48196994 AAGAAAAAACATAAGAGGCATGG + Intergenic
1040666465 8:49639791-49639813 CAGGGAAACAATAGGAGTGAAGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042034896 8:64522067-64522089 AAGGGAAAAGATAAGAGGAAGGG - Intergenic
1042052572 8:64727129-64727151 CAGGGAAAGCACAGCAGGGAAGG - Intronic
1042341537 8:67684912-67684934 AAGAGGAAACATCAGAGGGAAGG - Intronic
1042342823 8:67698190-67698212 CTGGACAGACATAAGAGGGAAGG - Intronic
1042705744 8:71664382-71664404 AAGTGAAAACATAACAGGAAGGG - Intergenic
1042943013 8:74126470-74126492 CAGGGAACACACAGGAGGGTGGG - Intergenic
1044220659 8:89665293-89665315 AAGAGAAAACATGAGGGGGAAGG - Intergenic
1044388326 8:91617623-91617645 CAGGCCAAATTTAAGAGGGAAGG + Intergenic
1044647986 8:94464890-94464912 GAGGGAGAGCAAAAGAGGGAGGG + Intronic
1045425050 8:102057758-102057780 CTGGGAAAGGATAAGAGGAAAGG - Intronic
1047186246 8:122635964-122635986 AAGGGAAAAAGAAAGAGGGAGGG + Intergenic
1047218187 8:122896163-122896185 CAGGGAGAACAGAAGAGCAATGG - Intronic
1047568042 8:126067791-126067813 CAGGGAAAACATGAAAGGGCAGG - Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1049950213 9:636401-636423 CAGGAAAAAGATAAAAGGGAAGG - Intronic
1050048333 9:1572845-1572867 AAGGGAAAACATAAAAAGGCAGG - Intergenic
1050754418 9:8983386-8983408 ACAGGAAAACATAAGAGGTAAGG - Intronic
1051216431 9:14803112-14803134 AAGGGAAAGGAAAAGAGGGAGGG - Intronic
1051368600 9:16339298-16339320 CAGGGAAAACCATAGAGGGAGGG + Intergenic
1052130190 9:24835291-24835313 CACGTAACACATAACAGGGAAGG - Intergenic
1053135126 9:35646219-35646241 CATTGAAAACGGAAGAGGGAGGG - Intronic
1053148535 9:35728311-35728333 CAGTCAGAATATAAGAGGGATGG + Intronic
1053621994 9:39828851-39828873 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1053837926 9:42160713-42160735 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1054735636 9:68747066-68747088 CAGGGAAAGAATGAGAGGGAAGG - Intronic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1055006219 9:71510475-71510497 CAGGAAAGACAGAAGAGTGAAGG + Intergenic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1056854568 9:90115233-90115255 CAGGGAATGAATAAGAGGGTAGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057191858 9:93092831-93092853 CAGGCAAGACATAACAGGGATGG + Intergenic
1057349700 9:94285447-94285469 AAGGGGAAACAAAGGAGGGAAGG + Intronic
1059391435 9:114001974-114001996 CCTGGAAAACAGAAGAGGAAAGG - Exonic
1060338610 9:122751834-122751856 AAGGGAAGAATTAAGAGGGAAGG - Intergenic
1061147900 9:128810472-128810494 CAGGGAAAAATGAACAGGGATGG + Intergenic
1203654155 Un_KI270752v1:7479-7501 CAGGGAAAACAAGGGAGGGAAGG + Intergenic
1185524934 X:770318-770340 GAGGGAAAAGATAAAAGGGAGGG + Intergenic
1185604436 X:1359778-1359800 GAGGGAGAATAAAAGAGGGAGGG - Intronic
1186265587 X:7830221-7830243 CAGGGAAAACACAAAACTGAGGG + Intergenic
1187250852 X:17596838-17596860 CAGGGAAGTCATAAAATGGAAGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187565732 X:20447718-20447740 CAGGAATAACAAAAGAGAGAGGG - Intergenic
1187693192 X:21892662-21892684 CAGGGAAAAATGAAAAGGGAAGG + Intergenic
1189252248 X:39610375-39610397 CAGGGACAACAAAAGAAGTAGGG - Intergenic
1190639298 X:52467220-52467242 CAGTGAACACATAAGATGGGAGG - Intergenic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1192471489 X:71403003-71403025 AAAGGAAAACATAAAAGGTAGGG - Intronic
1193645582 X:84065490-84065512 CAGATAAAACATAGAAGGGAGGG + Intronic
1194869085 X:99105331-99105353 CAGGGAAAACAAAGCAGGAAAGG - Intergenic
1195025519 X:100873080-100873102 CAGGCAAAACAGAAGAGAGAAGG - Intronic
1195133839 X:101883275-101883297 CAAGGAGAACATAAGAGAAAAGG - Exonic
1195280576 X:103329225-103329247 CATGGAAAACATAAATAGGATGG + Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1196412463 X:115434415-115434437 CAGGGAAAACATCACTGAGATGG + Intergenic
1196947295 X:120840467-120840489 AAGGGAAAAGATGAGAGGGTAGG - Intergenic
1197458667 X:126710530-126710552 CAGTGAAAACATAAGAATTAGGG + Intergenic
1197967925 X:132084826-132084848 CAGGGAGATCACAAGAGGAAAGG + Intronic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1199031600 X:143006554-143006576 CAGGCAAAAAAAAAGATGGAAGG + Intergenic
1199737406 X:150696715-150696737 GAGGGAAAATAAAAGAGAGAGGG - Intronic
1201909362 Y:19118511-19118533 AATGGAAAACATAAAAGGCAGGG - Intergenic
1202086157 Y:21139106-21139128 GAAGGAAAATGTAAGAGGGAAGG - Intergenic