ID: 1121091941

View in Genome Browser
Species Human (GRCh38)
Location 14:91188980-91189002
Sequence CAGTGGTGATGAGCACTGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121091941_1121091948 23 Left 1121091941 14:91188980-91189002 CCGCTCAGTGCTCATCACCACTG 0: 1
1: 0
2: 3
3: 30
4: 256
Right 1121091948 14:91189026-91189048 GAGCCTCCAGAAGAGACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121091941 Original CRISPR CAGTGGTGATGAGCACTGAG CGG (reversed) Exonic
900281388 1:1871740-1871762 TGGTGATGTTGAGCACTGAGGGG - Intronic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
902708072 1:18220255-18220277 CAGAGGAAATCAGCACTGAGTGG - Intronic
902880705 1:19370162-19370184 CAGTGGTCGTGGGCAGTGAGTGG - Intronic
903433381 1:23326809-23326831 CAAGGATGATGAGAACTGAGGGG - Intronic
905333491 1:37226404-37226426 CAGTCGAGATGAGTACAGAGTGG + Intergenic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
907935978 1:59042599-59042621 CAGTAGAGATGAGCAAAGAGAGG + Intergenic
908302293 1:62774019-62774041 CAGTGGGGAAGAGCACCAAGTGG - Intergenic
912087362 1:106025895-106025917 CAGTAGTGATGAGCACATAGTGG - Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
913483274 1:119310230-119310252 CAGTTGTTAAGAGCTCTGAGTGG + Intergenic
915466711 1:156102607-156102629 AAATGGAGATGAGCACTGGGTGG - Intronic
915752846 1:158228226-158228248 CAGTGGGGCAGAGCACTAAGTGG + Intergenic
917210745 1:172629710-172629732 CAGTGGTGAGGAGCATTGTCAGG + Intergenic
917537723 1:175886637-175886659 TAGTGGTGATTAGCAAAGAGCGG + Intergenic
917854034 1:179087411-179087433 CAGGGGTGATGGGCAAAGAGAGG - Intronic
920138476 1:203789962-203789984 CAGTGGTGATGAACACTGTGGGG + Intergenic
920809535 1:209269164-209269186 GAGTGGTGATGGGCACACAGAGG - Intergenic
921756814 1:218866853-218866875 CAGTGGTGATGACAGCTGAGTGG + Intergenic
1063601293 10:7483437-7483459 GAGTGGAGTTGAGCAGTGAGTGG - Intergenic
1063810737 10:9703490-9703512 CAGTGGTGAGCCTCACTGAGAGG - Intergenic
1065256862 10:23878777-23878799 CAGAGGTGTTGAGCAGTGACAGG + Intronic
1065361905 10:24896659-24896681 CTGTTGTGAGGAGCACTGGGTGG + Intronic
1065513910 10:26506219-26506241 CGGTAGTGTTAAGCACTGAGGGG - Intronic
1067847513 10:49735898-49735920 CTCTGGTGATGAGCAATGATGGG - Intronic
1067970370 10:50963394-50963416 CAGTGGTGATGTGAATTGTGAGG - Intergenic
1070577958 10:77694170-77694192 CAGTGGTGAGGAGAATTGAAAGG + Intergenic
1074228581 10:111511945-111511967 CCATGGTGCTGAGCACAGAGTGG + Intergenic
1075118050 10:119643666-119643688 CAGTAGGTATTAGCACTGAGGGG - Intergenic
1075227002 10:120638772-120638794 CCATGGTGCTGAGCACTCAGTGG - Intergenic
1076004619 10:126938851-126938873 CAGAGGGGATGAGCACTGGAGGG + Intronic
1077187823 11:1243354-1243376 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188245 11:1245025-1245047 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188778 11:1247125-1247147 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077189199 11:1248796-1248818 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077715926 11:4580612-4580634 GAGGGGTGATGAGCAAGGAGTGG - Intergenic
1080351126 11:31386766-31386788 CAGTGGGGTAGAGCACTAAGTGG + Intronic
1080489830 11:32750786-32750808 CAGTGGGGAAGAGCACCAAGTGG - Intronic
1080580634 11:33640437-33640459 AAGTGGGGATGGGCAATGAGAGG - Intronic
1080907429 11:36560735-36560757 CAGTGGTAATGAGGACTGCTAGG + Intronic
1081631859 11:44694761-44694783 CAGTGGGGACAAGGACTGAGGGG - Intergenic
1084360808 11:68667521-68667543 CAGTGGAGATGAGGAATGTGGGG + Intergenic
1084729891 11:71066169-71066191 CTGGGGAGATGAGCAGTGAGTGG + Intronic
1085277953 11:75312044-75312066 CTGAGGTGATCAGCACTTAGAGG - Intronic
1085670647 11:78461433-78461455 TAGTGCTGATTAGCACTGACCGG + Intronic
1088547175 11:110971264-110971286 CAGAAGTGATGTGCACTGATTGG - Intergenic
1090228392 11:125085100-125085122 CAGTGGTGATGAGCGCGTATGGG - Exonic
1090452775 11:126821259-126821281 CAGTGGTGAGAAGCACTGCTGGG - Intronic
1091067541 11:132530348-132530370 CAGTGGTGATGATAAATAAGAGG - Intronic
1091128959 11:133128001-133128023 CTGTGGTGATGTGGACTGATGGG - Intronic
1092236152 12:6811021-6811043 CAGTGGGGAAGAGGACTGTGTGG + Intronic
1096767813 12:53908043-53908065 GAGTGGTGATGATCAGTGTGAGG - Intergenic
1097280730 12:57844521-57844543 CAGTGGTGATGAGTAGGGGGAGG - Intronic
1100607410 12:96162991-96163013 CAGTGGGGAGGAGAACTGATGGG - Intergenic
1102299236 12:111758953-111758975 CAGTGGTGAAGAGCTGTCAGAGG + Intronic
1103224807 12:119277547-119277569 CAGTGGTGATGAGCAAGAGGAGG + Intergenic
1107423769 13:40273484-40273506 CAGTTGTCATGATCTCTGAGAGG + Intergenic
1109615979 13:64834243-64834265 CAGTGGTGATGGGGATTGATTGG + Intergenic
1110697404 13:78507538-78507560 CAATGGTGATGAGAACTGCTAGG + Intergenic
1111832127 13:93342677-93342699 CAGTCGTGAAGAGAAATGAGTGG + Intronic
1120275728 14:82370432-82370454 CAGTGGGGTGGAGCACTAAGTGG + Intergenic
1120340674 14:83217146-83217168 CAGTGGTGTAGAGCACCAAGTGG - Intergenic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121921599 14:97887241-97887263 CAGTGGGGAAAAGCACTGGGTGG + Intergenic
1122084621 14:99290977-99290999 CTGGGGTGATGAGGACTGCGTGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1123035101 14:105468792-105468814 CAGTGGGGAAGGGCAGTGAGTGG + Intronic
1202836295 14_GL000009v2_random:79680-79702 CTCTGGTGATGAGCAGTGGGGGG - Intergenic
1124374982 15:29124118-29124140 CAGTGGAGCAGGGCACTGAGTGG - Intronic
1128250655 15:66161723-66161745 AAGTGAGGATGAGCACTCAGAGG + Intronic
1129770475 15:78200520-78200542 CAGTGGTGATGGGCAAAGAATGG - Intronic
1131329726 15:91485801-91485823 GAGTGATGATGAGCAATGAGAGG + Intergenic
1133146021 16:3787212-3787234 CAGTGAAGAGAAGCACTGAGGGG + Intronic
1134239645 16:12496078-12496100 CAGAGGTACTGAGAACTGAGAGG + Intronic
1135889568 16:26345082-26345104 CAGTGGAGCTGAGAGCTGAGGGG + Intergenic
1136120330 16:28128801-28128823 CAGGGGTGATGAGCAATCACAGG - Intronic
1137478918 16:48834897-48834919 CACTGGTTATGACCACTGTGGGG + Intergenic
1138118765 16:54381341-54381363 CAGTGGGCATGGGCACTGAGAGG + Intergenic
1139102851 16:63789246-63789268 CAGTGCTGATCAGCAGAGAGGGG - Intergenic
1141996799 16:87641101-87641123 CAGTTGTGATGGGCACGGGGAGG - Intronic
1143756684 17:9072648-9072670 CAGCGGTGATGGGAAGTGAGTGG + Intronic
1146314935 17:31799486-31799508 AAGTGGTGATGAGGACAGAAGGG - Intergenic
1146626205 17:34437392-34437414 CAGAGAGGATGAGCCCTGAGTGG + Intergenic
1147193983 17:38752998-38753020 CAGCTGGGATGAGCACTGTGTGG - Intronic
1147334109 17:39716479-39716501 CAGTGGTGAGGGGGTCTGAGAGG - Intronic
1148085962 17:44994046-44994068 CAGTGGGGATGGGGCCTGAGAGG - Intergenic
1148735059 17:49860611-49860633 CAGTGGTGATGAGCTCAGACTGG - Intergenic
1149017147 17:51921267-51921289 GAGTTCTGATGGGCACTGAGGGG - Intronic
1149188685 17:54031673-54031695 CATTGGTGATGAGCAAAGTGTGG + Intergenic
1150526547 17:65929304-65929326 CAGTAGAGATGAGCTGTGAGAGG - Intronic
1151310584 17:73290334-73290356 CAGTGGGGAGGAGCACTCAGTGG - Intronic
1151658434 17:75506507-75506529 CAGTGGGGGAGAGCACTGAGGGG + Intronic
1151957329 17:77386899-77386921 CAGGGCAGATGAGCACTCAGAGG + Intronic
1152723527 17:81934351-81934373 CAGCGTTGATGAGCAGGGAGCGG + Exonic
1156071110 18:33210541-33210563 CAGTGGTGCTGAGAACACAGTGG - Intronic
1156670471 18:39463200-39463222 CAGTGGTGCTGTGTTCTGAGTGG + Intergenic
1157272848 18:46289967-46289989 CAGTGGTCAGTGGCACTGAGTGG - Intergenic
1159446425 18:68545964-68545986 CAGTGGTGGTGGCCACAGAGGGG + Intergenic
1160654154 19:252686-252708 CAGTGTGGATGGGCACTGATAGG - Intergenic
1161809026 19:6460837-6460859 CAGTCCTGATGACCACTAAGGGG + Intronic
1163510975 19:17734688-17734710 CAGTGGTCATTAACTCTGAGAGG - Intergenic
1164697368 19:30255928-30255950 CAGGGGTGATTAGCATGGAGAGG + Intronic
1165428785 19:35759905-35759927 CAGTGGTGCTGGGCAGGGAGGGG - Exonic
1166636029 19:44452554-44452576 CAGAGGTGAGGAGCACAGGGAGG + Intergenic
1167491953 19:49798231-49798253 CAGTGGTGGAGAGCTCTGGGGGG + Intronic
1202636344 1_KI270706v1_random:47685-47707 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
925474377 2:4196729-4196751 CAGCGGTGGTGAGCACGGTGGGG + Intergenic
925831972 2:7904557-7904579 CAGGGATGATGAGCATTCAGGGG - Intergenic
926751322 2:16200926-16200948 CAGAGCTGATGGGCAGTGAGAGG - Intergenic
926792208 2:16585323-16585345 TACTGGTGGTGAGCACTTAGGGG + Intronic
927158900 2:20240164-20240186 CAGTGGTGATGGGCAGAGATGGG + Intergenic
927954901 2:27201310-27201332 CGGTGCAGATGAGCACCGAGGGG - Intronic
928304543 2:30156729-30156751 GAGTGGAGATGAGTTCTGAGCGG - Exonic
928682546 2:33717183-33717205 CCCTGGAAATGAGCACTGAGGGG - Intergenic
929900054 2:45993028-45993050 CAGTGAAAGTGAGCACTGAGAGG + Intronic
930403400 2:50921761-50921783 CATTGGTAATGGGCACTGGGAGG - Intronic
931945371 2:67300350-67300372 AAGTGCTGAAGAGCACTGTGAGG + Intergenic
932192249 2:69750864-69750886 CAATGGCCATGGGCACTGAGGGG + Intronic
933304275 2:80577756-80577778 CAGTGGTGTTGAGCTCTGTTGGG + Intronic
934926958 2:98388776-98388798 CAGTGGTGATGAGAGCTGTAGGG + Intronic
934933400 2:98446067-98446089 CAGTGGGGTTGAGGACAGAGTGG + Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
941716901 2:168773764-168773786 CCGTAGTGATGAGCACTGACTGG + Exonic
941857751 2:170247909-170247931 GAATGGTGAGGAGCACTGTGTGG + Intronic
942658313 2:178237895-178237917 CAGTGGAGATAAGAAGTGAGTGG - Intronic
943914370 2:193609945-193609967 CAGTGGTTATGAGTTTTGAGAGG - Intergenic
944498177 2:200329597-200329619 CTCTGGTGTTGAGCCCTGAGAGG - Intronic
946401282 2:219469580-219469602 CAGTGCTAACGGGCACTGAGGGG - Intronic
947753106 2:232543027-232543049 CAGAGGAGATGAGCACACAGGGG - Exonic
948233718 2:236370976-236370998 CAATGGTGTTGAGGACAGAGTGG + Intronic
948674905 2:239591541-239591563 CAGTGTTAAGGGGCACTGAGGGG + Intergenic
1170775667 20:19372787-19372809 CAGTGGTGCTGAGCTCGGGGAGG - Intronic
1171882475 20:30628613-30628635 CTCTGGTGATGAGCAGTGTGGGG + Intergenic
1172937242 20:38629138-38629160 CAGTAGGGAGGAGCCCTGAGGGG + Intronic
1173564749 20:44030633-44030655 CAGTGGTGGTGAGGGCCGAGAGG - Intronic
1174039712 20:47690268-47690290 CATTGGTGATGAGGTCTGTGAGG + Exonic
1178908103 21:36652658-36652680 CAGTGATTATGAGGACTGACAGG + Intergenic
1179338182 21:40477652-40477674 CAGTGTTTATTAACACTGAGAGG + Intronic
1179993923 21:44964985-44965007 AAGTGCTGATGAACACTCAGTGG - Intronic
1180364521 22:11926631-11926653 CTCTGGTGATGAGCAGTGGGGGG - Intergenic
1180874212 22:19167299-19167321 CGGTGGTGCTGAGCCCTGAACGG + Intergenic
1181286491 22:21756195-21756217 AAATGGTGATGGGAACTGAGAGG - Exonic
1182070179 22:27458051-27458073 AAGTGGAGATGAGCAGTGATGGG + Intergenic
1182984736 22:34705784-34705806 CAGAGATGATCAGCACTGAAAGG + Intergenic
1183581341 22:38728341-38728363 CAGTGGTGGTGACCATGGAGAGG + Intronic
1185030404 22:48439981-48440003 CGGTGGCCATCAGCACTGAGGGG - Intergenic
1185239688 22:49735850-49735872 CAGTGGTGGTGGACACGGAGGGG + Intergenic
1185373910 22:50473430-50473452 CAGTGGGGATGAGGACTATGTGG + Intronic
950082827 3:10235538-10235560 AAGTGGTGTTGGGCACAGAGGGG + Intronic
950115800 3:10449713-10449735 CAGTGGTGGTGAGCTCCAAGAGG + Exonic
950207510 3:11092131-11092153 CAGTGTGGTTGGGCACTGAGGGG + Intergenic
950620327 3:14200381-14200403 CAGTGGTGCTGTCCACTGAGGGG + Exonic
950844158 3:15998512-15998534 CAGTGTTGATGGGCAGGGAGTGG + Intergenic
950896061 3:16451951-16451973 CAGTGGAACTGATCACTGAGTGG + Intronic
953411762 3:42694321-42694343 GAGTGGTGGTCAGGACTGAGAGG - Intronic
953860439 3:46539924-46539946 GAGGGGTGCTCAGCACTGAGGGG + Intronic
953905097 3:46864731-46864753 CACTGGGGGTGGGCACTGAGTGG - Intronic
954393918 3:50282480-50282502 CAGTAGGGAAGAGCATTGAGGGG - Intronic
954894476 3:53964034-53964056 CAGTGGTGAGGGGAATTGAGGGG - Intergenic
955771283 3:62387143-62387165 TAGTGGTTATGAGCAAGGAGGGG - Intergenic
956096185 3:65718946-65718968 CTGTGGTGAGGAGCAGAGAGAGG - Intronic
958670408 3:97197145-97197167 CAGTGGTGTAGAACACTAAGCGG - Intronic
959500364 3:107099776-107099798 CATTGGTGATGAGGACTCAGTGG + Intergenic
960769556 3:121178624-121178646 CAGTGGAGATGTGCATTCAGAGG - Intronic
961610417 3:128132910-128132932 CAGTGGGGTAGAGCACCGAGTGG + Intronic
962383208 3:134913217-134913239 CAGTGGTGGGGAGCACACAGAGG + Intronic
962787050 3:138778278-138778300 CAGTGGTGCTAAGCAGTTAGTGG - Intronic
963622874 3:147634603-147634625 CAGTGGGGATGTGCTCTCAGAGG - Intergenic
964398432 3:156272683-156272705 CAGTGGGGAGGAGCACCAAGAGG - Intronic
965485378 3:169272391-169272413 CAGTTGTGTGGTGCACTGAGAGG - Intronic
966151114 3:176868676-176868698 CAGTGGGGTAGAGCACTAAGTGG + Intergenic
966259175 3:177954798-177954820 CAAAGGTGAAGAGAACTGAGGGG + Intergenic
968461829 4:730072-730094 CAGTGGGGATGAGGACAGGGAGG - Intronic
969092212 4:4703118-4703140 CACTGGAGATGAGCCCCGAGGGG + Intergenic
969312604 4:6362639-6362661 AAGTGGAGATGGGCACTGAGAGG - Intronic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
971170076 4:24225015-24225037 CAGCAGAGATGAGCACAGAGAGG + Intergenic
971838684 4:31803124-31803146 AAGTGGAGTAGAGCACTGAGTGG - Intergenic
972856534 4:43114124-43114146 CAGAGGGGTAGAGCACTGAGTGG + Intergenic
973366144 4:49211056-49211078 CTCTGGTGATGAGCAGTGTGGGG + Intergenic
973394453 4:49581380-49581402 CTCTGGTGATGAGCAGTGTGGGG - Intergenic
973543607 4:51958632-51958654 CTGTGGGGTTGAGCACAGAGGGG + Intergenic
973790312 4:54372199-54372221 CATTGTTGGTGAGCACAGAGTGG + Intergenic
974717089 4:65680859-65680881 CAGTGCTGATGACCACTGTGGGG + Intergenic
974926552 4:68305956-68305978 CAGGGGTGGTGGGCAGTGAGAGG - Intergenic
975295101 4:72725880-72725902 CAGAGGTGATGATCACTGGAGGG - Intergenic
976858626 4:89634428-89634450 TAGTGGTGAAGAGCATTGACTGG - Intergenic
977403116 4:96560633-96560655 CAGTGGTGATAAACATTGAGTGG - Intergenic
977997657 4:103514732-103514754 CAGTGGTGGTGGGCAGTGATGGG + Intergenic
978456025 4:108892900-108892922 AAGTGGTGATGAGGAGTCAGGGG + Intronic
978839534 4:113193719-113193741 GAGTGGTGGTGAGGACTGAGAGG + Intronic
979507060 4:121510455-121510477 CAGTGGTGGTGAGGTCTGAGAGG - Intergenic
980116407 4:128683726-128683748 AAGTGGTGATGAGAACTCAGAGG - Intergenic
980794474 4:137663177-137663199 CAGTGGGGATGGGCAGTGGGTGG - Intergenic
981885126 4:149665336-149665358 CAGTAATGAGGACCACTGAGTGG + Intergenic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
982474845 4:155837497-155837519 CAGTGAGAATGAGCACTGGGAGG - Intronic
1202763661 4_GL000008v2_random:133552-133574 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
985919279 5:2956965-2956987 CACTGGTGATGGGCATTGGGCGG + Intergenic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
991682118 5:69150035-69150057 CAGTGGGGAAGAGCACTGAGTGG - Intergenic
993981264 5:94545881-94545903 CAGTGGGGTAGAGCACTAAGTGG + Intronic
994233895 5:97339554-97339576 CAGGGGTGTAGAGCACTAAGTGG + Intergenic
999321273 5:150616608-150616630 CAGGGGAGATGAGCAGTGGGCGG - Intronic
999445588 5:151636299-151636321 CAGTGGACAGGAGCACTCAGAGG - Intergenic
1001077279 5:168639406-168639428 CAGGTGTGATGAAGACTGAGAGG + Intergenic
1001743843 5:174074828-174074850 CAGGGGAGATGAGCTCTAAGCGG - Intronic
1002904396 6:1437235-1437257 TAATGGTGATGAGCATGGAGGGG - Intergenic
1006002183 6:30973806-30973828 CAGCTGTGAGGGGCACTGAGAGG - Intergenic
1006638893 6:35478763-35478785 CAGCGGTGATGGGCACTTGGGGG - Intronic
1007842117 6:44725127-44725149 AAGTGGGGATGCGCAGTGAGGGG + Intergenic
1008034699 6:46734004-46734026 CAGTGGTGATGAGGAAGGAGAGG - Intronic
1010186002 6:73143788-73143810 CAGTATTGATTGGCACTGAGGGG + Intronic
1011220677 6:85051558-85051580 CAGTGGTAGTGGGAACTGAGAGG + Intergenic
1014704849 6:124733135-124733157 CAGTGGTTATCAGGAGTGAGGGG + Intronic
1017999838 6:159569340-159569362 CAGTTGGCATGAGCACAGAGGGG - Intergenic
1019173104 6:170145959-170145981 CAGTGGTGATAAGCACACTGCGG + Intergenic
1019736328 7:2651454-2651476 CAGTGGTGGGTAGCACTGAGCGG - Intronic
1020866898 7:13575766-13575788 CAGTGGTAATTAGCTCTGAGAGG - Intergenic
1021039552 7:15845089-15845111 CAGTGGGAAAGAGCACAGAGTGG - Intergenic
1023024966 7:36041999-36042021 CAGTGTTGACTATCACTGAGAGG + Intergenic
1023232042 7:38043033-38043055 AAGTGGTGATGACCTCTGAATGG - Intergenic
1023637394 7:42226434-42226456 CTATGGTGATGAGCATTGGGAGG - Intronic
1024988207 7:55213956-55213978 CAGAGGTGATGAGCACAGAAGGG - Intronic
1026808076 7:73440260-73440282 CTGTGGTTAAGAACACTGAGAGG + Intergenic
1029381762 7:100219823-100219845 CAGAGGTGGTGAGCACAAAGTGG - Exonic
1029401927 7:100352273-100352295 CAGAGGTGGTGAGCACAAAGTGG - Exonic
1029529752 7:101117446-101117468 CAGTGGTGAGGAGAGCTGAGGGG + Intergenic
1030235544 7:107256765-107256787 CAGTGGGAATGAGCTCTGACTGG + Exonic
1032058885 7:128706954-128706976 CTGGGGTGATGAGGACTCAGGGG + Intergenic
1032263682 7:130355877-130355899 CAACAGTGATGACCACTGAGGGG - Intronic
1033600676 7:142886257-142886279 CAAAGGTGATGGGGACTGAGAGG - Intergenic
1034348804 7:150403566-150403588 CAGTGTTGATGTGCTCCGAGTGG + Intronic
1034895762 7:154875497-154875519 CACTTGTGATGGGTACTGAGAGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035813875 8:2517327-2517349 CAGTGGTAAGGAGCACAGATGGG - Intergenic
1038349775 8:26765370-26765392 GAGTGGAGATGATCACTGTGGGG - Intronic
1038482736 8:27912924-27912946 CAGTTGTAGTGAGGACTGAGTGG + Intronic
1040706632 8:50136504-50136526 CAGTGATGTTGAGCATTTAGTGG + Intronic
1040886298 8:52267160-52267182 CAGTGGGGATGAACCCTGAGGGG + Intronic
1041649050 8:60283134-60283156 CATTGCTGATGAGCTCAGAGTGG - Intergenic
1043514953 8:80987321-80987343 CAGAGGTGATGAGGCCTGTGTGG + Intronic
1043664538 8:82791649-82791671 CAGAGCTGAAGAGGACTGAGTGG + Intergenic
1044192959 8:89341936-89341958 CAGTGGTGGTGGCCACAGAGTGG - Intergenic
1044621088 8:94191239-94191261 CAGCTGTGATGAACCCTGAGAGG + Intronic
1046831847 8:118754934-118754956 CAGTGGTGATGAAGACAGAGAGG + Intergenic
1048710459 8:137204435-137204457 CAGTGGTGTAGAACACTGAATGG - Intergenic
1049167614 8:141136393-141136415 CAGTGTTTATGGGCACCGAGGGG + Intronic
1049386055 8:142343737-142343759 CAGTGGTGATGGGGAGTGGGGGG + Intronic
1050416367 9:5421418-5421440 TAGTGGTGATGAGTTCTGTGAGG - Intronic
1051805742 9:20990757-20990779 CAGTGGTGATGAGCAAGGGAAGG + Intronic
1053051877 9:34968808-34968830 CAGTGGAGATAAGTACTGTGTGG + Intronic
1055789615 9:79909846-79909868 AAGTGGGGAAGAGCACTGTGAGG + Intergenic
1056207234 9:84331968-84331990 CAATGTTGATGATCACTGAGTGG + Intronic
1056798256 9:89674009-89674031 CTGGGGGGATGTGCACTGAGGGG - Intergenic
1056907507 9:90666203-90666225 GTGTGGTGATGAGCAGTGGGGGG - Intergenic
1057644446 9:96859791-96859813 CAGTGGAGAAGAGCACCCAGTGG + Intronic
1057792791 9:98135085-98135107 CAGTGGCTATGGGCATTGAGGGG + Intronic
1058780841 9:108332920-108332942 AAGAGGTGATGAGATCTGAGAGG + Intergenic
1061076697 9:128345642-128345664 CAGTGGTTAAGGGCACAGAGTGG + Intronic
1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG + Intergenic
1061929927 9:133827230-133827252 CACTGGGGCTGACCACTGAGCGG + Intronic
1061929949 9:133827326-133827348 CACTGGGGCTGACCACTGAGCGG + Intronic
1061930053 9:133827806-133827828 CACTGGGGCTGACCACTGAGTGG + Intronic
1061930075 9:133827902-133827924 CACTGGGGCTGACCACTGAGCGG + Intronic
1061930099 9:133827998-133828020 CACTGGGGCTGACCACTGAGTGG + Intronic
1061930121 9:133828094-133828116 CACTGGGGCTGACCACTGAGCGG + Intronic
1061930162 9:133828286-133828308 CACTGGGGCTGACCACTGAGTGG + Intronic
1061930186 9:133828382-133828404 CACTGGGGCTGACCACTGAGTGG + Intronic
1061953164 9:133947731-133947753 CAGTCATCATGAACACTGAGAGG + Intronic
1203544414 Un_KI270743v1:118425-118447 CTCTGGTGATGAGCAGTGGGGGG + Intergenic
1187621776 X:21063528-21063550 CAGTGGTGATGGGAACTGCTGGG + Intergenic
1188530701 X:31137753-31137775 GAGTGGTGATGAACACTCTGAGG + Intronic
1192103713 X:68292843-68292865 CTGTGGTGATAAGCCCTTAGAGG - Intronic
1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG + Intergenic
1193865443 X:86725597-86725619 CAGTGTTGATGAGTCCTGAAGGG + Intronic
1194892192 X:99394260-99394282 CAGTGGTGGTGGCCACAGAGGGG - Intergenic
1195757814 X:108216568-108216590 CTGTGGTTCTGAGAACTGAGAGG - Intronic
1196698644 X:118641735-118641757 CAATGATGATTTGCACTGAGAGG - Intronic
1198083727 X:133263630-133263652 CAGTAGTGGTGAGAAGTGAGAGG - Intergenic
1201057140 Y:10006008-10006030 CAATGCTGATGTTCACTGAGAGG - Intergenic
1201792768 Y:17860196-17860218 CAGTGGTGGTGACCACTGAAGGG - Intergenic
1201808786 Y:18045790-18045812 CAGTGGTGGTGACCACTGAAGGG + Intergenic
1202354303 Y:24029446-24029468 CAGTGGTGGTGACCACTGAAGGG - Intergenic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic
1202516476 Y:25640666-25640688 CAGTGGTGGTGACCACTGAAGGG + Intergenic