ID: 1121096183

View in Genome Browser
Species Human (GRCh38)
Location 14:91219669-91219691
Sequence GCCAAGGGCCAGAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 9, 3: 71, 4: 488}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121096183_1121096200 25 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096200 14:91219717-91219739 AGGCCCTTGGGTTGTACTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1121096183_1121096193 -1 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096193 14:91219691-91219713 CCCAGGGGCACCTTAAAGTGAGG 0: 1
1: 0
2: 1
3: 13
4: 110
1121096183_1121096199 13 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096199 14:91219705-91219727 AAAGTGAGGGAGAGGCCCTTGGG 0: 1
1: 0
2: 0
3: 30
4: 246
1121096183_1121096201 26 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096201 14:91219718-91219740 GGCCCTTGGGTTGTACTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1121096183_1121096198 12 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096198 14:91219704-91219726 TAAAGTGAGGGAGAGGCCCTTGG 0: 1
1: 0
2: 2
3: 25
4: 230
1121096183_1121096196 5 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096196 14:91219697-91219719 GGCACCTTAAAGTGAGGGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 188
1121096183_1121096195 0 Left 1121096183 14:91219669-91219691 CCCTGCCCACTCTGGCCCTTGGC 0: 1
1: 0
2: 9
3: 71
4: 488
Right 1121096195 14:91219692-91219714 CCAGGGGCACCTTAAAGTGAGGG 0: 1
1: 0
2: 0
3: 14
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121096183 Original CRISPR GCCAAGGGCCAGAGTGGGCA GGG (reversed) Intronic
900236664 1:1594855-1594877 GCCATGGTCCAGAGAGAGCAGGG + Intergenic
900406062 1:2493555-2493577 CCCACGGCCCAGAGTGGCCAAGG - Intronic
900408986 1:2504438-2504460 GCCCAGGCCCAGGCTGGGCAGGG - Exonic
900640798 1:3687270-3687292 GCCAGGGTCCTGAGAGGGCAGGG - Intronic
901120678 1:6890538-6890560 TCCAAGAGCCTAAGTGGGCAAGG - Intronic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
901492109 1:9601937-9601959 GCCAGGGGACAGTGTGGGCTCGG - Intronic
901675575 1:10881744-10881766 GGCAAGGGCAAGAGTGGACGTGG - Intergenic
902591948 1:17481519-17481541 GCCAAGGGGCAGAGTGAGGGAGG + Intergenic
902717382 1:18282004-18282026 GCCAAGGCCCAAAGAGGGGAGGG - Intronic
903029842 1:20455991-20456013 TCCCTGGGCCAGGGTGGGCATGG - Intergenic
903467155 1:23559579-23559601 GCCCAGGGCCGGCGGGGGCAGGG - Exonic
903624527 1:24721371-24721393 GCCAAGAGCCAGTGAGGGCTGGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
903885331 1:26537604-26537626 GCCAAGGCCCAGAGTGTACAAGG - Intronic
903960249 1:27052554-27052576 GCCAAGGCCCAGGAAGGGCAGGG + Intergenic
904264946 1:29312856-29312878 GCCAAAGGCCAAAGGGGACAGGG - Intronic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905301596 1:36989657-36989679 GCCACGGGAGAGACTGGGCAGGG - Intronic
905876188 1:41433326-41433348 GCCTTGGGCCTGAGTGGGCAGGG + Intergenic
906116937 1:43363471-43363493 GCCAAAGGTCAGGGTGGGCGGGG - Exonic
906172161 1:43735558-43735580 GCCAACGGCCTGAGTGAGCATGG + Intronic
906208754 1:44000722-44000744 GCCAAGGGGCAGCGGGGGAAGGG + Intronic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
907425159 1:54374917-54374939 GCCAGGGGCCAGAGAGGGGGAGG + Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
907978387 1:59456148-59456170 GCTAAGGGCAAGATTGGTCATGG - Intronic
911026141 1:93436977-93436999 GCCTAGGGACAGAGTGGGATGGG + Intergenic
912451129 1:109768459-109768481 GCCAAGGGGTGAAGTGGGCAGGG - Intronic
912511936 1:110195534-110195556 GCAAAGGTGCAGGGTGGGCAGGG - Intronic
912518170 1:110228678-110228700 GCTAAGGGGCAGAGTGACCAGGG - Intronic
912681153 1:111729814-111729836 CCCCAGGGCCAGGGTTGGCAGGG - Intronic
913075164 1:115336073-115336095 CCCAAGGGCCAGTGGGAGCAAGG - Intronic
913197480 1:116470003-116470025 GCCAAGGGATAAAGTGGCCAGGG - Intergenic
914747992 1:150513393-150513415 GCCAAGGGCCAGGGGGAGCAGGG + Exonic
915164100 1:153939131-153939153 GCTTTGGGCCTGAGTGGGCAGGG - Intronic
915299094 1:154941861-154941883 GCACAGGGCCAGACAGGGCATGG + Intergenic
915321991 1:155061347-155061369 GCAGAGAGACAGAGTGGGCAGGG - Intronic
915322393 1:155062984-155063006 GCCAATGGTCAGAGTGGGGACGG - Intergenic
915513559 1:156400283-156400305 GCCAGGGTCCTGAGTGGGCCTGG - Intergenic
915979066 1:160408876-160408898 ACTAAGGTACAGAGTGGGCAAGG - Intronic
916081098 1:161232893-161232915 CACAGGGGCCAGGGTGGGCAAGG + Exonic
917839443 1:178965664-178965686 TCAAGGGGGCAGAGTGGGCAGGG - Intergenic
917964536 1:180170011-180170033 GCCAAGGCCCTCTGTGGGCAGGG + Intronic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
919978371 1:202627481-202627503 ACCCAGGGCCTGAGTGGTCATGG + Intronic
920534643 1:206729614-206729636 GCCCATGGGCAGAGAGGGCAAGG - Intronic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
920840601 1:209550675-209550697 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
920842180 1:209564199-209564221 GCCAAGGCACACAGTGGACAGGG - Intergenic
921051710 1:211515786-211515808 GCCAAGGTCGGGAGTGGGGAAGG + Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
922749773 1:228064943-228064965 GGCAAGGGCCAGGGCTGGCAGGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
922909088 1:229200314-229200336 GCCCAGGGCAAGAGGGGGCCAGG - Intergenic
922938189 1:229436986-229437008 GCCAGTGGCCAGGGAGGGCAAGG + Intergenic
923147607 1:231209137-231209159 GGCCAGGGCCAGCGTGGTCAAGG + Exonic
1063121816 10:3109884-3109906 CCCATGGGGCAGAGGGGGCAGGG + Intronic
1063610077 10:7554314-7554336 GCCAATGGCCAGGATGGGCGTGG - Intergenic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1065122898 10:22545386-22545408 GCCAAAGGGCAGAGAGGGAAGGG + Intronic
1065328498 10:24570625-24570647 GAAGAGGGCCAGAGTGGCCAGGG - Intergenic
1065848995 10:29771171-29771193 GCCATGGGACAGAGAGGGCTTGG + Intergenic
1066457980 10:35588048-35588070 GCCCAGAGCCAGGGTGGGCCTGG - Intergenic
1067029862 10:42872751-42872773 GACAATGGCCAGGGTGGTCATGG + Intergenic
1067237909 10:44467231-44467253 GCCCAGGCCCAGGGTAGGCAGGG - Intergenic
1068039210 10:51801418-51801440 ACCATGGGCCAGATTTGGCATGG + Intronic
1068200706 10:53780958-53780980 GCCTTGGGCCAGCGTGGGGAAGG - Intergenic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1072660494 10:97360762-97360784 ACTAAGGCCCAGAGAGGGCAAGG + Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1072921521 10:99581059-99581081 GCCAAGGGAGGAAGTGGGCATGG + Intergenic
1073204676 10:101762603-101762625 GCCCAGGGAGAGACTGGGCAGGG + Intergenic
1073429879 10:103479151-103479173 TCCAAGGGCCTGAGGGGCCAAGG + Exonic
1073467843 10:103704681-103704703 GCCAAGGGCCTGTGTGCCCAGGG + Intronic
1073656566 10:105423646-105423668 GCCAAGGAGCAAAGTGGCCATGG - Intergenic
1074105932 10:110389688-110389710 GCAAAGGGCCTGAGTGGGGAAGG + Intergenic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1076883250 10:133249632-133249654 AACGAGGCCCAGAGTGGGCACGG + Intergenic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077142749 11:1031577-1031599 GAGAAGGGCCAGGGTGGGCCTGG - Intronic
1077216060 11:1395599-1395621 GCCCAGGGCCACAGTGGGTGGGG - Intronic
1077289739 11:1783540-1783562 GCCTAGGGCCAGAGCAGGCTGGG - Intergenic
1077321739 11:1945977-1945999 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1077352120 11:2097844-2097866 AGCACGGGCCAGAGTGGGGAGGG - Intergenic
1077415161 11:2421347-2421369 GCCGAGGCCCAGAGAGGGCAAGG + Intronic
1077546906 11:3175891-3175913 GCCAGAGGCCAGTGTGGCCAGGG + Intergenic
1077557389 11:3232166-3232188 GCCCAGGGTCAGAGCAGGCAGGG - Exonic
1078604476 11:12762979-12763001 GCCAAGGGCCTGAGTAGGGAGGG - Intronic
1081630151 11:44683994-44684016 GCCAAGAGCCAGAGAGGGGAAGG - Intergenic
1081702996 11:45163675-45163697 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1081808767 11:45903772-45903794 GCCAAGGGAGGGTGTGGGCAGGG - Intronic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1083150174 11:60786999-60787021 GCAAAGCAGCAGAGTGGGCACGG - Intronic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083353488 11:62047883-62047905 GCTGGGGGCCAAAGTGGGCAAGG - Intergenic
1083476874 11:62920864-62920886 CCCTAGGGGCAGAGTGGGAAGGG - Intronic
1083761944 11:64823610-64823632 GGGAAGGGCCAGAGTGTGCCCGG + Exonic
1083791585 11:64989477-64989499 GCCAAGGGACAGTGAGGGCAGGG + Exonic
1083928531 11:65824692-65824714 GCCTAGGGCCAGACTGGGGAGGG - Intronic
1084128802 11:67118545-67118567 GCCCAGGGCGAGAGGGCGCAGGG - Intergenic
1084538733 11:69774166-69774188 GCCGAGGGGCGGAGTGGGCCAGG - Intronic
1084544684 11:69809008-69809030 GCCCAGGGTCAGAGTGTCCAGGG - Intergenic
1084590126 11:70085571-70085593 TCCTAGGGCCAGAGAGGCCAAGG + Intronic
1084955201 11:72687532-72687554 GCCAAAGGCCTGACTGAGCAGGG + Intronic
1085205127 11:74727042-74727064 TCCAAAGGCCAGAGTGGACTCGG + Intronic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085444648 11:76592208-76592230 GCAGAGGGGCGGAGTGGGCACGG + Intergenic
1085468097 11:76737833-76737855 TCCAAGGGCCAGACTGGGGCCGG + Intergenic
1088409670 11:109520385-109520407 GCAAAGGGCTAGGGTGGGTATGG - Intergenic
1089256533 11:117197192-117197214 TCCAAGGACCAGGGTGGCCAGGG - Exonic
1089457003 11:118631556-118631578 GCCAAGGTCCAGTGAGGGGAAGG + Intronic
1090185009 11:124732420-124732442 GCCTTGGGCCAGAGAGGCCAGGG - Intergenic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091071092 11:132564173-132564195 ACCAAGGGCCACAATGGCCAGGG - Intronic
1202804757 11_KI270721v1_random:1290-1312 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1091695759 12:2627102-2627124 ACAAAGGGCAGGAGTGGGCAGGG - Intronic
1091769446 12:3141568-3141590 GCCAAGGGCAAATGAGGGCACGG - Intronic
1092554766 12:9545464-9545486 GCTGAGGGTGAGAGTGGGCAAGG + Intergenic
1095424014 12:42055858-42055880 GCTAAGAGCTAGAGAGGGCAGGG - Intergenic
1096624808 12:52888075-52888097 ACCAAGGCCCAGAGAAGGCAGGG + Intergenic
1096747008 12:53735671-53735693 GCCCAGGGCCAGATTGGGGCGGG - Intergenic
1096913628 12:55009336-55009358 GCTGGGGGCCAGAGTGGGGATGG + Intergenic
1102236893 12:111299163-111299185 GCCAAGGGACAGAGGGCTCAAGG - Intronic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1103146488 12:118599544-118599566 GGCAGAGGCCAGAGTGTGCAGGG - Intergenic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1105894572 13:24707215-24707237 CCCAAGGGCCAGGGTGGTCTGGG + Intronic
1107086398 13:36431806-36431828 CCCTCGGGCCAGCGTGGGCAGGG + Intergenic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1111541444 13:89672293-89672315 GCCAAGGAACAGAGTGGGAGTGG - Intergenic
1112734151 13:102399461-102399483 GCCAAGGGCTGCAGTGGGAAGGG - Intronic
1113543903 13:111131569-111131591 GCCAAGGGCCAGCCTTGGGAAGG + Intronic
1113890043 13:113730940-113730962 GCCCAGCACTAGAGTGGGCATGG + Intronic
1113936232 13:113996460-113996482 GCCAAGGGGCTGAGTAGGGAGGG - Intronic
1114209968 14:20606069-20606091 GCCAAGGGCCAGGTTTGCCATGG - Intronic
1114562451 14:23603146-23603168 CCAAATGGCCACAGTGGGCAGGG + Intergenic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1119423479 14:74521883-74521905 GCCAAGGGCAAGGGCGGGCTTGG + Intronic
1119775095 14:77243260-77243282 GACCAGGGCTAGAGTGGGAAGGG + Intronic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1120144109 14:80960805-80960827 GCCAAGGCCTACTGTGGGCAAGG + Intronic
1120537434 14:85714224-85714246 TCAAAGGGCCATTGTGGGCAGGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121637711 14:95465121-95465143 GGCAAGGGCAAGAGAGAGCAAGG + Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122024935 14:98868945-98868967 GGCATGGGCCAGAATGGGCCTGG - Intergenic
1122037826 14:98961349-98961371 GCCAAGGGCCAGGGTGGGAGAGG + Intergenic
1122141638 14:99666530-99666552 TCCAGGGGCCAGGCTGGGCATGG - Intronic
1122206057 14:100148566-100148588 TCCAGGGGCCAGAGAGGACAGGG - Intronic
1122312167 14:100804281-100804303 CCCAGGGGTCAGGGTGGGCATGG - Intergenic
1122362217 14:101174247-101174269 GACGAGGCCCAGAGAGGGCAAGG + Intergenic
1123876365 15:24627698-24627720 GCCAAGTGCCAACGTGGGCCTGG - Intergenic
1124493996 15:30175420-30175442 ACCCAGGGCCTGAGTGGTCATGG + Intergenic
1124749573 15:32363226-32363248 ACCCAGGGCCTGAGTGGTCATGG - Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125758674 15:42083016-42083038 ACCAGTGGCCAGAGCGGGCATGG - Intronic
1126671364 15:51118365-51118387 GCAAAGAGCCAGATTGGACATGG - Intergenic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128656659 15:69467672-69467694 ACCAGGGGCCAGAGAGGTCAGGG - Intergenic
1128997652 15:72308574-72308596 GGCAAGGGCCAGATTAGGGAAGG + Intronic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1129171974 15:73813520-73813542 GGCAAGGGCCAGAGACAGCAAGG - Intergenic
1129172332 15:73815870-73815892 GCAAAGGCCCAGAGGTGGCAAGG - Intergenic
1129365051 15:75049037-75049059 GCCCAAGGCCTGAGAGGGCAAGG - Intronic
1129665189 15:77575687-77575709 GCCAGGGACCTGAGTGAGCAGGG - Intergenic
1130907268 15:88249527-88249549 CCAAGGGCCCAGAGTGGGCAGGG - Intronic
1131321005 15:91391146-91391168 GCCCAGGGGCAGAGTTGGAAGGG - Intergenic
1131592999 15:93769310-93769332 GCCCAGGGGAAGGGTGGGCAGGG + Intergenic
1132306883 15:100821696-100821718 GCCCATGGCCTGGGTGGGCAGGG - Intergenic
1132384538 15:101390690-101390712 GCCAACAGCCCGAGTGGGCAAGG + Intronic
1132462859 16:63914-63936 GACCAGGGTCTGAGTGGGCAAGG + Intronic
1132532102 16:456967-456989 CACATGGGCCAGCGTGGGCAGGG - Intronic
1132607842 16:800894-800916 GCCAGGGGCCAGTGTGGGGCTGG + Intergenic
1132639583 16:971467-971489 AGCAAGGGACAGAGTAGGCAGGG + Intronic
1132651083 16:1021730-1021752 GCCGCTGGCCAGAGTGGGGACGG - Intergenic
1132886624 16:2185074-2185096 GGCCAGGGCCAGGGTGGCCAGGG - Intronic
1132949165 16:2550940-2550962 GCCAAGGACCAGCGTGGGCAGGG + Intronic
1132965423 16:2651188-2651210 GCCAAGGACCAGCGTGGGCAGGG - Intergenic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133718461 16:8471644-8471666 GCCAAGCCCCAGTTTGGGCACGG - Intergenic
1134102155 16:11460091-11460113 GCCCAGGGACTGGGTGGGCAGGG - Intronic
1134416586 16:14048558-14048580 CACAGGGGCCAGAGTGTGCAGGG + Intergenic
1135564907 16:23504683-23504705 GCTAGGGGCCAGACAGGGCACGG + Intronic
1136475906 16:30513260-30513282 GCCAAGGGCAGGTGTGTGCAGGG + Intronic
1136509590 16:30728501-30728523 GCCAAGGGCCAGACTGGAATGGG - Intronic
1136775713 16:32870740-32870762 GCCAGGGGCCAGGGCAGGCAAGG + Intergenic
1136894904 16:33990772-33990794 GCCAGGGGCCAGGGCAGGCAAGG - Intergenic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1139204325 16:65012269-65012291 GCCATGGCCCAAAGTGGGAATGG - Intronic
1139308189 16:66005943-66005965 TCAAAGGCCCAGAGTGGGTAAGG + Intergenic
1139432967 16:66920937-66920959 GCCATGGGCATGGGTGGGCAGGG + Intergenic
1139475509 16:67200694-67200716 CCCAAGGGCCAGGGGAGGCACGG - Exonic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141378861 16:83557383-83557405 TCCACGGACCAGAGTGGGGATGG - Intronic
1141569975 16:84928462-84928484 GCGATGGGCCAGGGTGGGGAGGG - Intergenic
1141609758 16:85174729-85174751 ACCCAGTGCCAGGGTGGGCATGG + Intronic
1141998525 16:87649738-87649760 CCCAGGGGCCAAAGTGGGGAGGG - Intronic
1142108440 16:88318548-88318570 GCCAAGGGCAGGAGTGGGGTGGG + Intergenic
1142130387 16:88429346-88429368 GCCGAGGGCCCGAGGGGGCCGGG - Exonic
1142208000 16:88793095-88793117 GGCAGGGGCAGGAGTGGGCAGGG - Intergenic
1142285953 16:89171629-89171651 GCCGAGGGCCGGCCTGGGCAGGG - Intergenic
1203078131 16_KI270728v1_random:1132849-1132871 GCCAGGGGCCAGGGCAGGCAAGG + Intergenic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1142859658 17:2753636-2753658 GGTAAGGGCCAAAGTGTGCAAGG + Intergenic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143502422 17:7347124-7347146 GCCCAGGTCCAGAGTGTGGATGG + Exonic
1143787487 17:9266746-9266768 ACCAAGGGCCACGGTGGGGAGGG + Intronic
1144658583 17:17053590-17053612 GCCATGGGCGAGATGGGGCAGGG + Intronic
1145037710 17:19552856-19552878 GCCCAGGGTCAGCGTGCGCAGGG + Intronic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1145264466 17:21373045-21373067 GCCAAGGTCTAGGGTGGGCAGGG + Intergenic
1145800263 17:27678371-27678393 GCCAAGAGGCAGAGGTGGCAGGG - Intergenic
1146066779 17:29642272-29642294 CACAAGGGCCAGAGGAGGCAGGG - Intronic
1147150774 17:38512418-38512440 GGAAAGGGCCAGAGTGGGGCTGG + Intergenic
1147388797 17:40097004-40097026 GGCCAGGGCCAGATTGGGAATGG - Intronic
1147725929 17:42566178-42566200 CCCATGGGCAAGAGTGGGGAGGG - Intronic
1148087957 17:45006100-45006122 GCCAGGAGCGAGAGTGGGCCTGG - Intergenic
1148191086 17:45679088-45679110 GCCAGGGGCAAGGGTGGGCGGGG - Intergenic
1148737816 17:49874634-49874656 GCCAGGGGCCATGGTGGGAAGGG - Intergenic
1148764449 17:50028999-50029021 CCCAAGGGCCTTAGTGGGGATGG + Intergenic
1148863203 17:50615208-50615230 ACCAAGGGGCAGCGTGGGGAGGG + Intronic
1149116041 17:53097629-53097651 GCCAAGGTACAGCTTGGGCATGG + Intergenic
1149258315 17:54851989-54852011 TCCAAGGGACAGACTGGGCCAGG + Intergenic
1149420005 17:56501224-56501246 GCCAGAAGCCAGAGTAGGCAGGG + Intronic
1149951881 17:60997004-60997026 TCCATGGGCCAGTGTGGGGAGGG + Intronic
1150216696 17:63475441-63475463 GCCAGGGGCCAGGGAGGGCAAGG - Intergenic
1150445221 17:65223432-65223454 GCCAGGGGCCACTGAGGGCAGGG - Intronic
1150540185 17:66088826-66088848 GCCAGGGGCCTGAGTGTGCAGGG - Intronic
1151051725 17:70985684-70985706 GCCAAGTGCAAGAGGGGTCAGGG + Intergenic
1151193527 17:72415719-72415741 GCCAAGGGCCAGAGCGGCTCTGG - Intergenic
1151509125 17:74547519-74547541 GACAAAGGCCCGAGTGGGGAGGG - Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152040706 17:77900839-77900861 GCACAGAGCCAGTGTGGGCATGG - Intergenic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152238367 17:79149939-79149961 GCTAAGTGCCAGGGTGGGGATGG + Intronic
1152374681 17:79913080-79913102 GCCAAGGGGCAGGGTGGGCGTGG - Intergenic
1152376558 17:79921595-79921617 GCCGAGGCCCAGAGAGGTCAAGG - Intergenic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152924330 17:83080358-83080380 GCCCCGGGCCAGAGCGGGAAGGG + Intronic
1153332073 18:3883702-3883724 GGCAAAGGCCAGGCTGGGCAAGG + Intronic
1153522677 18:5967219-5967241 GCCCAGGGCCACAATGAGCATGG + Intronic
1153939949 18:9968868-9968890 GCGAGGGGCCAGAGTGTGAAGGG - Intergenic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1156329530 18:36106594-36106616 GCCAAGGCAAAGAGTGGTCAGGG + Intergenic
1157416637 18:47508954-47508976 GCCCAGGGAAAGAGTGGCCAGGG - Intergenic
1157896251 18:51471029-51471051 ACCCAGGGCCAGAGGGGTCATGG - Intergenic
1158390253 18:57039208-57039230 GCCCAGGGAAGGAGTGGGCAAGG + Intergenic
1159741362 18:72175319-72175341 GCCAAGGGCCATTGTGTTCATGG - Intergenic
1160521477 18:79510763-79510785 GCCCAGGGCCACACAGGGCAGGG - Intronic
1160591166 18:79945415-79945437 GCCATGGCCCAGGGTGGACAGGG + Intronic
1160842216 19:1151246-1151268 GCCTTGGGCCAGGCTGGGCAGGG + Intronic
1160947076 19:1648638-1648660 CCCAAGGGCCGGAGGGGCCAAGG - Intronic
1161008649 19:1949306-1949328 GCCAGGGGCTGGAGAGGGCACGG - Intronic
1161315500 19:3615440-3615462 GCAAAGGCCCAGAGGTGGCAGGG - Intronic
1161853419 19:6750636-6750658 GAGAACGGCCAGAGTGGGCTTGG + Intronic
1162065726 19:8124119-8124141 GTCGAGGGCCAGAGTGGAAAGGG + Intronic
1162487847 19:10972655-10972677 GCAAAGGCCAAGAGTGGGCAGGG - Intronic
1162566186 19:11446776-11446798 GCCCAGGACCAGAGAGGGCCAGG - Intronic
1163526557 19:17824908-17824930 CCCCAGGGCCAGAGTGGGGCTGG + Exonic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1164635983 19:29791856-29791878 GCTCAGGGCCAGAATGAGCAGGG - Intergenic
1164989634 19:32674844-32674866 CCCGAGGGGCGGAGTGGGCAGGG + Intronic
1165166997 19:33863733-33863755 GCCAGTGGACACAGTGGGCATGG + Intergenic
1165304356 19:34994622-34994644 GAGAAAGGACAGAGTGGGCATGG - Intergenic
1165856831 19:38883970-38883992 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1166542009 19:43611768-43611790 GCCACTGCCCAGAGTGGTCAGGG - Intronic
1166931344 19:46303503-46303525 GCCAGGGGCCAGAGGAGGGAGGG - Intronic
1167136365 19:47618602-47618624 GCAGAGGGACAGGGTGGGCATGG - Intronic
1167252090 19:48404834-48404856 GCCAGGGGCACGAGTGGTCACGG - Exonic
1167610705 19:50506564-50506586 GACAGGGGCCTGTGTGGGCAGGG + Exonic
1167637510 19:50663417-50663439 GCCCAGGGCAAGAGTGAGCCAGG - Intronic
1167831983 19:52031197-52031219 GCCAAGAGCTAGAAAGGGCATGG + Intergenic
1168414570 19:56160175-56160197 CCCAAGGGCCAGGGCGGGAAGGG - Exonic
1168571505 19:57474903-57474925 GCCAAAGGCCAGAGTATGAAAGG + Intronic
1168588914 19:57616660-57616682 GCCAAAGGGCAGGGTAGGCAGGG + Intronic
925045454 2:770000-770022 GCCATGGCACAGAGTGGGAAGGG - Intergenic
925292954 2:2760703-2760725 GCCAACAGCCTGAGTGGGCTTGG - Intergenic
925873339 2:8289852-8289874 GCCAAGGAGCAGAGTGGGAGTGG - Intergenic
925986199 2:9217142-9217164 ACCAAGGGCCTTGGTGGGCACGG - Intronic
926196285 2:10765485-10765507 GCCAAGGGTCAGAGTGGAGCTGG + Intronic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
926972788 2:18483773-18483795 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
927131801 2:20066390-20066412 GCCAAGGGCCTGTATGGGCCTGG + Intergenic
927592090 2:24365207-24365229 GTCAAAGGCCAGACTGGGCGAGG + Intergenic
927782651 2:25951994-25952016 GCCAAGAGGCAGAGGGGGCTGGG + Intronic
927810509 2:26178016-26178038 ACCCAGGGCCAGAGGAGGCAGGG - Intronic
927843656 2:26460602-26460624 TCCAAGAGCCAGAGTGGGGAGGG + Intronic
927926695 2:27018651-27018673 CCGAAGGGGCAGAGTGGGTAGGG - Intronic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
928038638 2:27851306-27851328 AACAAGGGCCAGAGTAGGGAAGG - Intronic
928045280 2:27924996-27925018 GCCAAGAGCCAAAGTGCTCAAGG - Intronic
929009144 2:37423975-37423997 GCCTAGGGGCAGAGTGGGGCAGG + Intergenic
929563346 2:42969390-42969412 GCCAAGGCCCAGAGAGAGGAGGG + Intergenic
929737710 2:44568048-44568070 GCCAGGGGCCAGGGTGGGGGTGG + Intronic
931152002 2:59584997-59585019 GCCAAGGTCCAGTGTGGCAAAGG + Intergenic
931253737 2:60553762-60553784 GCCAATGGCCAGTGCGGGGAGGG + Intergenic
932113680 2:69025093-69025115 GCCAAAGGCAAGAGAGGGCATGG - Intronic
932886546 2:75554184-75554206 GACAAGGGCAGGAGGGGGCAAGG + Intronic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
934056274 2:88253856-88253878 GCAAAGAGTCAGGGTGGGCAAGG - Intergenic
934112696 2:88757390-88757412 GACAGGGGCCGGAGTGGCCAGGG + Intergenic
935072153 2:99704503-99704525 CCCAAGACCAAGAGTGGGCAAGG - Intronic
935373705 2:102374107-102374129 TCCATGGACCAGGGTGGGCAGGG - Intronic
935586498 2:104804363-104804385 ACCAGAGGCCAGAGTAGGCAAGG - Intergenic
936018631 2:108978107-108978129 GCAAAGGGCCCCAGAGGGCAAGG + Intronic
936163903 2:110103851-110103873 GACAGGGGCCGGAGTGGCCAGGG + Intronic
936349752 2:111703744-111703766 TCCAAGGGCCTGAGTGAGGATGG - Intergenic
936897345 2:117443662-117443684 ACCAAGGGCCACAGAGAGCAAGG - Intergenic
937112755 2:119379103-119379125 TCCAAGGGACAGAATGGACATGG - Intergenic
937302717 2:120853029-120853051 GTCGAGGGCCAGAGAGGGTAGGG - Intronic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938021452 2:127908953-127908975 GCCAAGGAGCACACTGGGCAGGG + Intergenic
938068271 2:128293295-128293317 CCCAAGGGCCAGCCTGGGCCTGG + Intronic
938691291 2:133791879-133791901 GCCAAGGGCAAGAGCAAGCAGGG + Intergenic
940193538 2:151067533-151067555 GCCAAGGCACAGATTGGGCATGG + Intergenic
942606109 2:177692965-177692987 GGAAAGGGCCAGGCTGGGCAGGG - Intronic
942745141 2:179223266-179223288 GCCTAGGGCTGGAGTGGGTATGG + Intronic
943620241 2:190140578-190140600 GCCAAGGTACAGTGTGGCCATGG - Intronic
944069804 2:195656362-195656384 GCAAAGGGCAAGAATGAGCACGG + Intronic
944197779 2:197073416-197073438 GCCAAGGGCCAGAGCTAGCCTGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946371973 2:219286439-219286461 CCCCAGGGTTAGAGTGGGCAGGG + Exonic
947238697 2:227971032-227971054 GCCAAGGGCCACATGGGTCATGG - Intergenic
947833165 2:233156225-233156247 GACAAGGCCAAGACTGGGCAGGG + Intronic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
948434477 2:237943906-237943928 CCCAAAGTCCAGAGGGGGCAAGG - Intergenic
948502444 2:238405358-238405380 GCCAGCTGCCAGAGGGGGCAGGG - Intergenic
948800550 2:240431493-240431515 GCCAAGAGTCAGGGTGGGGAGGG + Intergenic
948917273 2:241040670-241040692 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
1169910010 20:10640337-10640359 GCCAAGGGAGAGATTGGGCATGG - Intronic
1170603634 20:17860043-17860065 GCCTGGGGAAAGAGTGGGCAGGG - Intergenic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172025617 20:31946318-31946340 GCCCAGGGACAGAATGGACAGGG - Intronic
1172055120 20:32149606-32149628 GCGAAGGGCCAGAGTGAGGCTGG - Intronic
1172057835 20:32166477-32166499 CCCAGAGGCCAGAGAGGGCAGGG - Exonic
1172621411 20:36320420-36320442 GGCAAGGGTCAGTGTGGGCCTGG - Intronic
1172791169 20:37506479-37506501 GCAAAGGGCGAGGGTGGGCAAGG - Intronic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1172951758 20:38726980-38727002 GCCAGTGGAAAGAGTGGGCACGG - Intronic
1173335060 20:42105953-42105975 GCCAAGGTACAGAGTGGGATAGG + Intronic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1174073858 20:47918282-47918304 TCCAAGGTCCAGAGAGGGCTGGG + Intergenic
1174077201 20:47946115-47946137 ACTAAGGGCCAGATTGTGCAGGG + Intergenic
1174355584 20:49995736-49995758 GCAAAGGCCCTGAGGGGGCAGGG - Intergenic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174470973 20:50760614-50760636 CCAAAGGGCCAGAGTGGGGCAGG + Intergenic
1175123300 20:56733395-56733417 GCCAAGGGATTGACTGGGCATGG - Intergenic
1175273211 20:57749255-57749277 TCCCAGGGCCTGAGAGGGCAAGG + Intergenic
1176119379 20:63447104-63447126 GGCAGGGGCCAGAGTGGAGAGGG - Intronic
1176173315 20:63706244-63706266 CCCGAGGGACAGAGTGGGTAAGG + Intronic
1176372584 21:6071267-6071289 GCCCCAGGCCGGAGTGGGCAGGG + Intergenic
1177486150 21:21758780-21758802 GCCAAGGGACAGGGGTGGCAGGG + Intergenic
1177486449 21:21762822-21762844 GCAAAGGGCCAGACTGGGAGGGG + Intergenic
1177912002 21:27044290-27044312 GCTAAGGGACAGAGTTGGCTAGG + Intergenic
1179096005 21:38314783-38314805 GCCACTTACCAGAGTGGGCAAGG - Intergenic
1179750892 21:43466978-43467000 GCCCCAGGCCGGAGTGGGCAGGG - Intergenic
1180012351 21:45059256-45059278 GCCAGGGGCCAGTGAGGGCAGGG - Intergenic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182110224 22:27717926-27717948 GCCAGGGCAGAGAGTGGGCAGGG + Intergenic
1182149887 22:28020466-28020488 GCCAAGGGGCAGAGGGGTCAGGG + Intronic
1182422049 22:30253454-30253476 GCCAAGAGTCAGGGTGGCCAGGG - Intergenic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183378148 22:37476997-37477019 GCCAAGGGGCAGAGTGAGCCTGG + Intronic
1183479430 22:38055276-38055298 AAGAAGGGCCAGAGTGGGTAGGG + Intergenic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1184149976 22:42632089-42632111 GCTAAGAGCCAGATTGGGCCAGG + Intronic
1184232854 22:43167903-43167925 GCCCAGGGCCGGTGTGGGGAGGG + Exonic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184919165 22:47593536-47593558 GGCAAGAGCCAGAGAGGGGAGGG - Intergenic
1185169025 22:49281464-49281486 TCCTGGGGCCAGAGTGGGCTTGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185370762 22:50459877-50459899 GCCCAGGCCCACAGCGGGCAGGG + Intronic
1185373407 22:50471112-50471134 GCCAAGGGGAGGAGTGGGGAGGG - Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
949898655 3:8791930-8791952 GCCAAGGGGCAGAGTGAGGGAGG - Intronic
950039529 3:9911055-9911077 CCCCAGGACCAGGGTGGGCAGGG + Intronic
950109369 3:10408666-10408688 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
953717244 3:45326061-45326083 GCCCAGGGCCAGCCTGGGCCAGG - Intergenic
953827005 3:46262048-46262070 GACATGGGGCAGAGTGGGAAGGG - Intronic
954383286 3:50230954-50230976 GCTGAGGTCCAGAGTGGGCCAGG - Intronic
954952682 3:54489119-54489141 GGCAGAGGCCAGAGTGAGCAGGG + Intronic
956625112 3:71259187-71259209 CCCATGGGCATGAGTGGGCACGG + Intronic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
961353189 3:126316740-126316762 TCCATGGGCCGGAGTGGGGAAGG + Intergenic
961649981 3:128412477-128412499 GCCAAGGGGCTGCATGGGCAAGG + Intergenic
962146824 3:132848388-132848410 GCTAAGGGCTGGAGTTGGCAAGG - Intergenic
963260901 3:143189938-143189960 GTCAAGGGACAGAGAGGCCAGGG - Intergenic
963721783 3:148869720-148869742 CCCAGGGCCCAGACTGGGCATGG - Intronic
964259002 3:154812077-154812099 GACACTGGCCAGAGTGGCCAAGG - Intergenic
965448594 3:168807720-168807742 GCAGAGGGCTAGGGTGGGCAAGG + Intergenic
965683760 3:171279541-171279563 GCCAATAGCCAGAGTTGGCAAGG - Intronic
966107101 3:176349251-176349273 GCCAGGGTGCAGAGGGGGCAAGG - Intergenic
966869153 3:184278631-184278653 GCCAAGGGTCAGAGCAGGGAAGG + Intronic
968481412 4:834713-834735 GGCAGGGGCCAGAGACGGCAGGG + Intergenic
968488842 4:878996-879018 GCCAACAGCCCGAGTGGCCAAGG + Intronic
968541170 4:1169166-1169188 GCACTGGGCCACAGTGGGCAGGG - Intronic
968562941 4:1294637-1294659 GCCCAGGGCCTGACTGTGCAGGG - Intronic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
968702110 4:2062131-2062153 GCCACGGCCCAGAGGGAGCAGGG - Intronic
968812396 4:2805867-2805889 GCCAAGGTGCAGAGAGGGAAGGG + Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969272173 4:6110478-6110500 GCCAAGGGCTGGAGAGGGCGGGG - Intronic
969344057 4:6560237-6560259 GCCAAGAGCCTGGGTGGGCTGGG - Intronic
970689650 4:18607765-18607787 TCCAAGGGCCAGAGAGAACATGG - Intergenic
974000462 4:56506330-56506352 GATAAGGGCTAGGGTGGGCAGGG - Intronic
974036775 4:56824356-56824378 GCTAAGGTCAAGGGTGGGCATGG - Intergenic
976220136 4:82750191-82750213 GCTGAGAGCCAGAGTTGGCATGG + Intronic
978635604 4:110801894-110801916 GCCAGGGGCTAGAGTGAGGAGGG + Intergenic
979831378 4:125309730-125309752 ACCATGGGACTGAGTGGGCATGG + Intergenic
980266543 4:130524138-130524160 GCCAAGGTACAGCTTGGGCATGG - Intergenic
980386675 4:132093992-132094014 GCCAAAGGCCAGAGAGCCCATGG + Intergenic
980481611 4:133395172-133395194 GCCACGGGCTGGAGAGGGCAAGG + Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
995570596 5:113476730-113476752 GCCTAGGGCCGGAGTGGTTAGGG + Intronic
996529930 5:124518034-124518056 ACCAAGGGACACAGTGAGCAGGG - Intergenic
997212167 5:132083245-132083267 CCCAAGGCCCAGAGAGGGCAGGG + Intergenic
997386754 5:133479669-133479691 GCCTAGGGCTGGGGTGGGCATGG + Intronic
997417769 5:133742106-133742128 GCCAAGGGTAAGAGGGTGCAGGG - Intergenic
997663086 5:135604296-135604318 GCCCAGGGCCAGCCTGGGCCAGG + Intergenic
997665394 5:135626130-135626152 GCCAAGGGCCTGAGTCTGCATGG + Intergenic
997978529 5:138454432-138454454 GCCCAGAGCCAGTGTGGGGAGGG + Intergenic
998160679 5:139811213-139811235 GCCAAGGAACAAAGTGGGGAGGG - Intronic
998656832 5:144190660-144190682 GCAAAGGGACAGAGGGGACAAGG - Intronic
999195063 5:149776280-149776302 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
999265588 5:150264886-150264908 CCCACGTGCCAGGGTGGGCAGGG + Intronic
999440520 5:151597247-151597269 GCCAAGCCCCTGAGTGGGCAAGG - Intergenic
999693081 5:154165723-154165745 GCCTAGGGCCAGAGAAGGCTGGG + Intronic
1000020232 5:157311817-157311839 GCCCAGGGCCAGAAGGGGTAAGG + Intronic
1001246873 5:170111482-170111504 GCCACAGGCAAGAGTTGGCAGGG - Intergenic
1001478152 5:172065583-172065605 GCCCAGGGCCAGCGGGGGTAGGG - Intronic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1002018043 5:176341513-176341535 GCAGAGGGCCAGAGGGGCCAGGG + Intronic
1002083012 5:176748611-176748633 GGCAAGGTCCAGAGAGGGGAAGG - Intergenic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1003483333 6:6553322-6553344 GCCAAAGGCAAGAATGGGCATGG + Intergenic
1005724241 6:28633493-28633515 GCGGAGGCTCAGAGTGGGCAAGG + Intergenic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006106339 6:31719147-31719169 GCCCAGGGCTGGAGTGGGCCGGG + Exonic
1006118822 6:31791832-31791854 GCCCAGGCCCAGAGTGGGTGGGG - Intronic
1006292990 6:33154839-33154861 GCAAAGGCACAGAGTGGGAAAGG - Intergenic
1006376975 6:33677081-33677103 GTCAAGGGCGTGAGTGGCCAAGG + Exonic
1006406772 6:33850043-33850065 GCCCAGGGCCAGAGCTGGGACGG + Intergenic
1006823580 6:36917551-36917573 GCCATGGTCCAGAGGTGGCAGGG - Intronic
1007077110 6:39075003-39075025 ACCAAGGCCCAGAGCTGGCAGGG + Intronic
1007257187 6:40537566-40537588 GACAAGGGTCAGAGTGGTCAGGG - Intronic
1008796097 6:55304893-55304915 GGCAAGGGGCAGAATGGACAGGG - Intergenic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1015370037 6:132440141-132440163 GCCAATGGCCAGATTGAGTAGGG - Intergenic
1016809681 6:148247839-148247861 GGGAGGGGCCAGAGTGGCCAGGG - Intergenic
1018988992 6:168659333-168659355 GCCAAGAGACAGAGGGAGCAAGG + Intronic
1019529363 7:1495858-1495880 GCCACGGGCGGGAGTGGGGAGGG - Intronic
1019569819 7:1705671-1705693 GCCATGAGCCAGAAAGGGCAGGG - Intronic
1019576892 7:1741885-1741907 GCCCAGGGCCCCAGTGAGCATGG + Intronic
1019707923 7:2505211-2505233 CCCAGGGGCCAGAGAGGGGAGGG - Intergenic
1019733765 7:2640699-2640721 GCCTGGAGGCAGAGTGGGCATGG + Intronic
1021340545 7:19458114-19458136 GCCAAGGATCAGAGGGAGCATGG + Intergenic
1021596687 7:22324762-22324784 GCCAGAGACCTGAGTGGGCAGGG - Intronic
1022019166 7:26382109-26382131 GACAAGAGCCAGTGTGGGCTGGG - Intergenic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023714918 7:43034238-43034260 GCCAAGGGCTGGAGTGAGAAAGG + Intergenic
1023828819 7:44027856-44027878 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1023890855 7:44391018-44391040 GACAAGGGCCAGGGTGGACAGGG + Intronic
1025110746 7:56214106-56214128 TCCAAGGGGAAGAGTGGGAAGGG - Intergenic
1025941605 7:66079419-66079441 GGCATGGGACAGAGTGGGGAGGG - Intronic
1026292977 7:69025387-69025409 GCCACGCTGCAGAGTGGGCATGG - Intergenic
1026491100 7:70864300-70864322 GCCAAGGGCTGGAGTGGGGAGGG - Intergenic
1028156220 7:87432707-87432729 GCCAAGGGCTAGAGTGAGGGTGG + Intronic
1029608877 7:101616053-101616075 ACCAAGGCCCAGAGAGGGGAAGG + Intronic
1029739118 7:102482113-102482135 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1029757119 7:102581292-102581314 GCCCCGGGGCAGGGTGGGCAGGG - Exonic
1030033517 7:105389091-105389113 GCCGAGGGCCAGCGCGGCCATGG - Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1030385558 7:108863739-108863761 CCCAAGGGACTGAGTGGACAGGG + Intergenic
1030769343 7:113455021-113455043 GTCCAGGGCAAGAGTAGGCATGG - Intergenic
1031866432 7:127042367-127042389 GCCAAGGCACAGAGGGGTCATGG + Intronic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032080528 7:128856383-128856405 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1032091576 7:128914167-128914189 GGCAGGGGCCAGGCTGGGCATGG - Intergenic
1032222968 7:130008175-130008197 CTCAAGGGCCAGAAGGGGCAGGG + Intergenic
1032281975 7:130511145-130511167 GGCAAAGGGCAGAGTGGGAAAGG + Intronic
1032484667 7:132276446-132276468 GCCAAGGGAAAGGGTGGGAAAGG - Intronic
1032484695 7:132276609-132276631 GCAAAGGGGAAGAGTGGGAACGG - Intronic
1032541133 7:132704028-132704050 GCCAAGGACCAGAGCAGTCACGG + Intronic
1033262794 7:139858147-139858169 GCCATGGGGCAGAGTGAGCATGG - Intronic
1034072858 7:148203848-148203870 GCCCAGGGCCAGAATATGCAGGG + Intronic
1034255136 7:149720636-149720658 GCCAAGGGACAGCCAGGGCATGG - Intronic
1034757015 7:153632018-153632040 GCAAAGAACCAGACTGGGCATGG - Intergenic
1035082306 7:156226943-156226965 GGCAAGTGCCAGAGGGGTCAGGG + Intergenic
1035087237 7:156271109-156271131 GCCATGGACCAGAGTGGGGCAGG - Intergenic
1035094413 7:156341653-156341675 GCCCAAGGCCAGAGAGGACAAGG + Intergenic
1035110628 7:156478718-156478740 GCCAAGGCCCGCAGCGGGCAGGG - Intergenic
1035520235 8:270472-270494 ACCAAGGCCCAGAGTCGGGAGGG + Intergenic
1035572488 8:682030-682052 GCCAAGGGGCAGGGTGGGGGTGG - Intronic
1035740653 8:1925784-1925806 GCCAAGGCAAAGAGCGGGCACGG - Intronic
1036663816 8:10726116-10726138 GCCAAGGGCCAGGGAGCCCAGGG + Exonic
1037117630 8:15245740-15245762 ACCAATGGGCAGAGTGGGAATGG - Intergenic
1038446258 8:27606309-27606331 GCCAAGGCTCTGAGTGGGGAAGG - Intronic
1038726046 8:30083215-30083237 GCCAAGGGCCTGGGGAGGCACGG + Intergenic
1039401077 8:37269715-37269737 GCCAAGAGCTAGACTGGCCAGGG + Intergenic
1039853836 8:41395775-41395797 GCCAAGGGCCAGACAGTGCATGG - Intergenic
1039880478 8:41622303-41622325 GCAGAGGGGCAGGGTGGGCAGGG + Exonic
1039966447 8:42287507-42287529 GCCAAGCGCCAGGGTGGGTGGGG + Intronic
1040072553 8:43200370-43200392 GCCAAGGCCCAGACGGGCCAAGG - Exonic
1040580745 8:48696636-48696658 GCCAGGGCCCAGAGTGCACATGG + Intergenic
1041172632 8:55160527-55160549 TCCAAAGGCCAGAGTAGGCAGGG + Intronic
1041177796 8:55214689-55214711 GCCCAGGGGTGGAGTGGGCAGGG + Intronic
1041431060 8:57781045-57781067 GACAAGGGCCAGTGAGGACATGG + Intergenic
1041892926 8:62891362-62891384 GCCAAAGGCCAGAGTGTCCCTGG - Intronic
1042816402 8:72882243-72882265 ACCAAGGGCCAGAGTGGTATAGG - Intronic
1043526679 8:81105064-81105086 GCTAAGGGTGGGAGTGGGCAGGG - Intronic
1047385821 8:124408249-124408271 GACAGGGGCCAGAGAGGCCATGG - Intergenic
1047437515 8:124847211-124847233 GGCAAGGGCCTGAGTGGGTCAGG + Intergenic
1047773222 8:128047337-128047359 ACCATGGGCCAGAGGAGGCAGGG + Intergenic
1048283796 8:133125442-133125464 GCCAAGGCCCTAAGTGGGAAAGG + Intronic
1048927972 8:139287754-139287776 GCCAAGGGCAGGAGTGGGCAGGG - Intergenic
1049289188 8:141792458-141792480 CCCCAGGGCCACAGTGGGCCGGG + Intergenic
1049353288 8:142175579-142175601 GCCCAGGCCCAGAGAGGCCAGGG + Intergenic
1049398377 8:142412483-142412505 GGCAAGGGGCAGTGTGGGCTGGG - Intergenic
1049541704 8:143211715-143211737 GCCGAGGGCGAGAGGGCGCAGGG + Intergenic
1049655270 8:143794411-143794433 GCCCATGGCCAGAGGAGGCAGGG + Intronic
1052735625 9:32339336-32339358 GCCAAAGGCCTGAGTACGCAGGG - Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1056671996 9:88638367-88638389 GCCAAGAGCTGGGGTGGGCAAGG - Intergenic
1059457021 9:114406225-114406247 GCTCAGGGCCAGAGTGGCGAAGG - Intronic
1060525240 9:124316680-124316702 GCCAAGGTCCAGAGAGGGGAAGG - Intronic
1060821599 9:126664446-126664468 GCCAAGGGGCCCTGTGGGCAAGG + Intronic
1060891229 9:127189800-127189822 GCGAGGGGCCAGAGCGGGCCAGG + Intronic
1060995569 9:127873483-127873505 GCCCAGGGCCTGAGAGGGGAAGG - Intronic
1061075690 9:128340345-128340367 GGCAAGGGCCGGGGTCGGCAGGG + Intergenic
1061176785 9:129002397-129002419 ACCAAGGGACACAGAGGGCAGGG - Intronic
1061276356 9:129571187-129571209 ACCAAGGCACAGAGAGGGCAAGG - Intergenic
1061395079 9:130339417-130339439 GCTGAGGCCCAGAGTGGGAAGGG + Intronic
1061539722 9:131271640-131271662 GCCAAAGGGCAGACTGGGCGGGG - Intronic
1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG + Intergenic
1061702827 9:132428874-132428896 GCCAATGGTCAGAGAGGGCCTGG - Intronic
1061948985 9:133925579-133925601 CCCCAGGGGCAGAGTGGCCAAGG + Intronic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062306704 9:135911371-135911393 GCAAAGAGCGAGATTGGGCAGGG + Intergenic
1062453432 9:136625007-136625029 CCCCAGGAACAGAGTGGGCAGGG - Intergenic
1062522520 9:136964155-136964177 CTCCAGGGCCAGGGTGGGCACGG - Intergenic
1062586984 9:137253917-137253939 GCCCTGGGCCAGAGTGTTCAGGG - Intergenic
1062702325 9:137913829-137913851 CCTAAGGGCCTGAGTGGACATGG + Intronic
1187746205 X:22411905-22411927 GCCAATGGCCTGAGTGAGCTTGG + Intergenic
1190251556 X:48730891-48730913 GCCAGGGGCCAGTGTGGGCTTGG - Intergenic
1190284453 X:48952985-48953007 GCCAAGGTCCAAGGTGTGCAAGG + Intronic
1190741015 X:53288857-53288879 GCCAAGGTCCAGAGAGGGATTGG - Intronic
1192755951 X:74047252-74047274 GCCAAGGGCCAGGCCGGGCGCGG + Intergenic
1195316671 X:103686495-103686517 GCCAACGCCCAGCTTGGGCAAGG - Intronic
1195376615 X:104234184-104234206 GCCAAGAGCCAGAAGAGGCAGGG + Intergenic
1195614514 X:106901925-106901947 ACCAAAGCTCAGAGTGGGCAAGG - Intronic
1195658312 X:107354279-107354301 GCCAAGGGCCAAATTGTGGAAGG - Intergenic
1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG + Intronic
1199929065 X:152499922-152499944 CCCCAGGGCCAGAGCAGGCATGG - Intergenic
1200067191 X:153509582-153509604 CCCAAGGGCCAGGAGGGGCACGG - Intergenic
1200089550 X:153627936-153627958 GCAAAGGGCCAGTGTGGCCGGGG + Intergenic
1200104186 X:153703298-153703320 GCCAGGGGCCAGGGCAGGCAAGG - Intronic