ID: 1121098576

View in Genome Browser
Species Human (GRCh38)
Location 14:91234288-91234310
Sequence GCTGCTGGTGCGCAGCGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121098576_1121098584 7 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098584 14:91234318-91234340 GGTAGGGCAGGAAGCAGGCCAGG 0: 1
1: 1
2: 10
3: 81
4: 709
1121098576_1121098585 20 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098585 14:91234331-91234353 GCAGGCCAGGAAGATGACCACGG 0: 1
1: 0
2: 3
3: 22
4: 285
1121098576_1121098582 -5 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098582 14:91234306-91234328 GCAGCAACACGTGGTAGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 135
1121098576_1121098583 2 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098583 14:91234313-91234335 CACGTGGTAGGGCAGGAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 259
1121098576_1121098579 -10 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098579 14:91234301-91234323 CACCAGCAGCAACACGTGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1121098576_1121098580 -9 Left 1121098576 14:91234288-91234310 CCCAGACGCTGCGCACCAGCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1121098580 14:91234302-91234324 ACCAGCAGCAACACGTGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121098576 Original CRISPR GCTGCTGGTGCGCAGCGTCT GGG (reversed) Exonic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
901763946 1:11488240-11488262 GGGGCTGGTGCTCAGCCTCTAGG - Intronic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902043918 1:13511693-13511715 TCTACTGGTGGGCAGGGTCTGGG + Intronic
902626428 1:17679283-17679305 GCTCCTGGTGCACAACCTCTTGG + Intronic
902747782 1:18484705-18484727 GCTGCTGGTGCCCAGGCTGTGGG + Exonic
905112396 1:35605463-35605485 GCTGCTGGAGCACTGGGTCTGGG - Intronic
905770647 1:40636026-40636048 GATGTTGCTGCGCAGCTTCTTGG + Exonic
907224007 1:52927873-52927895 GCTCCTGATGCCCAGCGCCTCGG + Intronic
914255747 1:145960532-145960554 GCTGCTGGAGCGGAGGGGCTCGG - Exonic
914370639 1:147021628-147021650 GCTGCTGATGAGCAGTGACTGGG - Intergenic
914484052 1:148091782-148091804 GCTGCTGATGAGCAGTGACTGGG + Intergenic
915066346 1:153228182-153228204 GCTGCTGCTGCACAGAGACTTGG - Intergenic
917287740 1:173439457-173439479 GCTGCAGGTGGGCAGAGGCTGGG - Intergenic
917906179 1:179588849-179588871 GCTGCTGGTGCACAGCTCCTGGG + Intergenic
919544627 1:198899571-198899593 GCTACTGGAGCTCAGAGTCTGGG - Intergenic
920217150 1:204368959-204368981 GCTGCTGGGGAGCAGTGCCTGGG + Intronic
920458312 1:206117378-206117400 GCGGCTGGAGCGCAGCGGCGCGG + Intronic
922160316 1:223074792-223074814 GCTGTTGGTTTGCAGGGTCTGGG + Intergenic
1067552159 10:47243782-47243804 GCTGCTGGAGCAGAGTGTCTAGG - Intergenic
1072737439 10:97888717-97888739 GCTGCTGGTGTGCGGTGTCTGGG - Intronic
1077048486 11:556248-556270 GCAGCTGGTGCGCGGCTTCCCGG - Exonic
1077090818 11:777483-777505 TCTGCGCGTGCGCGGCGTCTGGG + Exonic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1083233645 11:61338562-61338584 GCTGCTGGAGGGCAGGGACTAGG + Intronic
1083436553 11:62647238-62647260 TCTGCTGCTGCTCAGTGTCTGGG - Exonic
1084000968 11:66295308-66295330 GCAGCTGGTGCCCAGCTACTCGG + Exonic
1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG + Exonic
1089476010 11:118762585-118762607 GCTGCTGATGCCCAGCATCATGG + Intronic
1092384176 12:8023015-8023037 GCTGCTGGTCAGCAGAGTCATGG + Intergenic
1094436387 12:30425041-30425063 GCTGCTGGAGCCTAGGGTCTGGG - Intergenic
1101324022 12:103698627-103698649 ACTGCTGGTGAGCTGCCTCTTGG - Intronic
1102541028 12:113619322-113619344 GCTGCTGGTGCACAGAGGATGGG - Intergenic
1104120443 12:125793943-125793965 GCAGCTGGTGGGCAGAGTCCTGG - Intergenic
1107058522 13:36131258-36131280 GCTGCTGGAGCGCGGCGCCTCGG + Exonic
1113799162 13:113077637-113077659 GCTCCTGGAGCCCAGGGTCTGGG - Intronic
1118879347 14:69812942-69812964 ACTGCTGATAAGCAGCGTCTGGG - Intergenic
1120096027 14:80388638-80388660 GCGGCTGGTTCTCAGAGTCTGGG + Intergenic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122627642 14:103092384-103092406 GCTGGTGGTGCCCAGGGCCTGGG - Intergenic
1122771591 14:104100145-104100167 GCTGCTGGGGCACAGCTTCCTGG + Intronic
1122906610 14:104804617-104804639 GTTGTTGGTGCACAGTGTCTAGG + Exonic
1129468845 15:75738946-75738968 GCTGCAGGTGCAGAGCGTCCCGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130846832 15:87755419-87755441 GCTGCAGGTGCCTGGCGTCTTGG - Intergenic
1130935633 15:88467962-88467984 TCTGCTTGGCCGCAGCGTCTTGG - Exonic
1133336303 16:5008743-5008765 GCTGCTGGTCCCCAGCCTCAGGG + Intronic
1137030333 16:35518086-35518108 GCTGCTTATAAGCAGCGTCTGGG - Intergenic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1139724648 16:68887298-68887320 GCAGCTAGTGCACAGCCTCTGGG - Intronic
1141904247 16:87013189-87013211 GCAGCTGGAGGGCAGCGTGTGGG - Intergenic
1142009195 16:87705172-87705194 GCTGCTGGCGCGGCGCGGCTGGG - Intronic
1142017056 16:87755088-87755110 GCAGCTGGTGCGGAGGGGCTGGG - Intronic
1142221424 16:88856817-88856839 GTTGCTGGTGCTCAGCGCCGCGG - Exonic
1142297466 16:89235215-89235237 GGTGCTGGTGCCAAGCTTCTGGG - Exonic
1142542753 17:673423-673445 GCTGCTGTTGAGCACCGTCGTGG - Intronic
1142603891 17:1071250-1071272 GGTGCTGATGTGCAGCGTCTGGG - Intronic
1143016849 17:3895363-3895385 GCTTCTGCTGGGCAGCCTCTGGG + Intergenic
1143794316 17:9324424-9324446 GCTCCTGGTGCGCAGTGTGATGG + Intronic
1144245748 17:13362588-13362610 GCTGGTGCTTCGCAGCGGCTTGG + Intergenic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147743106 17:42679747-42679769 ACTGCTGGTGACCAGCGGCTTGG - Exonic
1151354240 17:73549061-73549083 GCTGCTGGTGCCCAGCACCTCGG - Intronic
1152753493 17:82077435-82077457 GCTGCAGGTGGGCAGTGTCCAGG - Intergenic
1152753959 17:82079208-82079230 GCTGCTGGAGGGCAGCGGCCTGG - Exonic
1153336705 18:3932499-3932521 TCTGCTGGTGGGCAGGGCCTAGG - Intronic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1161103183 19:2431504-2431526 GCGGCTGGGGGGCAGCCTCTGGG - Intronic
1161628675 19:5340476-5340498 GCTACCGGGGCGCAGCGGCTGGG + Intronic
1163019785 19:14475805-14475827 GGTGCTGGTGGGCAGGGCCTCGG + Intergenic
1166800897 19:45456256-45456278 GCGGCTTGTGGGCAGCGGCTGGG + Intronic
1167808818 19:51810501-51810523 ACTGCTGATAAGCAGCGTCTGGG + Intronic
1167883039 19:52477986-52478008 ACTGCTGATAAGCAGCGTCTGGG + Intronic
1168105651 19:54164418-54164440 GCTGCAGGTGCGGACGGTCTTGG - Exonic
926253586 2:11170373-11170395 GCTGGTGGTGGTCAGCGTCGAGG + Intronic
927606600 2:24491614-24491636 GCTGCGGGTGCGGAGCCTCCCGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929075180 2:38074830-38074852 GCTGCTGGTGCGCGGCAGCGCGG - Exonic
931153739 2:59604227-59604249 GCTGGTGGAGAGCAGCTTCTAGG - Intergenic
931653397 2:64488808-64488830 GCTGCTGCTGCGATGAGTCTGGG - Intergenic
934763828 2:96869686-96869708 GCGGCTGCTTCGCAGGGTCTCGG - Intronic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
946339377 2:219058221-219058243 GCGGCAGGTGCAGAGCGTCTCGG + Intronic
948596908 2:239085445-239085467 GCTGCAGGAGCTCAGCGTCTAGG - Intronic
948874378 2:240819301-240819323 GCTGCGGGGCCGCAGGGTCTAGG - Intronic
949059922 2:241950935-241950957 GCAGCTGGTCCTCACCGTCTCGG + Intergenic
1168864725 20:1075802-1075824 GCTGGTGGAGCCCAGCCTCTGGG - Intergenic
1168905262 20:1398299-1398321 ACTGCTGATAAGCAGCGTCTGGG - Intergenic
1171474954 20:25401356-25401378 ACTGCTGATAAGCAGCGTCTGGG + Intergenic
1171500134 20:25586568-25586590 GCTTCTGGTGCCAAGCATCTCGG + Intergenic
1172118508 20:32584854-32584876 GCTGCTGCTGCGCGGGGGCTGGG - Intronic
1172705456 20:36879163-36879185 GCTGCTGGTGCTCAGGGACCAGG + Exonic
1176118085 20:63441915-63441937 GCTGCTGGTGCACAGGGGCAGGG - Intronic
1178876921 21:36420809-36420831 CCTGCCTGTGCGCAGCCTCTGGG + Intergenic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
1184529650 22:45046874-45046896 GCTGGTGGTGAGCATCCTCTTGG - Intergenic
950093453 3:10313804-10313826 GCTGCTGCAGTGCAGCGTGTTGG - Intronic
950096811 3:10335426-10335448 ACTGCTGGGGTGCAGCGTCTAGG + Intronic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
951906953 3:27715365-27715387 GCGGCGGGTGCGCAGCGTCTGGG + Intergenic
953793534 3:45966336-45966358 GCTCCTGGTGTGCAGCCTCTTGG + Exonic
953980194 3:47409802-47409824 GCTGCTGGCGGGCAGCCTCGCGG - Exonic
954218871 3:49140129-49140151 GCCCCTGCTGGGCAGCGTCTGGG - Intergenic
954326991 3:49869265-49869287 GCTGCTGGTCCCCAGGGGCTTGG + Intronic
956748559 3:72328855-72328877 GCTCCTGGAGCACAGCATCTAGG + Intergenic
961359893 3:126360476-126360498 GCTGCTGGTGCCCAGGGGCCAGG + Intergenic
961687184 3:128642071-128642093 GCTGCTGGCTTGTAGCGTCTTGG - Intronic
968662316 4:1803855-1803877 GCTGCTGCTCCGCACTGTCTGGG + Intronic
972336456 4:38111066-38111088 GCTGCAGGTGCGCATCATATGGG + Intronic
975737803 4:77398638-77398660 ACTGCTGATGAGCAGTGTCTGGG + Intronic
975983483 4:80183876-80183898 GCTGCTGCCGGGCGGCGTCTGGG - Intronic
985611401 5:891596-891618 GCTCCTCGTGGGCAGCGTCCGGG + Intronic
992104363 5:73437443-73437465 GCGGCTGGTTCGCAGCAGCTCGG + Intergenic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
1001246029 5:170106236-170106258 GCCGCTGCTGCCCAGCGTGTCGG + Exonic
1001984216 5:176060597-176060619 GCTGCGGGCGCGCCACGTCTAGG - Intronic
1002233259 5:177783468-177783490 GCTGCGGGCGCGCCACGTCTAGG + Intronic
1002262719 5:178006313-178006335 GCTGCGGGCGCGCCACGTCTAGG - Intergenic
1003303095 6:4902534-4902556 TCTCCTGGTGAGCAGCATCTTGG - Intronic
1006831793 6:36972593-36972615 GCTGCTGATGCCCAGGGTCTGGG - Intronic
1017158338 6:151341992-151342014 GCTGCTGGCGCAGAGCGTTTTGG - Intronic
1029366407 7:100119313-100119335 GCGCCGGGTGAGCAGCGTCTCGG - Intronic
1033477001 7:141701666-141701688 GGTGCTGGCGCGCGGCCTCTCGG - Intronic
1035157444 7:156925796-156925818 GCAGCATGTGCGCAGCGCCTGGG - Intergenic
1035699319 8:1626356-1626378 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1035699359 8:1626524-1626546 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1035699371 8:1626580-1626602 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1036823955 8:11961817-11961839 GCTGCTTGAGGGCAGAGTCTTGG + Intergenic
1042303216 8:67308179-67308201 GCTGCTGCTCCACAGTGTCTGGG - Intronic
1049172725 8:141171928-141171950 GGTGGTGGTGTGCAGTGTCTGGG + Intronic
1049426553 8:142540494-142540516 GCAGCTGGTGCTGAGCGCCTGGG + Intronic
1049497669 8:142944012-142944034 GCTGCTGGCCCTCAGCATCTGGG - Intergenic
1049655316 8:143794557-143794579 GCTGGTGGGGCGCACCCTCTGGG + Intronic
1049657105 8:143803781-143803803 GCTGCTGGTGCGGAGGGACCCGG - Exonic
1049815496 8:144597281-144597303 GCTGCTGGTGCAGAGTGTCCTGG - Intronic
1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG + Intergenic
1062364318 9:136201793-136201815 GCTCCGGGTGCGGAGCGTCGAGG + Intronic
1062384369 9:136303276-136303298 GCTGCAGGTGCGCAGAGCCTGGG + Exonic
1188451025 X:30308490-30308512 GGTGCTGGTGCGCAACTGCTGGG - Exonic
1191139754 X:57104521-57104543 ACTGCTGATAAGCAGCGTCTGGG - Intergenic
1192494255 X:71604382-71604404 GATGCTGGTGAGCAGGATCTTGG + Exonic
1192968667 X:76207085-76207107 GCTGCTGCTGCCCAGGGTTTGGG + Intergenic
1195376041 X:104229207-104229229 GCTGCTGGAGGGCAGGGACTAGG + Intergenic
1197728645 X:129792812-129792834 GCTGCTGGAGCGCATCGGCCTGG + Exonic
1199978592 X:152908647-152908669 GCTGCTGGGGCCCAGCGGTTTGG + Intergenic