ID: 1121100085

View in Genome Browser
Species Human (GRCh38)
Location 14:91244540-91244562
Sequence GTTTCAGAGTCCCCCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121100085_1121100087 10 Left 1121100085 14:91244540-91244562 CCTCTGAGGGGGGACTCTGAAAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1121100087 14:91244573-91244595 TGACTCTGCCTGCCCCAGCTAGG 0: 1
1: 0
2: 6
3: 37
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121100085 Original CRISPR GTTTCAGAGTCCCCCCTCAG AGG (reversed) Intronic
906110972 1:43321759-43321781 GCTCCAGAGTGCCCTCTCAGAGG + Intronic
912274546 1:108242447-108242469 GATTCAGAGTCAGACCTCAGGGG - Intronic
912286721 1:108377411-108377433 GATTCAGAGTCAGACCTCAGGGG + Intronic
912293673 1:108451894-108451916 GATTCAGAGTCAGACCTCAGGGG + Intronic
912815851 1:112827434-112827456 GTTTTAGATGCCCCCCACAGTGG + Intergenic
914381618 1:147121444-147121466 GATTCAGAGTCAGACCTCAGGGG - Intergenic
914940629 1:152019942-152019964 GATTCAGAGTCAGACCTCAGGGG + Intergenic
915708503 1:157870655-157870677 CTTACAGAGTCACACCTCAGAGG - Intronic
917836514 1:178945806-178945828 GTTTCAGATTCCCCTCTGAGTGG - Intergenic
920515494 1:206581981-206582003 GTGTCAGAGTCATCCCTCACTGG + Intronic
920657146 1:207885688-207885710 GGTTCAGAGTCTTCCCTCAAAGG - Intronic
924083047 1:240419738-240419760 GTTTCAGGGTCCTTCCTCACAGG + Intronic
1066642794 10:37573000-37573022 TTTTCAGAGTCTCCCCTGACAGG - Intergenic
1070462620 10:76684980-76685002 TCTTCAGAGACCCTCCTCAGAGG - Intergenic
1077379322 11:2221523-2221545 GTTTCAGGGTCCTGCCTCATGGG - Intergenic
1077606772 11:3617583-3617605 GTCACAGAATCCCCCCTGAGGGG + Intergenic
1078883933 11:15480993-15481015 GTTTCAGAGGCCCAGCTGAGGGG + Intergenic
1082088214 11:48067376-48067398 CTTTCAAAGTCCCTCCTCGGAGG + Intronic
1090187994 11:124750837-124750859 GCTTCAGAACCCCCCCACAGTGG - Exonic
1090915998 11:131162917-131162939 GCCTCAGAGTCCTGCCTCAGTGG - Intergenic
1091586636 12:1820672-1820694 GTGCCAGAGTCTCCACTCAGCGG - Exonic
1092101784 12:5889548-5889570 GTTTAAGAGTCCCACCTTTGTGG - Intronic
1094870973 12:34599172-34599194 GTGGCAGAGTTCCCCCCCAGGGG + Intergenic
1103844471 12:123891885-123891907 GTCTCAGAGTCCTCTCTCCGGGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106902205 13:34365906-34365928 GTTTTAGTTTCTCCCCTCAGCGG + Intergenic
1108255282 13:48603690-48603712 GTAGCAGAGTCCTTCCTCAGGGG + Intergenic
1118156433 14:63246917-63246939 GCTTCAGAGTCAGCCCTTAGTGG + Intronic
1121100085 14:91244540-91244562 GTTTCAGAGTCCCCCCTCAGAGG - Intronic
1121744902 14:96280391-96280413 ATTTCACAGCCCCCACTCAGAGG - Intergenic
1126088077 15:45027529-45027551 GTTTAAGTGTCCGTCCTCAGGGG - Intronic
1128109276 15:65066742-65066764 GATTCAGAGTCCCCTCTCTGGGG + Intronic
1128533463 15:68471152-68471174 GTTTCAGAGCCCCCCGTCTTGGG + Intergenic
1137753827 16:50886107-50886129 GTTACAAAGTCTCCCCACAGGGG + Intergenic
1141445822 16:84057503-84057525 GTGTCAGCGTCCTCCCTGAGAGG - Intronic
1143473752 17:7191756-7191778 GTTCCAGGGATCCCCCTCAGGGG + Intronic
1144209236 17:13000672-13000694 GTTTCAGAGTCACTCCTCTAGGG - Intronic
1148489468 17:48013917-48013939 GTTTCCAAGTCCTCTCTCAGAGG + Intergenic
1148644388 17:49210876-49210898 GGCTCAGGGTCCCCCCTCCGGGG - Intronic
1153938275 18:9951873-9951895 GTTTCATAGTACCCCCTCGAGGG + Intronic
1156284623 18:35679607-35679629 GCTCCAGAGTCCCTGCTCAGGGG + Intronic
1158534004 18:58291270-58291292 TTTTCACAGCCCCCACTCAGAGG + Intronic
1162138165 19:8568956-8568978 GTTTCAGAGACCCCACACAAGGG - Intronic
1166476864 19:43134076-43134098 ATTTCAGAGTCCACCTTCTGGGG + Intronic
1166568076 19:43777225-43777247 GTTTCAAGGTCCCCCTTCATGGG - Intronic
1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG + Intronic
1168702964 19:58452372-58452394 GTTTTAAAGTCCCAACTCAGAGG - Intronic
932668809 2:73719264-73719286 ACTTCAGAGTGCCCCCTCTGTGG - Intergenic
936873097 2:117156766-117156788 GTTTCAGTGTGCCCCTTCTGGGG - Intergenic
939536418 2:143436524-143436546 GTTCCAGAGTCCATCCTCAATGG - Intronic
941049341 2:160714690-160714712 GTTTCAGGATCTCCCCACAGTGG + Intergenic
948482867 2:238261421-238261443 GTTCCAGAGTGACCTCTCAGTGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172173294 20:32957534-32957556 GTTTCAGGCTCCTCCTTCAGTGG + Intronic
1176248375 20:64108372-64108394 GTCTCAGAGCCGCTCCTCAGCGG + Intergenic
1179092397 21:38278926-38278948 CCTTCATAGTCCCTCCTCAGTGG - Intronic
1179405323 21:41121165-41121187 GCTTCAAGGTCGCCCCTCAGAGG + Intergenic
1181596067 22:23915603-23915625 GCATCAGAGTTCCCTCTCAGAGG + Intergenic
949925308 3:9036612-9036634 GTCTCAGGGTCTTCCCTCAGGGG - Intronic
951336475 3:21428765-21428787 CTTGCAGAGTCTCTCCTCAGAGG - Intronic
952176722 3:30871801-30871823 GTTTCAGAGACTCCCTTCTGAGG - Intronic
956248092 3:67206260-67206282 TTCTCAGTGTCTCCCCTCAGTGG - Intergenic
957666576 3:83238384-83238406 GATTCAGAGTACCCTTTCAGAGG + Intergenic
958805923 3:98809733-98809755 GTTTCCAGGTCCTCCCTCAGTGG - Intronic
965487295 3:169293535-169293557 GTTCCAGTGTCCCTGCTCAGAGG + Intronic
967280011 3:187813192-187813214 GATTCAGAGTCTCCCCTAAGAGG + Intergenic
968541903 4:1172222-1172244 GCTTCCGAGACCCCCATCAGCGG + Intronic
969603071 4:8188571-8188593 GTTTCCCGGTCCCCCCTCTGTGG + Intronic
970012082 4:11470362-11470384 GTGTCAGAGTCTGCCCTCTGGGG - Intergenic
972240695 4:37188695-37188717 CTTTCAGGGTCACCCCTGAGGGG - Intergenic
975881442 4:78912342-78912364 GTTTCACTGTCCCTTCTCAGTGG - Exonic
977504319 4:97882450-97882472 ATTTCCCAGTCCTCCCTCAGAGG - Intronic
977720992 4:100240216-100240238 GCCTCAGAGTCACCCCTCAAGGG + Intergenic
981075311 4:140585475-140585497 GTTTTAGAATCCAGCCTCAGAGG - Intergenic
985938146 5:3112252-3112274 GCTTGAGAGGCGCCCCTCAGGGG + Intergenic
986272166 5:6242855-6242877 GTTTCAGACCCTCCCCTCTGAGG - Intergenic
988503304 5:31800972-31800994 GTGTCAGAGCCTCCCATCAGTGG + Intronic
993512598 5:88790110-88790132 GTGCCAGAGTCCCACCTCACTGG + Intronic
997474047 5:134132588-134132610 TTTTCAGAGTCAACCGTCAGAGG + Intronic
1004853646 6:19726679-19726701 GTTTTAGTGTCCCGCTTCAGTGG + Intergenic
1005038760 6:21582416-21582438 GTTGCAGACTCCCCCCTCCATGG + Intergenic
1005963794 6:30712206-30712228 GTTTCACAGTCCCCATGCAGAGG + Exonic
1006170594 6:32089763-32089785 CTGTCAGAGTCCCCTCTCATGGG + Intronic
1007335054 6:41149903-41149925 GTTACAGAATCCCTCCTCAGTGG - Exonic
1008123261 6:47641657-47641679 GTTTTAGATGCCCCCCACAGTGG + Intergenic
1009770418 6:68137519-68137541 CCTTCACAGTCCTCCCTCAGGGG - Intergenic
1010338212 6:74714586-74714608 GTTTTATTTTCCCCCCTCAGAGG - Intergenic
1017818861 6:158034574-158034596 CTCTCAGAGTCCCCACTCAGAGG + Intronic
1018239139 6:161754936-161754958 GTTTGAGAATCCCCACTCAGGGG + Intronic
1019896991 7:3990322-3990344 GTTGCAGAGGCCCCCCGCAGGGG - Intronic
1020286133 7:6682590-6682612 GATTGAGTGGCCCCCCTCAGTGG - Intergenic
1021600146 7:22356738-22356760 CTTCCAGACGCCCCCCTCAGCGG + Intronic
1024530932 7:50392267-50392289 CCTTCAGAGTCCCCCATAAGGGG - Intronic
1037523510 8:19702842-19702864 GTTTCAGGGTCTCCCCTAAAGGG + Intronic
1038423086 8:27446048-27446070 GTCACAGAGTGCCACCTCAGTGG - Intronic
1044352518 8:91183811-91183833 TTTGCAGAGTCACACCTCAGGGG - Intronic
1047247120 8:123155687-123155709 GCTTCAGGGTCCTTCCTCAGGGG - Intergenic
1055968026 9:81884216-81884238 GTGACAGAGTCCTCCCACAGAGG - Intergenic
1058433966 9:104945211-104945233 ATTTCTGAGTCTCCCCTCATTGG - Intergenic
1058843060 9:108929732-108929754 GCTTGAGACTCCCCCCTCACTGG + Intronic
1060021143 9:120132261-120132283 GTTTCAGAGTCCCTGCCAAGGGG + Intergenic
1062115942 9:134809010-134809032 GGCTCAGAGTCGGCCCTCAGTGG + Intronic
1062245180 9:135562468-135562490 GGCTCAGTCTCCCCCCTCAGGGG + Intronic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1062571072 9:137185639-137185661 GTTTCAGAGTCCCCCTACTGAGG - Intronic
1186711907 X:12206684-12206706 GTTTCAGTGTCTGTCCTCAGTGG + Intronic
1190528159 X:51348498-51348520 GTTTCAGGGTCCTTCCTCAAGGG + Intergenic
1194620223 X:96162033-96162055 GTTTCACAGCCCCCCTTCGGTGG - Intergenic
1196603262 X:117625957-117625979 ATTTCTGGGTCCACCCTCAGTGG - Intergenic
1198456872 X:136825589-136825611 CTTTCAGAGTCACCCTTGAGTGG - Intergenic