ID: 1121100091

View in Genome Browser
Species Human (GRCh38)
Location 14:91244587-91244609
Sequence GTTTGAAGGCAGAGCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121100091_1121100094 -9 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100094 14:91244601-91244623 CCTTCAAACCTCAAACAGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 188
1121100091_1121100096 4 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100096 14:91244614-91244636 AACAGCTGGGCTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 27
4: 284
1121100091_1121100097 13 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100097 14:91244623-91244645 GCTTCCTGCAGAGGCTCTGCAGG 0: 1
1: 0
2: 11
3: 193
4: 654
1121100091_1121100100 21 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100100 14:91244631-91244653 CAGAGGCTCTGCAGGAGCCTGGG 0: 1
1: 0
2: 3
3: 50
4: 445
1121100091_1121100099 20 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100099 14:91244630-91244652 GCAGAGGCTCTGCAGGAGCCTGG 0: 1
1: 1
2: 6
3: 50
4: 480
1121100091_1121100092 -10 Left 1121100091 14:91244587-91244609 CCAGCTAGGCTCTGCCTTCAAAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1121100092 14:91244600-91244622 GCCTTCAAACCTCAAACAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121100091 Original CRISPR GTTTGAAGGCAGAGCCTAGC TGG (reversed) Intronic
901322886 1:8350138-8350160 GTTAGAAGGCGGGGCCTGGCTGG - Intergenic
902007481 1:13243791-13243813 TTTTTAAGGCAGAGTCTTGCTGG - Intergenic
903580247 1:24365344-24365366 GTTGGAAGGCATTGCCTAGGAGG + Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905269680 1:36779336-36779358 GTTGGAAGTTAGAGCCTAGATGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
914193478 1:145431206-145431228 GTTGGAGGGCAGACACTAGCAGG - Intergenic
914474807 1:148014096-148014118 GTTGGAGGGCAGACACTAGCAGG - Intergenic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
916339215 1:163710284-163710306 GTTTGAAGTCTGACCCTGGCAGG + Intergenic
916482145 1:165224014-165224036 TGTTGAAGGCAGGGCCTAGTGGG + Intronic
917688805 1:177446347-177446369 GTTTGACGGCAGATCCTGGCAGG - Intergenic
917964362 1:180169147-180169169 GGTTGGAGCCAGAGCCCAGCTGG + Intronic
919126587 1:193401682-193401704 GTTTCTAGGCACAGCCTACCTGG - Intergenic
920940903 1:210481244-210481266 GTTTGTAACCAGAGGCTAGCAGG - Intronic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
1063044344 10:2376739-2376761 TTTTGATGGCAGTTCCTAGCTGG - Intergenic
1066633143 10:37476523-37476545 GTTGGGAGGTAGAGCCTAGTGGG + Intergenic
1066649066 10:37638704-37638726 GGCTGAAGGCAGAGCCAGGCTGG + Intergenic
1068459093 10:57302893-57302915 GTTTGGAAGCAGAAACTAGCTGG + Intergenic
1069832477 10:71289711-71289733 ATTAGGAGGCAGAGCCAAGCTGG + Intronic
1070128810 10:73642500-73642522 GTTAAAAGGCAGATCCTGGCTGG - Intergenic
1070236175 10:74628855-74628877 TTTAGAAGGCAGAGACTAGGAGG + Intronic
1071913472 10:90263102-90263124 GTTGGGAGGTAGAGCCTAGTGGG + Intergenic
1072336524 10:94402940-94402962 GTTTGGAGCCCGAGCCCAGCAGG - Exonic
1072422160 10:95297965-95297987 AGTTGAAGGCAGAGGCTAGGTGG - Intergenic
1075932842 10:126313954-126313976 GTTTTAAGGCAGAGACGAGAAGG + Intronic
1078891072 11:15559778-15559800 GTTCTAAGGCAGAGCCTACGGGG - Intergenic
1079590440 11:22176842-22176864 GTTGGAAGGTAGGGCCTAGTGGG - Intergenic
1081343040 11:41950964-41950986 GTTTAATGGTAGAGCCAAGCTGG + Intergenic
1084212418 11:67630221-67630243 GTTTGAAGGCGGGGCCTCGGTGG + Intergenic
1089376928 11:118000919-118000941 GTTTGAAGGCAGAGTCCAAATGG - Exonic
1089407090 11:118206725-118206747 GTCAGAAGGAAGAGCCTAGGAGG - Intronic
1089556385 11:119317736-119317758 GTTTGAAGGGACAGCCCAGAAGG - Intronic
1092292317 12:7168873-7168895 GGTTGAAGGCACACCCTAGGGGG + Intergenic
1092464098 12:8712700-8712722 GTTTGAAACCAGAGCATTGCTGG - Intronic
1094161509 12:27395839-27395861 GTTGGGAGGCAGAGTCTAGTGGG - Intronic
1094293413 12:28877206-28877228 GTTTGAAGGCAGAAGCCAGATGG - Intergenic
1094365576 12:29676603-29676625 GTTTGAAGGCAGAGTGTAGATGG - Intronic
1095599155 12:43995239-43995261 TTTTTAAGACAGAGCCTTGCTGG - Intronic
1096244948 12:49979314-49979336 GATTGAAGGCAGTGCTCAGCAGG - Intronic
1099794762 12:87385404-87385426 GTTTGAAGGGAGAGACTTTCAGG + Intergenic
1105379947 13:19877536-19877558 GTTGAAAGACAGAGCCTAGTGGG - Intergenic
1109981407 13:69913185-69913207 GTTTGAAGGGGGAGCATAGGGGG - Intronic
1110937043 13:81304553-81304575 GCTTGAAGGCAGAGTTTCGCTGG - Intergenic
1111317927 13:86585406-86585428 TTTTGGAGGCAGAGCCTGGTGGG + Intergenic
1113063290 13:106348570-106348592 GTTTGAAGTAAGAGCCAAACTGG - Intergenic
1116099665 14:40417375-40417397 ATTTGAAGGCTTCGCCTAGCTGG + Intergenic
1120718842 14:87868836-87868858 TTGTGAAGGAAGGGCCTAGCAGG + Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121155779 14:91682649-91682671 GTTGGCAGGCAGAGTCTAGATGG - Intronic
1121729699 14:96177881-96177903 GCTTGAAGGCAGAGTTTAGGAGG + Intergenic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1131206340 15:90451575-90451597 GTTGGGAGGCAGGGCCTAGTAGG - Intronic
1135041778 16:19122927-19122949 GTTTGAAGCCAGAGCTTCTCAGG + Intronic
1138757529 16:59506363-59506385 ATTAGAAGGCAGAGCCCAGGAGG + Intergenic
1140483959 16:75279404-75279426 GTTGGCAGGAAGAGCCCAGCGGG + Intergenic
1142093653 16:88227925-88227947 GGATGGAGGCAGAGCCTGGCGGG - Intergenic
1142128925 16:88423576-88423598 GGATGCAGGCACAGCCTAGCGGG + Intergenic
1144205595 17:12977476-12977498 ATGTGGAGGCAGAGCCTGGCTGG - Intronic
1144292065 17:13836348-13836370 TGTTGAAGGCAGGGCCTAGTGGG - Intergenic
1147390066 17:40103626-40103648 GTGTGAAGGCAGAGGCTGGGAGG + Intergenic
1149017768 17:51928637-51928659 TTTTGAAGTCTGAGCCAAGCTGG - Intronic
1155999426 18:32368271-32368293 GTTACAAGGGAGAGGCTAGCAGG - Intronic
1158582432 18:58695805-58695827 GTTGGGAGGTAGGGCCTAGCGGG - Intronic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1159116795 18:64123753-64123775 GTTGGAAGGCAGGGCCTGGTAGG + Intergenic
1159576867 18:70189778-70189800 GTATGAAGGCAGAACCCAGTAGG + Intronic
1160044216 18:75371816-75371838 GTATGGAGGCAGAGCCCAGGTGG - Intergenic
1162042527 19:7979336-7979358 GTTTGGAGCCAGAGCCTCACGGG - Intronic
1166154192 19:40898454-40898476 CTTTGAGGACAGAGCCAAGCAGG - Intergenic
1166173912 19:41052126-41052148 CTTTGAGGACAGAGCCAAGCAGG + Intergenic
1167154751 19:47731148-47731170 GTTTGAACTGAGAGCCTAACGGG + Intronic
926580943 2:14632712-14632734 GTGGGAAAGCAGAGCCGAGCCGG + Exonic
928660005 2:33492508-33492530 GTTTGAAGATAGAGCCTATAAGG + Intronic
930852922 2:55980873-55980895 GTTTGAAGGGAGAGCCTCTCAGG - Intergenic
931111983 2:59120783-59120805 TGTTGAAGGTAGAGCCTAGTGGG + Intergenic
931901328 2:66791602-66791624 CTTTGAAGACAGAGGCTAGGTGG + Intergenic
934110400 2:88736833-88736855 GTTTGAATGCAGAAACTAACAGG - Intronic
935815352 2:106842316-106842338 ATGTGAAGGCAGAGCCTGGCAGG + Intronic
936270289 2:111043746-111043768 GTTTGATGGCTGAGCATTGCTGG - Intronic
936924911 2:117726662-117726684 GTCTGACTGCAGAGCCTATCTGG - Intergenic
937097569 2:119245634-119245656 CTTTGAAGCCAGAGCCCACCAGG - Exonic
944414262 2:199467502-199467524 GCCTGAAGTCAGAGCCTACCTGG - Intronic
944597567 2:201275274-201275296 GTTTGGAGAAAGAGTCTAGCAGG + Intronic
947524371 2:230869414-230869436 TGTTCAAGACAGAGCCTAGCTGG - Intronic
1171429800 20:25075387-25075409 GGGTGAAGGGAGAGCCTGGCTGG + Intronic
1174815636 20:53684658-53684680 TTTTGGAGGCAGGGCCTTGCTGG + Intergenic
1176125923 20:63474588-63474610 GTTTGATGTCAGAGCCCAGTGGG + Intergenic
1176936452 21:14873485-14873507 GTTTGAAGGCAAAACCTAGGAGG + Intergenic
1179801059 21:43811641-43811663 GAGTGAAGGCAGAGCCTGGGAGG + Intergenic
1180019285 21:45111111-45111133 GGTGGAAGGCACAGCCTGGCGGG - Intronic
1180063955 21:45403911-45403933 GTTTGAAGGCAGATGCTGGTCGG + Intergenic
1180594596 22:16964931-16964953 GCTTGAAGTCAGGGCCCAGCTGG - Intronic
1182946480 22:34327612-34327634 GTTAGGAGGCAGGGCCTAGTGGG + Intergenic
1184905645 22:47484051-47484073 GTTTGAAGGCAGGGTTTCGCAGG + Intronic
949874960 3:8620513-8620535 GATTGAAGGCAGATTGTAGCAGG - Intronic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
950607192 3:14092508-14092530 TTATGAAGTCAGAGCCTAGGTGG + Intergenic
953751099 3:45609156-45609178 TTTTGAAGGGAGAGCTTATCTGG + Intronic
957011592 3:75012000-75012022 TGTTGAAGGCAGAGCCTGGTGGG + Intergenic
957527005 3:81390700-81390722 GTTGGAAGGTGGGGCCTAGCAGG - Intergenic
957855123 3:85865122-85865144 GTTTGAAGCCACAGCCCAGGTGG + Intronic
959814329 3:110657913-110657935 TTTGGAAGACAGAGCCTGGCTGG - Intergenic
960105718 3:113794399-113794421 ATTTGATGCCATAGCCTAGCTGG - Intronic
961649679 3:128411122-128411144 CTTTGAAGGTGCAGCCTAGCCGG + Intergenic
961987857 3:131157135-131157157 GTTTAAAGACAGAGTCCAGCAGG + Intronic
964778972 3:160314344-160314366 GTTAGAAGGAAGTGCCTAGGAGG - Intronic
966096648 3:176212940-176212962 GTGTGGAAGCAGACCCTAGCGGG + Intergenic
968524812 4:1050862-1050884 GCGTGAAGGCAGTGCCCAGCAGG - Intergenic
969152872 4:5185494-5185516 ATTTGAAGGCAGAGCCGATCTGG + Intronic
976379854 4:84386946-84386968 GTTTGAAGACAGACCCGTGCTGG - Intergenic
976530977 4:86151476-86151498 GCTGGAAGGCTGAGCCCAGCTGG - Intronic
980920730 4:139083635-139083657 GTCTGAAGGGAGAACCGAGCGGG + Intronic
981077978 4:140609551-140609573 GTTTGAAGGGTGATCCTAGAAGG + Intergenic
984942257 4:184943212-184943234 TGTTGGAGGTAGAGCCTAGCGGG - Intergenic
984948149 4:184986053-184986075 ATTAGAAGGCAGAGGCAAGCAGG - Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985810371 5:2079038-2079060 GTGTCAAGGAAGAGCCTAGTGGG + Intergenic
985828010 5:2206987-2207009 GTTTAAAGGTCGGGCCTAGCCGG + Intergenic
986158254 5:5198492-5198514 CTTTGATGTCACAGCCTAGCTGG - Intronic
986588829 5:9347488-9347510 GTTTGAAGGAAGACCCAATCAGG - Intronic
987082106 5:14435171-14435193 GTTTGAAGGCTGAGTACAGCAGG + Intronic
987731766 5:21782147-21782169 GTTGGAAGGCAGAGCTGAGCTGG + Intronic
995219555 5:109632754-109632776 GTTTGAAGGCAGTGTCTTCCAGG + Intergenic
997253093 5:132406499-132406521 GTTTGAAGGCAGAGCTCTTCAGG - Intergenic
1003241084 6:4346480-4346502 GTTTGAAGGGAGAGGCTTTCTGG - Intergenic
1003803559 6:9699888-9699910 GTTTGGAGGTAGAGCCTAATGGG + Intronic
1009649212 6:66451637-66451659 TATTGGAGGCAGAGCCTAGTGGG + Intergenic
1010027441 6:71236206-71236228 GTTTGAAAACAGAGGCTAGGTGG - Intergenic
1010616567 6:78020289-78020311 TTTTGAAGTCAGAGGCTGGCAGG + Intergenic
1012411974 6:98969136-98969158 GTTGGGAGGTAGAGCCTAGTGGG - Intergenic
1013518564 6:110912029-110912051 TTTTTAAGGCAGAGCCAACCAGG + Intergenic
1015284215 6:131466553-131466575 GTTGGAAGGCTGAGCCTAGCAGG + Intergenic
1016827221 6:148399754-148399776 CTTTGATGGCGGAACCTAGCAGG + Intronic
1017202747 6:151773548-151773570 GTTTGAAGGCAGCTGCTGGCAGG + Intronic
1018923264 6:168190160-168190182 GTGTGGGGGCAGAGCCTCGCCGG - Intergenic
1019950760 7:4370437-4370459 GTTGGAAGGCAGAGCTGAGGGGG + Intergenic
1020555330 7:9663655-9663677 GTTTGAAGGGTGAGCAAAGCAGG + Intergenic
1021519450 7:21524674-21524696 CTTTGAAGGCAGACACTATCAGG - Intergenic
1023865664 7:44237087-44237109 GTTCCAATGCAGAGCCTGGCTGG - Intronic
1024472062 7:49775004-49775026 GGTTCAAGGCAGAGCTTTGCAGG + Intronic
1024512165 7:50212864-50212886 GGCTTAAGGCAGAGCCCAGCCGG + Intergenic
1026650967 7:72215739-72215761 TTTTGCAGGGAGATCCTAGCTGG - Intronic
1030703719 7:112669113-112669135 GTTACAAGGCAGAGCCTAATAGG - Intergenic
1032511488 7:132475973-132475995 GATGCAAGGCAGAGCCCAGCGGG + Intronic
1032735337 7:134687579-134687601 GTGCAAAGGCAGAGCCTAGGAGG - Intergenic
1032755268 7:134884368-134884390 GTGTGAAGTCAGAGCAAAGCGGG - Intronic
1032770945 7:135055180-135055202 GTTGGGAGGTAGGGCCTAGCGGG - Intronic
1033189644 7:139265716-139265738 ATGTGAAGGGAGAGCCTAGAGGG + Intronic
1035293822 7:157856479-157856501 GGTTGAAGGCTGAGCCTCGGAGG - Intronic
1035627951 8:1088030-1088052 GTGTGAAGGCAGAGCCAGACGGG - Intergenic
1036434734 8:8723148-8723170 GTTAGAAGGAAGAGCCCAGGTGG + Intergenic
1036467431 8:9013845-9013867 TTTTGAAGGCAGAGCCAAACAGG - Intronic
1038235240 8:25746569-25746591 GTGTGAAGGCAGAGCTGAGTGGG - Intergenic
1038623665 8:29169341-29169363 ACTTGAAGGCAGAGTCTAACTGG - Intronic
1038832068 8:31072861-31072883 ATCTGAAGGAAGAGCTTAGCAGG + Intronic
1042752971 8:72178547-72178569 GTTTTAAGGAAGAGCCTAGATGG + Intergenic
1043888449 8:85630089-85630111 GCCTGAAGGTAGAGCCCAGCTGG + Intergenic
1044860160 8:96515143-96515165 GTTTGACTGCAGAGACTAGCTGG - Intronic
1045649764 8:104330520-104330542 ATTTGAAGGCAGTCACTAGCTGG - Intronic
1047764059 8:127976007-127976029 GTAGGAAGGCTGAGGCTAGCAGG + Intergenic
1049173129 8:141174409-141174431 GGGTGGAGGCAGAGCCGAGCAGG + Intronic
1050042625 9:1512032-1512054 GTTTGAAGCTAGAGCTAAGCGGG + Intergenic
1051411864 9:16797994-16798016 GATGGATTGCAGAGCCTAGCTGG - Intronic
1054910011 9:70446000-70446022 GTTGGGAGGTAGGGCCTAGCGGG + Intergenic
1060019429 9:120116279-120116301 TTTTGAAGGTAGATCCTGGCGGG + Intergenic
1062167966 9:135117812-135117834 GTTTGAAGAAAGAATCTAGCAGG - Intronic
1185572855 X:1147693-1147715 GGATGAAGGCAGAGACTCGCAGG - Intergenic
1186827044 X:13350693-13350715 TTTTCAAGCCAGAGCCCAGCTGG + Intergenic
1188204954 X:27344564-27344586 GTTTGGAGGCGGAGCCTGGTGGG + Intergenic
1190227704 X:48559057-48559079 GTTGGAGGGCAGAGCCTTCCTGG + Intronic
1190417665 X:50197052-50197074 ATTTGAAGTCATAGCCTAGGGGG - Intronic
1196003665 X:110812762-110812784 GTTGGGAGGTAGGGCCTAGCGGG + Intergenic
1197038164 X:121903446-121903468 GCTTGAAGGCAGAGTTTTGCTGG - Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic