ID: 1121100842

View in Genome Browser
Species Human (GRCh38)
Location 14:91249083-91249105
Sequence CTGAGGTTCTAAATGACAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121100837_1121100842 10 Left 1121100837 14:91249050-91249072 CCTCACACATGCTTCACACAGAA 0: 1
1: 1
2: 1
3: 27
4: 338
Right 1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG 0: 1
1: 0
2: 3
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121100842 Original CRISPR CTGAGGTTCTAAATGACAAA CGG Intronic
905328478 1:37175309-37175331 CTGAGGATCAAAAAGAAAAAGGG - Intergenic
905675843 1:39824504-39824526 CTGTCATTTTAAATGACAAAAGG + Intergenic
905978568 1:42200803-42200825 ATGAGAATCTAAATGACCAACGG - Intronic
906235018 1:44201221-44201243 ATGAGATTCTAAATAAAAAAAGG - Intergenic
907983594 1:59508730-59508752 CTGTGGTTCCAAATGAAAGATGG + Intronic
908951111 1:69564415-69564437 CTGAGGTTCTGAATAGAAAATGG - Intergenic
910048122 1:82942428-82942450 CAGAGGTTCAACATAACAAATGG + Intergenic
910305962 1:85764131-85764153 CTCAGTTTATAAATGAGAAAAGG - Intronic
910843560 1:91584603-91584625 CTGATGTGCTATATGACATAAGG + Intergenic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
912689206 1:111791605-111791627 CACAGGATCTAAATGAAAAAAGG - Intronic
913704009 1:121399946-121399968 TTGAGGTTCTAAATGAAATTGGG + Intergenic
913942660 1:125122442-125122464 TTGAGGTTCTAAATGAAATTGGG + Intergenic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
915825085 1:159067368-159067390 CTTTGGTTCTAAATGGCAAGTGG - Intronic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916256746 1:162795976-162795998 CTGAGATTATAAAAGATAAATGG - Intronic
917075548 1:171200742-171200764 CTGAGGTGATAAGTGACAAGAGG - Intronic
917468621 1:175306995-175307017 CTGAGCTTCAAAGTGACAAAAGG + Intergenic
919675012 1:200372995-200373017 CTGAGCTTCTAACTGCCACAGGG + Intergenic
920899614 1:210094404-210094426 CTGAGGGTGTACATGACAGATGG - Exonic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922077304 1:222258983-222259005 CCGAGGTTAGGAATGACAAAAGG + Intergenic
923174470 1:231450560-231450582 CTGAGGGTTTTAATCACAAAGGG - Intergenic
923619892 1:235569963-235569985 CTGAGGGTCTTAATCTCAAAAGG - Intronic
923626264 1:235616310-235616332 CCCAGGTTCTGAATGACAAAGGG - Intronic
924166336 1:241287172-241287194 CTGAGGGTGTAATTGACAAGTGG + Intronic
1062768318 10:81694-81716 CCGAGGGTCTAAATAACAACTGG + Intergenic
1064221344 10:13443034-13443056 CTGAGGTTTTGAATGAAAACAGG + Intronic
1064827745 10:19424867-19424889 CTGAGTCTCTAGCTGACAAAAGG + Intronic
1064972357 10:21079022-21079044 CTCCAGATCTAAATGACAAATGG + Intronic
1066249223 10:33616613-33616635 CTGACGTTCTGAAAGACCAATGG + Intergenic
1066701887 10:38138589-38138611 GTGAGGTCTAAAATGACAAATGG + Intergenic
1066982834 10:42435284-42435306 CTGAGGGTTTTAATCACAAAAGG + Intergenic
1069136724 10:64776464-64776486 CTTAGGTTCAAAAGGAAAAAAGG + Intergenic
1070975349 10:80602091-80602113 CTGTGCTTCTAAATCTCAAATGG - Intronic
1075324559 10:121520468-121520490 CTGACAATCTAAGTGACAAATGG + Intronic
1076124256 10:127962073-127962095 CTTAAGCTCTAAATAACAAAGGG + Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1078113136 11:8416681-8416703 CTGAGATTCTACATGTCTAAAGG + Intronic
1078948615 11:16101830-16101852 CTGAGGGTTTTAATCACAAAGGG - Intronic
1080041513 11:27764134-27764156 CTTAGATTCTAAATGAAAAATGG - Intergenic
1080678067 11:34446347-34446369 CTGAGTTTTTAAGTTACAAATGG - Intronic
1080798656 11:35589270-35589292 CCCAGGTCCAAAATGACAAAAGG - Intergenic
1087395589 11:97592962-97592984 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1088289860 11:108224158-108224180 CTCAGTTTCTCAATGATAAAAGG - Intronic
1088973937 11:114798203-114798225 CTGAGATTTTTAATGATAAATGG + Intergenic
1092663992 12:10773760-10773782 CTGAGATGATACATGACAAATGG + Intergenic
1093006805 12:14059987-14060009 CTGAGTTTCTCAAGGAGAAATGG + Intergenic
1093690944 12:22107971-22107993 CTGAGTGTCTTAATCACAAAGGG - Intronic
1094111625 12:26868771-26868793 ATCAGGTTCTATATGTCAAAAGG + Intergenic
1095121145 12:38421087-38421109 CTGAGGTTTTTAATCACAAAGGG - Intergenic
1096199995 12:49674607-49674629 CTTAGGTACCACATGACAAAAGG + Intronic
1097236087 12:57540590-57540612 CTGAGGTTCTAAATCAGACAGGG + Intronic
1097698226 12:62795353-62795375 TTGATATTCTAAATAACAAAAGG - Intronic
1100181101 12:92087603-92087625 ATGGGGTTCTAAATAAGAAATGG - Intronic
1100694518 12:97077485-97077507 CTGGGATTCTATATAACAAAAGG + Intergenic
1102797303 12:115699984-115700006 CTGAGGCTCAGAAGGACAAAGGG + Intergenic
1103166309 12:118773377-118773399 CTGAGGCCCTAAATGAGAATGGG - Intergenic
1103893100 12:124254559-124254581 CTGAGGTTGTAAAGGAGCAATGG - Intronic
1106508160 13:30389834-30389856 GAAAGGTTCTAAAGGACAAAGGG - Intergenic
1107029449 13:35835491-35835513 CTGAGGTTCTAGATACCTAATGG - Intronic
1108189331 13:47921455-47921477 CTGAGGGTTTAAATGTTAAAGGG - Intergenic
1108519362 13:51232617-51232639 CTAAGGTTCTTAATAACTAAGGG - Intronic
1109945662 13:69428240-69428262 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1109993713 13:70093823-70093845 CTGCAGTTCTAATTGCCAAATGG - Intronic
1110125280 13:71934380-71934402 CTGAGGTGCAACTTGACAAAGGG + Intergenic
1112804602 13:103149957-103149979 CTGAGGTGCAAAGTGAGAAATGG - Intergenic
1114975560 14:28092663-28092685 CAAAGCTACTAAATGACAAAAGG + Intergenic
1116406372 14:44571616-44571638 CTGAGGGTTTTAATGATAAAGGG - Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG + Intronic
1121832866 14:97066802-97066824 CTGGGTTTCTGAATGACACAGGG - Intergenic
1202939466 14_KI270725v1_random:133730-133752 TTGAGGTTCTAAATGAAATTGGG - Intergenic
1125897720 15:43316545-43316567 CAGAAGTTCTGAATGACAGATGG + Intergenic
1125932782 15:43612152-43612174 ATTAGGTTCAAAATGGCAAAGGG + Intronic
1125945881 15:43711614-43711636 ATTAGGTTCAAAATGGCAAAGGG + Intergenic
1126027183 15:44458120-44458142 CTGAGGCTCAAAATGAAAAAAGG - Intronic
1128458593 15:67848673-67848695 GTTAGGTTCTATATGTCAAAAGG + Intergenic
1129009640 15:72403577-72403599 CTTAGGATCTAAATCACAAAAGG - Intronic
1129504606 15:76071059-76071081 TTGACGTTCTATATGATAAAGGG + Intronic
1129720928 15:77877566-77877588 CTGAGGCTCTCAGTGAAAAAGGG - Intergenic
1130728952 15:86469900-86469922 CTGATTTTTTAAATGGCAAAAGG - Intronic
1131924852 15:97371419-97371441 CTCAGGTTCAAAAAGAAAAAAGG + Intergenic
1136699678 16:32119558-32119580 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1136767983 16:32808363-32808385 TTGAGGTTCTAAATGAAATTGGG - Intergenic
1136800171 16:33062734-33062756 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1136902571 16:34053997-34054019 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1136958067 16:34806745-34806767 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1138715562 16:59018027-59018049 ATGAAGTACTAAATGCCAAAGGG + Intergenic
1140281842 16:73562253-73562275 CTGAAGTTCTGAATTGCAAAGGG + Intergenic
1140729875 16:77846133-77846155 ATGAGGTTCTTAATTACACAGGG + Intronic
1203070374 16_KI270728v1_random:1070383-1070405 TTGAGGTTCTAAATGAAATTGGG - Intergenic
1143801800 17:9389175-9389197 CTGAGGTCATAACTGACAAGTGG - Intronic
1147898411 17:43767556-43767578 CTGAGGTTCAGAATGATTAAGGG - Exonic
1150870638 17:68906540-68906562 TTTATGTTCTAACTGACAAAAGG + Intronic
1151401996 17:73861875-73861897 CCAAGGTTCCAATTGACAAATGG - Intergenic
1154044498 18:10891805-10891827 CTGAGTTTTTAACTGTCAAAAGG + Intronic
1154517890 18:15194890-15194912 TTGAGGTTCTAAATGAAATTGGG - Intergenic
1156273091 18:35555264-35555286 CTAAGGTCCAAAATGCCAAATGG - Intergenic
1156939382 18:42746853-42746875 CTGAGGGTTTTAATCACAAAGGG - Intronic
1157512365 18:48286014-48286036 CTGAGGTTCTAAATCCCTCAAGG - Intronic
1158837059 18:61342006-61342028 CTGAGATGCTAACTGCCAAATGG - Intronic
1161921020 19:7265995-7266017 CTGAGGTACTAAAAGACAAATGG + Intronic
1165553227 19:36605929-36605951 CTGAGGTTGTGAATGACAAGTGG + Intronic
1167517441 19:49931274-49931296 CTGAGCTACAAAATGACAAAGGG + Intronic
927374037 2:22392607-22392629 CTCAGGTTATAGAGGACAAAAGG - Intergenic
928473262 2:31596005-31596027 CTGAGGGTTTTAATGATAAAGGG - Intergenic
928926774 2:36587867-36587889 CTGAGTTTCTGAAAAACAAATGG - Intronic
929489656 2:42384976-42384998 CTGAGGTTTTAAATGACAACTGG - Intronic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
930159710 2:48142326-48142348 CTGAGGGTTTTAATCACAAAGGG + Intergenic
930608216 2:53514240-53514262 CGGAGCTTCTAACTGACACAAGG - Intergenic
931036491 2:58250000-58250022 CTGGGCTTCTAAATGAAAACCGG + Intergenic
931233945 2:60397919-60397941 CTGAGGTGCAAAATGAGAGACGG + Intergenic
931419585 2:62114099-62114121 TTGAAGTTCTAATTGACAGAAGG + Intronic
931959435 2:67465905-67465927 TTGAGCTTGTAAATGACAAAGGG + Intergenic
935043921 2:99462254-99462276 GTGAGGTTTAAAATGAAAAACGG - Intronic
935071847 2:99701221-99701243 CTTAGGCTACAAATGACAAATGG + Intronic
935708023 2:105873105-105873127 CTGAGCCTCCATATGACAAAAGG + Intronic
938809446 2:134839394-134839416 CAAAAGTTCTTAATGACAAAAGG - Intronic
938853704 2:135288123-135288145 CTGAGGGTTTTAATCACAAAAGG + Intronic
939204318 2:139080576-139080598 CTGAGGGTTTAAATGAGAAAGGG - Intergenic
939520753 2:143226917-143226939 CTTAGTTTCTAAAAGACAAGTGG + Intronic
940837636 2:158542111-158542133 CTAAGGTTATGAATGAAAAACGG - Intronic
940973325 2:159917767-159917789 CTAAACTTGTAAATGACAAAAGG + Intergenic
941403816 2:165063914-165063936 CTAAGATTTTAAATGTCAAAAGG + Intergenic
943167761 2:184352136-184352158 CTGAGGGTTTTAATCACAAAGGG - Intergenic
943539322 2:189192302-189192324 TTCAGGTTCTTAATGACACAAGG - Intergenic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
944088781 2:195880869-195880891 ATGAAGGTATAAATGACAAAAGG + Intronic
944287826 2:197972054-197972076 TTGATTTTCTAAATGACACAGGG + Intronic
944997167 2:205306634-205306656 CCGAGGTGCTAAATGTCTAAAGG - Intronic
945052145 2:205834287-205834309 TTGAGGTTCTAAATGACACAGGG - Intergenic
945266461 2:207895969-207895991 CTTCAGTTCTAACTGACAAATGG - Intronic
945777226 2:214120879-214120901 CTGAGTTGCAAAATGACTAATGG - Intronic
946366522 2:219252487-219252509 CTGTGGCTCCACATGACAAAAGG + Intronic
946483530 2:220078952-220078974 CTGATGTTCTCACTGACAATAGG + Intergenic
947168866 2:227290742-227290764 TTCAGGTTCTAAAGGAAAAAGGG + Exonic
948764707 2:240213460-240213482 CTGAGGTTTTACAGGACAAAAGG + Intergenic
1169537724 20:6563878-6563900 CTGAGGTTCTAATTAGCACATGG + Intergenic
1170549365 20:17463270-17463292 ATGAGGATCTAAATGACCAGAGG - Intronic
1170651148 20:18243198-18243220 CTGAGGGTTTTAATGATAAAGGG - Intergenic
1171721328 20:28566121-28566143 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1171953310 20:31440539-31440561 CTGCTGACCTAAATGACAAAGGG + Exonic
1173050113 20:39551115-39551137 CTGAGATTCTAAGTGAGAAAGGG + Intergenic
1174790116 20:53470037-53470059 CTGAGTTTCCAAATGGCAAGAGG - Intronic
1176583726 21:8553359-8553381 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1176588900 21:8620891-8620913 CTGAGTTACTAAAGCACAAATGG - Intergenic
1176915359 21:14619433-14619455 TTGAGGCTCAAAATGATAAATGG + Intronic
1177225037 21:18243350-18243372 CTGGGATTCTGAATGAAAAATGG - Intronic
1177714700 21:24823943-24823965 CAGAGGTCCTAAATGACACATGG - Intergenic
1178950864 21:36984444-36984466 CAGAGCTACTAAGTGACAAATGG + Intronic
1180266536 22:10530292-10530314 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1180271726 22:10597887-10597909 CTGAGTTACTAAAGCACAAATGG - Intergenic
1180294870 22:10924778-10924800 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1181458532 22:23072794-23072816 CTGAGATTCTAGAAAACAAAAGG - Intronic
1182617224 22:31595446-31595468 GTCAGGTTCAAAATGATAAATGG + Intronic
1183413052 22:37666505-37666527 CTGAGGATCTAAAAGACCACTGG - Exonic
1184514244 22:44951883-44951905 TTGAGGTAATAAAGGACAAAAGG - Intronic
949138421 3:600879-600901 CTGAGTTACTAAAGCACAAACGG + Intergenic
949768962 3:7557334-7557356 CTGATTTTCTAAATGGCACATGG + Intronic
950330869 3:12155138-12155160 CTGAGGTTCTAAAAGAGGCATGG - Intronic
951153417 3:19320349-19320371 CTGAGGGTCTTAATCATAAAGGG + Intronic
951294848 3:20921370-20921392 CTGAGGATTTAAATCATAAAGGG - Intergenic
952285047 3:31960310-31960332 CTGAGGGTCTGAGTGACAAGCGG - Intronic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
954972176 3:54660602-54660624 CTGAGGCTCCCAATGCCAAATGG + Intronic
955897791 3:63719079-63719101 CTGAGGTGCTAAAAGACATAAGG - Intergenic
956333780 3:68141106-68141128 CTGAGGTTATTAATGCCAGAAGG - Intronic
956913084 3:73841616-73841638 ATGAGCTTCCAATTGACAAAAGG - Intergenic
960310687 3:116112845-116112867 CTGAGATTCAAAATGTAAAAAGG - Intronic
960559016 3:119061930-119061952 TTGACCTTCTAAATGATAAAAGG + Intronic
961215826 3:125159782-125159804 CTGGGGTTCTAGATGACCAGAGG - Intronic
962176957 3:133165318-133165340 CTGAGGGACTAAATACCAAAGGG + Intronic
962280794 3:134050249-134050271 ATGAGTTTCTAAAAGACAGAAGG - Intronic
962765044 3:138554224-138554246 CTGAGGGTTCTAATGACAAAAGG - Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966282106 3:178243620-178243642 TTGAGGTTCTGAAGGCCAAAAGG - Intergenic
967425204 3:189319029-189319051 CTGAGGATCTAAATGTTACAGGG - Intronic
967491644 3:190098341-190098363 TTTAGGTTCCAAATGACAATAGG + Intronic
967654256 3:192027444-192027466 CTGGGGTGCTAAATGACCTAAGG + Intergenic
969850578 4:9953462-9953484 TTGAGGTCCAAAATGACCAAGGG - Intronic
971661548 4:29423006-29423028 CTGAGTTTCATATTGACAAACGG - Intergenic
971724704 4:30295696-30295718 CTGAATTTCAAAATGAGAAAGGG + Intergenic
971973648 4:33654304-33654326 CTGAGTTTTTAATTAACAAATGG + Intergenic
974559688 4:63501115-63501137 AAGAGGTTCTAAATCTCAAAGGG + Intergenic
975084916 4:70327056-70327078 CTTAGGTTCTGAATTTCAAATGG - Intergenic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976530687 4:86149141-86149163 ATGAGATTCTAAATGAGAGAAGG - Intronic
977829026 4:101568442-101568464 CTGAGGGTCTTAATCATAAAGGG - Intronic
983962759 4:173774461-173774483 CTGAGGGTTTTAATCACAAAGGG + Intergenic
987832785 5:23118537-23118559 ATGAAGTTCAAAATGTCAAATGG + Intergenic
988423977 5:31040943-31040965 CTGAGGGTTTTAATCACAAAAGG - Intergenic
990349454 5:54901101-54901123 CTGACATTCTGAATGACACAGGG + Intergenic
990397062 5:55392848-55392870 CTGAGGTTGTGAATGACAGCTGG - Intronic
993811913 5:92490644-92490666 CTCAGTTTCTAGATGACAACTGG + Intergenic
994054193 5:95397449-95397471 CTGACTCTCTACATGACAAATGG + Intronic
994443555 5:99842281-99842303 CTGAGCCTCTAAAAGAAAAATGG - Intergenic
995161454 5:108987984-108988006 CTGAGGGTGTTAATCACAAACGG + Intronic
995472688 5:112519795-112519817 CTGAGGGTTTTAATGATAAAGGG + Intergenic
996025532 5:118641379-118641401 CTGAGGTTTTTAATAATAAAGGG - Intergenic
996422638 5:123279049-123279071 CTGAGATTCCAAATGGCCAAGGG + Intergenic
997876570 5:137553812-137553834 CTGAGGGTCTTAATCATAAAGGG - Intronic
998529840 5:142874382-142874404 CTGATGTTCTACATGGCAACAGG - Intronic
999306767 5:150524634-150524656 CTGAGGTTCAAAAAGTTAAATGG + Intronic
1001519389 5:172380003-172380025 CTGAGGTTCAGAATAATAAAAGG - Intronic
1004473191 6:15947281-15947303 CAGAGGTTCTCAGTGACAGAAGG + Intergenic
1004643588 6:17538945-17538967 CTCAGGATCTAAATGACACTGGG - Intronic
1008900232 6:56605570-56605592 CAGAGGCTATCAATGACAAATGG + Intronic
1012190698 6:96276574-96276596 CTGGGGTTCTAAATAAGGAAAGG + Intergenic
1014477483 6:121891176-121891198 CTGAGGATATAAATGAAAAGAGG - Intergenic
1015615235 6:135067527-135067549 CTGAGATTCCAGATGACAACCGG + Intronic
1015900161 6:138056892-138056914 CTGAGGGTCTTAATCATAAAGGG - Intergenic
1016044813 6:139470253-139470275 CAGAGGTTCTCAATGACAGCCGG + Intergenic
1018520513 6:164644843-164644865 CTGATGTTCTAACTGACACTTGG - Intergenic
1019021627 6:168923460-168923482 CTCAGGGTCTAAATGACTCAGGG + Intergenic
1020271931 7:6601961-6601983 CTCAGTTTCTAAATGACACTAGG + Intronic
1022978611 7:35581206-35581228 CTGGAGTTCTAAATTAGAAAGGG - Intergenic
1023008617 7:35904239-35904261 CCAAGGTTCTAAAGGATAAAAGG - Exonic
1023016547 7:35973610-35973632 CCAAGGTTCTAAATGATGAAAGG - Intergenic
1023792465 7:43763821-43763843 CTGAGTTTGTAAAAGAGAAACGG - Intronic
1025015574 7:55436382-55436404 GGGAGGATTTAAATGACAAATGG + Intronic
1025482283 7:60995546-60995568 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1026823352 7:73564781-73564803 CCTAGGTTCTAGATCACAAAAGG + Intergenic
1027050296 7:75017541-75017563 CTGAGGTTCCAGATGACCCAAGG - Intronic
1027693361 7:81375846-81375868 CTGAGGGTTTAAATCATAAAAGG + Intergenic
1028261982 7:88677763-88677785 CTGAGGGTTTTAATCACAAAGGG - Intergenic
1030069397 7:105685929-105685951 CTGAGATTCTAAAGGCCAACAGG - Intronic
1031276056 7:119724765-119724787 CTGCGGTTCTAAATGGGAACTGG - Intergenic
1038106438 8:24440316-24440338 CAGAGGGTCTAAATATCAAAAGG + Intergenic
1038761757 8:30391035-30391057 TGGAGGTTCCTAATGACAAAGGG - Intronic
1038761770 8:30391121-30391143 TGGAGGTTCCTAATGACAAAGGG - Intronic
1038909061 8:31941348-31941370 CTGAGGTTTTTAGTCACAAAGGG - Intronic
1044241978 8:89899303-89899325 CTGAGTTTAAAAAGGACAAAAGG + Intergenic
1045409584 8:101903823-101903845 CTCAGCTTCTAAAAGACAGAAGG + Intronic
1045502731 8:102755807-102755829 CTGAGTTTCTGCAAGACAAAGGG + Intergenic
1045574152 8:103400602-103400624 CGGAAGTTCTAACTGACACAAGG + Intronic
1046236427 8:111429244-111429266 CTAAGGTTTTAAAGGACACATGG + Intergenic
1047525279 8:125627632-125627654 CTGAGGCTCTTATTGTCAAAAGG + Intergenic
1050749311 9:8918458-8918480 CTGATGTTCTAAAAGTGAAAGGG - Intronic
1050895284 9:10879094-10879116 CTCAGGTTCTAGCTGACACAGGG - Intergenic
1052162124 9:25275870-25275892 CTGATGTTCAGAATGTCAAATGG - Intergenic
1057004155 9:91541736-91541758 CTGAGGGTCTTAATCACAAAGGG - Intergenic
1057691513 9:97290831-97290853 CTGAGGTTTAAAAGGAAAAAAGG - Intergenic
1059253020 9:112904293-112904315 CTGATCTTCTACATGACAGAGGG - Intergenic
1059263142 9:112998703-112998725 ATGAGCTACTAAATGACAAATGG - Intergenic
1059440326 9:114302959-114302981 CAGAGGTTCTGAATGACGCATGG - Intronic
1059506800 9:114806538-114806560 ATGAGGTTCAAAATGACAGAGGG - Intergenic
1059965705 9:119611400-119611422 ATAATGTTCTAAATGTCAAAAGG - Intergenic
1062662849 9:137648132-137648154 TTGAGTTTCAAAAGGACAAATGG - Intronic
1203613682 Un_KI270749v1:31127-31149 TTGAGGTTCTAAATGAAATTGGG + Intergenic
1203618907 Un_KI270749v1:99470-99492 CTGAGTTACTAAAGCACAAATGG - Intergenic
1186749039 X:12602538-12602560 CTGAAGTTCCACATGTCAAAAGG - Intronic
1188716667 X:33466873-33466895 CTGAGTTTCCAGCTGACAAATGG + Intergenic
1192005704 X:67209809-67209831 GTGAATTTCTAAATGTCAAATGG + Intergenic
1192921252 X:75708738-75708760 CTGAGGGTTTTAATGATAAAGGG + Intergenic
1193396285 X:80987773-80987795 TTAAGGTACTAAATAACAAAGGG - Intergenic
1193463389 X:81817463-81817485 CTTAGTTTCTCCATGACAAATGG + Intergenic
1193636107 X:83950752-83950774 CTGAGGTTTTTAATCATAAAGGG - Intergenic
1193937445 X:87640640-87640662 CTGAGGGTTTTAATGATAAAGGG - Intronic
1196135413 X:112204040-112204062 TTTAGTTTCTAAATGCCAAAAGG + Intergenic
1196687938 X:118528384-118528406 ATGTGGTTCAAAATGACAAGGGG + Intronic
1197591340 X:128414579-128414601 CTGAGGTTGTTAATCATAAAGGG + Intergenic
1197611806 X:128647760-128647782 CTGAGGTTTTCAATCATAAAGGG - Intergenic
1198245502 X:134827430-134827452 GTGAGGGTCTAAATGAAAAAGGG - Intronic
1198872558 X:141191572-141191594 CAGTGTTTCTAAATGAGAAAAGG + Intergenic
1199988109 X:152966934-152966956 CTGAGGTTGTATATGCCAAGGGG - Intronic
1201486344 Y:14498380-14498402 CAGAGATTCAAAATGACAACGGG + Intergenic