ID: 1121101104

View in Genome Browser
Species Human (GRCh38)
Location 14:91250953-91250975
Sequence CTGTTGGTTAGGCAGTCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121101104_1121101110 14 Left 1121101104 14:91250953-91250975 CCCTCTGACTGCCTAACCAACAG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1121101110 14:91250990-91251012 CGACACTGTACCGGTTTTTGAGG 0: 1
1: 0
2: 0
3: 0
4: 27
1121101104_1121101109 5 Left 1121101104 14:91250953-91250975 CCCTCTGACTGCCTAACCAACAG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1121101109 14:91250981-91251003 GCATGGAAGCGACACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121101104 Original CRISPR CTGTTGGTTAGGCAGTCAGA GGG (reversed) Exonic
903747618 1:25598828-25598850 TTTTTGGTTAAGCAGTCACAGGG - Intergenic
904368310 1:30032350-30032372 CAGTGGGTTAGGCAATCATAAGG - Intergenic
904560896 1:31396606-31396628 TTGTTGGTTAGGCAGACAACAGG - Intergenic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
915592881 1:156880534-156880556 CTGGAGGTTAGACTGTCAGAAGG + Intronic
920861162 1:209708209-209708231 TTGTTGATTAGTCAGTTAGAAGG + Intronic
1066450434 10:35523300-35523322 CTTTTAATTAGGCAGTAAGATGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1074691965 10:116014258-116014280 CTGTTGATTAAGCAGTCACAGGG + Intergenic
1077555083 11:3222113-3222135 CTGATGGTGAGGCAGCCAGGAGG - Intergenic
1082699042 11:56404759-56404781 CTTTTGGTGAGGCTGTCAGCTGG - Intergenic
1085464260 11:76713458-76713480 CTGGTGGGTAGGCAGGTAGATGG + Intergenic
1090057832 11:123438664-123438686 TTGGTGGTTATGCACTCAGAGGG + Intergenic
1090072953 11:123560275-123560297 CTGTCTGTGAGGGAGTCAGAGGG + Intronic
1090999243 11:131894564-131894586 CTGTGGGTTAGGCAGTGTCACGG - Intronic
1092162518 12:6323894-6323916 CTGTTGCTCAGGAAGTCAGTGGG + Intronic
1096980389 12:55725308-55725330 GTGTTGGTTGGGCAGGCAGTGGG - Intronic
1101411102 12:104469227-104469249 CTGTTAGTACGGCAGACAGAGGG - Intronic
1102659270 12:114511752-114511774 TTGTTGTTTTGCCAGTCAGATGG - Intergenic
1103284619 12:119790046-119790068 CTGTTGCTTTGAAAGTCAGAAGG - Intronic
1103429963 12:120875161-120875183 CTGTGGGTTAGGCATTTGGATGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1105588444 13:21767203-21767225 CTGTTGGCCAGGCAGTAGGAAGG - Intergenic
1105733723 13:23246347-23246369 CTGTTGCTTTGGCTGCCAGAGGG - Intronic
1105797180 13:23866795-23866817 AAGTTGGGTAGGCAGTTAGATGG - Intronic
1107192984 13:37612286-37612308 CTGTTACTTTGGCAATCAGACGG + Intergenic
1107399907 13:40059724-40059746 CTGTTGGTTAGTGAGTTGGAAGG - Intergenic
1111925857 13:94462748-94462770 CTGTTGGAAAGACAGTGAGAGGG + Intronic
1116397998 14:44470660-44470682 CTGTTGGTCAGGAAGTTGGAAGG - Intergenic
1117391054 14:55263186-55263208 CTGTTCAGTAGGCAGTCAGAGGG + Intergenic
1117554904 14:56874155-56874177 CTGTTGGATAGGCAACCAGCAGG - Intergenic
1119518522 14:75267825-75267847 CTGTTGGTAAGTCAGGCAGTAGG + Intronic
1120705973 14:87746111-87746133 GCTTTGGTTGGGCAGTCAGATGG + Intergenic
1121101104 14:91250953-91250975 CTGTTGGTTAGGCAGTCAGAGGG - Exonic
1126842773 15:52733543-52733565 CTGTTGGGTGGGAAGGCAGAGGG + Intergenic
1131343127 15:91621472-91621494 CTGGTGGGCAGGCAGGCAGAGGG + Intergenic
1131343616 15:91626415-91626437 TTTTTGGTTAGGAAGCCAGAGGG - Intergenic
1133883118 16:9801760-9801782 CTGGTGGTCATGCTGTCAGAGGG + Intronic
1136774328 16:32863601-32863623 ATGATGGTTGGGCAGTCACATGG - Intergenic
1136896283 16:33997913-33997935 ATGATGGTTGGGCAGTCACATGG + Intergenic
1138433372 16:56983489-56983511 CTGTTGGGGAGACAGACAGAGGG + Intronic
1138862019 16:60770142-60770164 CTGTTGCTCAAGCAGTCAGCTGG + Intergenic
1140192653 16:72831119-72831141 CTGTTTTCTAGACAGTCAGAAGG - Intronic
1203076751 16_KI270728v1_random:1125720-1125742 ATGATGGTTGGGCAGTCACATGG - Intergenic
1149561251 17:57609356-57609378 CTGTTAGCCAGACAGTCAGACGG + Intronic
1150226586 17:63527842-63527864 CTGTTGGGTAGGCAGACAGGAGG - Intronic
1151352038 17:73537511-73537533 CTGATGGAGAGGCAGGCAGAGGG + Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1153372854 18:4339320-4339342 GTGTTGGGAAGGCAGCCAGAGGG + Intronic
1155081331 18:22413014-22413036 CTGTTGGATAGTAAGCCAGAAGG - Intergenic
1156517814 18:37695972-37695994 CAGTGGCTGAGGCAGTCAGATGG + Intergenic
1158454401 18:57593603-57593625 CTGCTGGTTGGTCAGTGAGAAGG + Intergenic
1164055448 19:21618243-21618265 TTGCTGGTTAGCCAATCAGATGG + Intergenic
1164773130 19:30828021-30828043 CTGTTGGTTAGGCAACCAAAAGG - Intergenic
1167879442 19:52444118-52444140 CATTTGGGTAGGCTGTCAGAGGG + Intronic
925989591 2:9243455-9243477 CTGTTGTTTAGGAACTCAGACGG + Intronic
927995241 2:27480707-27480729 CTGTTGTTTAGCCAGATAGATGG - Intronic
929790869 2:45022014-45022036 CTCTGTGTTAGGCTGTCAGAGGG + Intergenic
930597455 2:53405754-53405776 CTTTTGTTGAGGCAGTCAAAAGG + Intergenic
933493454 2:83018194-83018216 CTGTTGGTTAAGTACTCAGTTGG + Intergenic
934281352 2:91615727-91615749 CAGTTTGTTAGGCAGTGAGGAGG + Intergenic
940259683 2:151766827-151766849 CTGTAGGTCATGCAGTCACAAGG - Intergenic
940583502 2:155612558-155612580 ATGTTGGTTAGACAGTGATAAGG - Intergenic
946159913 2:217829843-217829865 GTGGTGGTCAGGCTGTCAGAAGG - Exonic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947484590 2:230536569-230536591 TTATTGGTTAGGCAGTCATAAGG - Intronic
947521889 2:230852219-230852241 CTGCTGGGGAGGCTGTCAGAAGG + Intergenic
1169818997 20:9688295-9688317 GTGTTGGGGAGGCAGGCAGAGGG - Intronic
1170898269 20:20436125-20436147 CTGTGATTTAGGCAGACAGACGG - Intronic
1173274995 20:41572654-41572676 CTGATGGGTAGGCATGCAGAAGG - Intronic
1177135808 21:17304464-17304486 CTGTTTGTTAAGCAGGGAGAAGG - Intergenic
1178821818 21:35982417-35982439 CTCTTGGTGGGGCAGTCAGGGGG - Intronic
1181795197 22:25303120-25303142 CAGATGGGTAGGCAGACAGAGGG - Intergenic
1181835739 22:25606640-25606662 CAGATGGGTAGGCAGACAGAGGG - Intronic
1184418972 22:44368670-44368692 CTGCTGGGTGTGCAGTCAGAGGG - Intergenic
949096897 3:96992-97014 CTGTAGGTAAAGCAGACAGATGG + Intergenic
953328256 3:42030747-42030769 TTGTTGGTCAGGCAGTTAGTAGG + Intronic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954369592 3:50163249-50163271 CCGTTGCTTCGGCAGACAGAGGG - Intronic
960258749 3:115540450-115540472 TAGTTGGTTAGGCAGTGACAGGG - Intergenic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
964606136 3:158562261-158562283 CTGTGTGTTAGGCAGTGAGTGGG + Intergenic
966007231 3:175030088-175030110 CAGTTTCTAAGGCAGTCAGATGG - Intronic
966767393 3:183475573-183475595 CTGAGGGTTAGGCCATCAGATGG + Intergenic
967765146 3:193271151-193271173 ATTTTGGTTAGGCAGTTTGAGGG + Intronic
972369991 4:38414176-38414198 CTCTGTTTTAGGCAGTCAGATGG - Intergenic
973634789 4:52851987-52852009 CTGGTGGTGGGGAAGTCAGAGGG - Intergenic
977570067 4:98620125-98620147 CTATTGGTTAAGCTGTCATAAGG - Intronic
977938814 4:102835879-102835901 CTGTGGGTTAAGAAGACAGAGGG - Intronic
978796735 4:112715304-112715326 CTCTTGGTGAGGCAGTCTCATGG + Intergenic
979367589 4:119843887-119843909 CTGTTGGCTAGGCTCTCAGCTGG + Intergenic
984977950 4:185246425-185246447 CTGCTGCTTTGGCAGTCTGATGG + Intronic
986361655 5:6984135-6984157 CTCTTGGCTCTGCAGTCAGAGGG + Intergenic
986697674 5:10373235-10373257 TTGTTGGTTTGTCATTCAGAAGG + Intronic
994329921 5:98492562-98492584 CATTTGGGTAGGCTGTCAGAGGG - Intergenic
994488862 5:100416081-100416103 CTTTTTGTTAGGCAGTCCTACGG - Intergenic
996752344 5:126901527-126901549 CTGATTGTTAGGCAGTGTGAGGG + Intronic
998937092 5:147240870-147240892 GTGTTGGTTAGCCACTCTGAGGG - Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999549347 5:152668385-152668407 CTGTTAGTTAGACAGTTAGTTGG + Intergenic
1000787182 5:165559633-165559655 CTGTTAGGTAGGCAGTGCGAAGG + Intergenic
1003145550 6:3507327-3507349 CTGTTGGCTAGGCACTCAAAAGG - Intergenic
1003956874 6:11172415-11172437 GTGTTAGTTAGGTAGTGAGATGG + Intergenic
1003984657 6:11423765-11423787 TTGTTGGAAATGCAGTCAGAAGG - Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1006167762 6:32075197-32075219 CTGTTGGGTCTGCAGCCAGAAGG + Intronic
1007805796 6:44444923-44444945 CTGCTGCTTAGGCTGCCAGAAGG + Intronic
1008222213 6:48868835-48868857 CTATTGCTTAAGCAGTCAAAGGG - Intergenic
1012241528 6:96878365-96878387 CAGCTGGTTAGACAGCCAGAGGG + Intergenic
1012758349 6:103263126-103263148 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1016236244 6:141870454-141870476 CTGATGGTTGGAGAGTCAGATGG - Intergenic
1016806659 6:148218724-148218746 TTGTAGGTCACGCAGTCAGAGGG + Intergenic
1017072586 6:150589017-150589039 CTGGTGCTTAGGCAGTCACACGG - Intergenic
1023228297 7:37995943-37995965 CTGTTGGTCATTCAGTCACATGG - Intronic
1026894857 7:74004078-74004100 CTTTTGGATGGGCAGTCAGTCGG + Intergenic
1026925921 7:74193545-74193567 CTGTTGGTTGCGCACTCAGGGGG - Intronic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1029622625 7:101699458-101699480 CAGATGGGTAGGCAGACAGACGG + Intergenic
1031723457 7:125206819-125206841 CTGGTGATTAGGCAGGAAGATGG + Intergenic
1032836880 7:135682904-135682926 CTGAGGGTTACGCAGTAAGATGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035047706 7:155980171-155980193 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1035250720 7:157595381-157595403 CTGGAGGTTAGGAAGCCAGAAGG + Intronic
1035931368 8:3783669-3783691 CTGCTGGTTCAGCAGTCAAACGG + Intronic
1038748475 8:30274608-30274630 CTGTTGGCAAGGCAGCCGGAAGG - Intergenic
1040796125 8:51291635-51291657 CTGTTTGTTAAGCAGGGAGAAGG + Intergenic
1041179075 8:55229163-55229185 CTGTTTGTAAGGCAGGCAGCAGG + Intronic
1041553852 8:59130856-59130878 CTTTTAGTTAGACAGTCATAGGG - Intergenic
1042469756 8:69172531-69172553 CTGTTGGTTAACCATTCATATGG + Intergenic
1044325577 8:90853972-90853994 TCGTTGGTTAGGCAATCATAGGG + Intronic
1046500551 8:115070858-115070880 CTGCGGGTCAAGCAGTCAGAAGG - Intergenic
1047201653 8:122772414-122772436 CTGTTGGCTAGGACCTCAGATGG + Intergenic
1050860705 9:10426628-10426650 CAGTTGTTTCTGCAGTCAGAGGG - Intronic
1051856759 9:21576333-21576355 CCCTTGGTTAGACAGTAAGAAGG + Intergenic
1052043622 9:23769329-23769351 CAGCTGGGTAGGCAGTCAAAGGG + Intronic
1057463331 9:95287673-95287695 CAGGTGGTAAGGTAGTCAGATGG - Intronic
1203376994 Un_KI270442v1:384372-384394 CTGTTGGTTCTGGAGGCAGAAGG + Intergenic
1192102220 X:68277030-68277052 TTTTGGGTTAGGCATTCAGACGG - Intronic
1194817792 X:98465499-98465521 CTCAAAGTTAGGCAGTCAGAAGG + Intergenic
1195928523 X:110050217-110050239 TTGGTGGTTTGGCAGTCACAAGG - Intronic
1197641078 X:128968641-128968663 CAGTTGGTTAGGAAAACAGAGGG + Intergenic
1197769452 X:130080947-130080969 CTGTTGGTTAGTCAGCAACATGG - Intronic