ID: 1121102138

View in Genome Browser
Species Human (GRCh38)
Location 14:91257030-91257052
Sequence GTTGTTTTGTAAATAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121102137_1121102138 0 Left 1121102137 14:91257007-91257029 CCTTGGCAGAGACAGCAGAATTT No data
Right 1121102138 14:91257030-91257052 GTTGTTTTGTAAATAAAACCTGG No data
1121102136_1121102138 5 Left 1121102136 14:91257002-91257024 CCAGTCCTTGGCAGAGACAGCAG No data
Right 1121102138 14:91257030-91257052 GTTGTTTTGTAAATAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121102138 Original CRISPR GTTGTTTTGTAAATAAAACC TGG Intergenic
No off target data available for this crispr