ID: 1121104079

View in Genome Browser
Species Human (GRCh38)
Location 14:91269560-91269582
Sequence GAGGCTGCAGAGATGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121104074_1121104079 -1 Left 1121104074 14:91269538-91269560 CCAGCTCGAATCTCAGGCTCCTG No data
Right 1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121104079 Original CRISPR GAGGCTGCAGAGATGGTCCT GGG Intergenic
No off target data available for this crispr