ID: 1121105070

View in Genome Browser
Species Human (GRCh38)
Location 14:91274186-91274208
Sequence AGAGAGAGGCAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1827
Summary {0: 1, 1: 1, 2: 19, 3: 208, 4: 1598}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121105058_1121105070 26 Left 1121105058 14:91274137-91274159 CCGGAACCTTCACTGCCACTCAG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG 0: 1
1: 1
2: 19
3: 208
4: 1598
1121105063_1121105070 2 Left 1121105063 14:91274161-91274183 CCTCTCTCTGGGCCCGAGAAAGA 0: 1
1: 0
2: 2
3: 12
4: 151
Right 1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG 0: 1
1: 1
2: 19
3: 208
4: 1598
1121105059_1121105070 20 Left 1121105059 14:91274143-91274165 CCTTCACTGCCACTCAGACCTCT 0: 1
1: 1
2: 1
3: 33
4: 380
Right 1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG 0: 1
1: 1
2: 19
3: 208
4: 1598
1121105062_1121105070 11 Left 1121105062 14:91274152-91274174 CCACTCAGACCTCTCTCTGGGCC 0: 1
1: 0
2: 2
3: 45
4: 364
Right 1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG 0: 1
1: 1
2: 19
3: 208
4: 1598
1121105065_1121105070 -10 Left 1121105065 14:91274173-91274195 CCCGAGAAAGAGAAGAGAGAGGC 0: 1
1: 2
2: 10
3: 69
4: 718
Right 1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG 0: 1
1: 1
2: 19
3: 208
4: 1598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121105070 Original CRISPR AGAGAGAGGCAGAATGGGGA TGG Intronic
900017433 1:162327-162349 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900047692 1:520923-520945 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900149210 1:1170934-1170956 AGGGCCAGGCAGAATGGGGGAGG - Intergenic
900324698 1:2102872-2102894 AGAGAGAGACAGACGGGGGGAGG - Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900676643 1:3891701-3891723 AGAGAAAGGCAGAGTGGGTGGGG - Intronic
901006357 1:6173546-6173568 AGAGAGAGGCTCAGTGGGGAGGG - Intronic
901028314 1:6291016-6291038 AGACAGAGGCAGCTTGGGGCTGG + Intronic
901170204 1:7251411-7251433 GGAGACGGGCAGGATGGGGAGGG + Intronic
901186816 1:7378952-7378974 AGTCAGAGACAGAGTGGGGATGG - Intronic
901499568 1:9643425-9643447 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
901700582 1:11043152-11043174 TGTGGGAGGCAGAGTGGGGAGGG - Intronic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901787075 1:11631847-11631869 AGAGAGAGAGAGAAAGTGGAAGG + Intergenic
901787089 1:11631978-11632000 AGAGAAAGGGAGGAAGGGGAAGG + Intergenic
902391905 1:16111822-16111844 GGAGAGAGACAGACTCGGGAAGG - Intergenic
902623542 1:17664176-17664198 AGAGAGAGGCAGGGAAGGGAAGG + Intronic
902654734 1:17859526-17859548 AGAGAGAGAGAGATGGGGGAGGG + Intergenic
902654763 1:17859614-17859636 AGAGAGAGAAAGATGGGGGAGGG + Intergenic
902796308 1:18802865-18802887 AGAGAGACACTGAATGGGGTTGG - Intergenic
902811906 1:18892716-18892738 AGTGGGAGGCAGAGTGGGGGTGG - Intronic
903147425 1:21383560-21383582 AGAGAGAGGCAGAGTGGGAGTGG - Intergenic
903234665 1:21942058-21942080 ACAGGGAGGCAGAATGGGTGTGG - Intergenic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903517672 1:23922933-23922955 ATAGAGAGTTAGAATGGGGCTGG - Intergenic
903679313 1:25086770-25086792 AGAGAGAGGTGGCCTGGGGAGGG - Intergenic
904036235 1:27560521-27560543 AGAGAAAGGCAGAGGTGGGAGGG - Intronic
904117544 1:28173813-28173835 AGAGAGAGACAGAATATGCAGGG - Intronic
904397101 1:30229300-30229322 AGAGTGAGGCAGACAGGGCATGG - Intergenic
904540891 1:31232459-31232481 AGAGAGAGAGAGAGTGGGGGAGG + Intronic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
905141822 1:35852334-35852356 AGAGAAAGTCAGAAGAGGGATGG + Intronic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905362307 1:37429584-37429606 AGAGAGAGGGAGAAGGGGAGAGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905865127 1:41372384-41372406 AGAAAGAGGAAGAGTGGGCATGG - Intronic
905893418 1:41530845-41530867 AGAGAGAGATAGGAAGGGGAGGG + Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906248751 1:44295204-44295226 TGGGAGAGGAAGAATGGGCAGGG + Intronic
906527192 1:46501141-46501163 AGAGAGAGAGGGAAGGGGGAGGG - Intergenic
906576500 1:46895450-46895472 AGAGAAAGGCAGATGGGGGTGGG + Intergenic
906595418 1:47072135-47072157 AGAGAAAGGCAGATGGGGGTGGG - Intronic
906649702 1:47503860-47503882 AGAGCTAGGCAGAAACGGGAGGG + Intergenic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
906882571 1:49608164-49608186 AAAGAAAGGAAGAAAGGGGAAGG + Intronic
906916596 1:50017738-50017760 AGAGAGGGGCAGGAGGGTGAGGG + Intronic
907014880 1:51002842-51002864 AGTGAGAGGAAGAGAGGGGAGGG + Intergenic
907165697 1:52408876-52408898 AGACAGAGGCAGGCTGGGTAAGG - Intronic
907181286 1:52572641-52572663 AGAGAGAGGGAGAAGGGAGAGGG - Intergenic
907192836 1:52663130-52663152 AGAGAGATGGAGAAGAGGGAGGG - Intronic
907291599 1:53417104-53417126 AGAGAGAGGCAGCTCGGGGTGGG - Intergenic
907327247 1:53646837-53646859 AGAGAGAGAAAGAGAGGGGAAGG + Intronic
907350163 1:53822886-53822908 ATAGAGGGTCAGAATGGGAATGG + Intronic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908259028 1:62325398-62325420 AAAGAAAGGCAGAATTGGGCAGG - Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909096362 1:71293176-71293198 AGAGAGAGAAAGAAGAGGGAGGG - Intergenic
909591439 1:77353610-77353632 AGTGAGACGCAGAGTGGGTAAGG - Intronic
909600523 1:77456711-77456733 AGAACCATGCAGAATGGGGAAGG + Intronic
909699776 1:78510415-78510437 AGAGAGAGTAAGAAAGAGGAAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
910280863 1:85500036-85500058 AGAGAGAGAAAGAAAGGGGAAGG - Intronic
910303185 1:85731187-85731209 AGAGAGCTACAGAATGGGGCGGG - Intronic
910440646 1:87248127-87248149 AGAGAGAGAGAGAATGAGGCGGG + Intergenic
910512311 1:88021155-88021177 AGAGAGAGAGAGGGTGGGGAAGG + Intergenic
910771980 1:90840017-90840039 GGAGAGGGGCAGGATAGGGAAGG - Intergenic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911712894 1:101095763-101095785 AGAGAGCAGCAGCATGGGTAGGG - Intergenic
911871563 1:103107121-103107143 AGAGGGAGGGAGAAGGCGGAGGG + Intronic
912124028 1:106510734-106510756 AGAGGGAGGAAGAATAGAGAGGG + Intergenic
912340052 1:108905668-108905690 AGAGAGATGGAAAATAGGGAGGG - Intronic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912657223 1:111497664-111497686 AGAGAGAGACAGAAAGGAGGAGG + Intronic
912730002 1:112093778-112093800 AGAGAGAGACAGAATGAGGGAGG + Intergenic
912763549 1:112389005-112389027 GAAGAGAGGCAGTAAGGGGAGGG + Intergenic
912772030 1:112472981-112473003 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
912957297 1:114164640-114164662 AGAGAGAGGTAGAAAGGGTGGGG - Intergenic
912999112 1:114562150-114562172 AGAGGGAGGTAGAAGGTGGAAGG - Intergenic
913484341 1:119320154-119320176 GGAGAGAGGGAGAAGGGGAAGGG - Intergenic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
914446289 1:147753260-147753282 AGAGAGGTGGGGAATGGGGAGGG - Intergenic
915107890 1:153545792-153545814 AGAGAGGGGAAGAATGGGGACGG + Exonic
915211539 1:154313243-154313265 GGAGAGATACAGAAAGGGGACGG - Intergenic
915794514 1:158714865-158714887 AGAGAGAGAGAGAAAGGGGGAGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915900100 1:159840615-159840637 TGAGAGAGGCAGATGGTGGAAGG + Intronic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
915956725 1:160226400-160226422 AGAGAGAGGAAGGAAGGTGAAGG - Intronic
916078375 1:161216633-161216655 AAATAGAGGCAGAAATGGGAAGG + Intronic
916260732 1:162839697-162839719 AGAAAGAGGAAGGAAGGGGAAGG + Intronic
916336829 1:163681774-163681796 AGAGAGTGGCAAAATGGGGATGG - Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916510654 1:165469796-165469818 TGAGAGAGGAAAAATGGGAAAGG - Intergenic
916573422 1:166046758-166046780 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916811282 1:168307656-168307678 AGAGAGAGGAAGAAGGCAGAGGG - Intronic
917054949 1:170970761-170970783 AGAGAGAGACAGAGTGGGCAGGG + Intronic
917243865 1:172978775-172978797 AGAGAGAGAGAGAAGGGGGGCGG - Intergenic
917374661 1:174336900-174336922 AGAGAGAGAAAGAATGGAGGAGG + Intronic
917491308 1:175500910-175500932 AGAGCCAGGCAGAATGGCAATGG + Intronic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
917739067 1:177945808-177945830 AGAGAGATACAGAACAGGGAGGG + Intronic
918048647 1:180956005-180956027 GGAGGGAGGGAGAAAGGGGAAGG - Intergenic
918109470 1:181442744-181442766 AGAAAGAGACAGGATGTGGAAGG - Intronic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918416772 1:184317454-184317476 AGAGAAAGGGAGAAAGGAGAGGG + Intergenic
918535301 1:185567420-185567442 AAAGTGTGGCAGAATGGGGGTGG + Intergenic
918621045 1:186606199-186606221 AGAGAGAGAGAGAGTGGAGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919056943 1:192583024-192583046 AGAGAGAGGGAGAAAGGGAAAGG + Intergenic
919138046 1:193535337-193535359 TGATAGAGGAAGAATGGGGATGG - Intergenic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919392812 1:197009102-197009124 AGAGAGAGACAGAGTGGCGGGGG + Exonic
919455329 1:197814196-197814218 AGAGTGGGGAAGAATGGGGCAGG + Intergenic
919531300 1:198724667-198724689 AGAGAGAGAGAGAATCAGGATGG - Intronic
919638256 1:200024875-200024897 AGAGAGAGAGAAGATGGGGAAGG + Intergenic
919844371 1:201632059-201632081 AGAGAGAAGCACATTGGGAAAGG - Intronic
920051678 1:203168148-203168170 AGAGAGGTGCAGAGTGGGGAGGG + Intronic
920181952 1:204137481-204137503 AGAGAGAGGTAGACTGGTTAAGG + Intronic
920230472 1:204466645-204466667 AGAGAGAGACAGTGGGGGGAGGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920441125 1:205980898-205980920 AAAGAAAGGAAGAAAGGGGAAGG - Intronic
920493443 1:206437248-206437270 TGAAAGAGGCAGGATGGGTAGGG - Intronic
920539867 1:206770186-206770208 AGAGAGAGGCAGAAAAGGACAGG - Intronic
920656738 1:207882169-207882191 AGAAGAAGGCAGAATTGGGAGGG + Intergenic
920735442 1:208529123-208529145 AGAAGGAGTCAGATTGGGGAAGG + Intergenic
920743807 1:208606664-208606686 TGACACAGGCAGATTGGGGATGG - Intergenic
921066956 1:211630311-211630333 TGAGAGAGGCAGTGTGGGGAGGG - Intergenic
921250365 1:213291748-213291770 AGAGGGAAGCAGAATGGTGTGGG - Intergenic
921266924 1:213428513-213428535 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
921329375 1:214020207-214020229 TGAGGGGGGCAGAGTGGGGACGG - Intronic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
921337261 1:214100744-214100766 AGAGAGAGAGAGAATGGGAGAGG + Intergenic
921406724 1:214788513-214788535 AGAGAGAGGCTGAATGGGTTGGG + Intergenic
921562070 1:216670806-216670828 GGAGAGAGAAAGAAAGGGGATGG + Intronic
921573813 1:216809999-216810021 AGAGAGAGACAGAAAGGGGGAGG + Intronic
921580861 1:216894656-216894678 GGAAAGAGGCAGTATGGGGAGGG + Intronic
921604624 1:217138778-217138800 AGAGAGAGACAGAGAGGAGAGGG - Intergenic
921949155 1:220911102-220911124 ATAGAGAGCCAGAATGGGTCAGG - Intergenic
922105275 1:222508245-222508267 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922265608 1:223980823-223980845 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922329609 1:224562726-224562748 AGAGAGAGACAGTGAGGGGAGGG - Intronic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
923001053 1:230006727-230006749 AGAGAGAGGAGGAATGGGATGGG - Intergenic
923470984 1:234290902-234290924 AGAGAGTAGCAGAATTGAGAGGG - Intronic
923846077 1:237734294-237734316 AGAGAGAGAGAGAATGGAGTGGG + Intronic
923849379 1:237776712-237776734 GGAGAGAGGAGGTATGGGGAAGG + Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924347449 1:243085778-243085800 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
924799466 1:247317185-247317207 AGAGGGTGGCAGAATGGCCAGGG + Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
924856147 1:247876948-247876970 AGAGAGAGACAGAGCGGGGAAGG - Exonic
1062948122 10:1476186-1476208 AGAGAGAGGCAGAGAGAGAAAGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063157938 10:3397209-3397231 AGAGAGAGAGAGAAAGGGGGAGG - Intergenic
1063511248 10:6647060-6647082 AGAGAGAGGGAGAGAGGGAAAGG - Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1063678432 10:8162742-8162764 AGAGAAAGCCAGAAAGGAGAAGG + Intergenic
1063859505 10:10292277-10292299 AGAGAGAGGTTAAATGGGAAAGG - Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064050661 10:12056737-12056759 AGAGAGAGAGAGACTGGGCACGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064326106 10:14353108-14353130 AGAGAGAGAGAGAAGGGAGAGGG + Intronic
1064795547 10:19007584-19007606 GGAGGGAGGGAGAGTGGGGAGGG - Intergenic
1064819009 10:19302616-19302638 AGAGAAAGGTAGAATGGATAAGG + Intronic
1064865003 10:19869454-19869476 AGAGAGAGAGAGAAAGGGGGGGG + Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065810404 10:29438097-29438119 AGAGAGAGACAGAGGGGGGGGGG - Intergenic
1065813698 10:29465195-29465217 AGAAAGAGAAAGAAAGGGGAAGG - Intronic
1066298864 10:34079461-34079483 TGAGAGTGGCAGATGGGGGAAGG - Intergenic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066507470 10:36060336-36060358 AGGAAGAGACAGAGTGGGGAGGG + Intergenic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1067945466 10:50685756-50685778 AGAGGGTGGCTGAATGGGGAGGG + Intergenic
1068467128 10:57408867-57408889 AAAGATAGGCAAAATGGTGAAGG + Intergenic
1068638824 10:59378824-59378846 AGAGAAAGCCAAATTGGGGAAGG - Intergenic
1068809052 10:61235175-61235197 AGAAAGACTCAAAATGGGGAGGG - Intergenic
1068846437 10:61680960-61680982 AGAGAGAGAGAGAACGAGGATGG - Intronic
1068897213 10:62219177-62219199 GGAGACAGGCAGAATGAGAATGG + Intronic
1068933864 10:62617523-62617545 GGAGAGAGGAAGAAAGGAGAAGG + Intronic
1069040484 10:63690946-63690968 AGATAAAGGAAGAAAGGGGATGG + Intergenic
1069344937 10:67457813-67457835 AGAGAGAGGCAGGAGAGAGATGG - Intronic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1069717559 10:70530715-70530737 TGAGTGAGACAGAATGGGGTGGG + Intronic
1070314106 10:75294709-75294731 AGAGAGAGGAGGGGTGGGGAAGG + Intergenic
1070384995 10:75916389-75916411 AGAGAGAGGCAGCAGGGGTGAGG + Intronic
1070597915 10:77845644-77845666 AGAGAGAGAAAGAAAGGGAAAGG + Intronic
1070629833 10:78076648-78076670 AGAGAGAGGGAGAGGGGAGAGGG + Intergenic
1070683041 10:78462431-78462453 GGAGGGAGGCAGGATGGGGCAGG + Intergenic
1070729233 10:78813856-78813878 GGATGGAGGCAGAATGGGGCAGG - Intergenic
1070866977 10:79712629-79712651 AGAGGGTGGCTGAATGGGGAGGG + Exonic
1070880767 10:79850750-79850772 AGAGGGTGGCTGAATGGGGAGGG + Exonic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071421994 10:85510144-85510166 AGAGAAAGGCATACTGGTGAGGG + Intergenic
1071423514 10:85525843-85525865 AGAGAGTGGCAGAAAGGAGAGGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071633889 10:87234852-87234874 AGAGGGTGGCTGAATGGGGAGGG + Exonic
1072050211 10:91696556-91696578 AGAGAGAGGGATGATGGGGGAGG + Intergenic
1072282313 10:93877879-93877901 AGAGAGAGAAAGAAAGGAGAGGG + Intergenic
1072307402 10:94120801-94120823 AGAGAGAGGGGTGATGGGGAAGG + Intronic
1072459412 10:95605529-95605551 AGATGGAGGGAGAGTGGGGAGGG + Intergenic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1072728172 10:97827574-97827596 AGAGGGAGGAAAGATGGGGAGGG - Intergenic
1072811701 10:98467482-98467504 AGAGAGAGGGAGAGAGGGAAGGG + Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073103765 10:101020725-101020747 AGGGAGAGTGAGAATGGGGCGGG + Intronic
1073142763 10:101260029-101260051 TGAAAGAGGGAGAATGAGGACGG + Intergenic
1073349908 10:102812397-102812419 AGAGAGGGGCAGTTTGGGAAGGG - Intronic
1073460143 10:103661379-103661401 AGAGAGAGGCAGAGCGGAGGCGG + Intronic
1073649178 10:105340744-105340766 GGAGAGAGGCAGCACAGGGAAGG - Intergenic
1073849132 10:107594007-107594029 AGAGACAGACAGATGGGGGAGGG + Intergenic
1073923457 10:108485621-108485643 ACAGAGTGGCAGAATGGATAAGG - Intergenic
1074140228 10:110666002-110666024 AGAGAGAGAGAGAGAGGGGAAGG + Intronic
1074290228 10:112132774-112132796 AGAGAGAGAGAGAATTGGGGAGG - Intergenic
1074304348 10:112262961-112262983 AGAGAATTGCAGAGTGGGGAGGG - Intergenic
1074404669 10:113170535-113170557 AGAGAGAGGCAGAAGGTGTCTGG - Intergenic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1074756633 10:116628450-116628472 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075612807 10:123866930-123866952 AGAGTGAGGCAGACGTGGGATGG - Intronic
1075670534 10:124261197-124261219 AGATAGAGCCAGAACAGGGAAGG + Intergenic
1075918749 10:126191963-126191985 AGGAAGAGAGAGAATGGGGAGGG + Intronic
1075939055 10:126372734-126372756 AGAGGGAGGCAGAAAGGGCTGGG - Intronic
1076049487 10:127321229-127321251 AGAGAGGGGGAGGACGGGGAGGG - Intronic
1076182495 10:128421367-128421389 AAAGAGAGGCTGAATGGCAATGG + Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076778140 10:132709413-132709435 AGAAAGAGGAAGAAGAGGGAGGG + Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1076974029 11:157533-157555 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1077507769 11:2940098-2940120 AGACAGAGGCAGAAATCGGAAGG + Intergenic
1077644623 11:3912264-3912286 AGAGAGGGGAAGAGAGGGGAGGG - Intronic
1077678212 11:4216036-4216058 AGAGAGAGGAAGCAGTGGGATGG - Intergenic
1077762553 11:5118988-5119010 AGAGAGAGGAGGAGAGGGGAGGG + Intergenic
1077956325 11:7023831-7023853 CGAGAGAGGGAGAGTAGGGAGGG + Intronic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078129080 11:8596977-8596999 GGAGGGAGGCAGAGAGGGGAGGG + Intergenic
1078282878 11:9920276-9920298 AAAAACAGGCAGAATTGGGAAGG + Intronic
1078550839 11:12279665-12279687 AGAGAGAGGCAGGAAGGGAGAGG - Intronic
1078841080 11:15075968-15075990 AGAGAAGGGCTGAATGAGGAAGG - Intronic
1078876946 11:15408691-15408713 AGAGAGAGGCAGACACTGGAGGG + Intergenic
1078897887 11:15614105-15614127 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1079033814 11:17005549-17005571 AGAGAGAGAGAGAATGGAGAGGG + Intronic
1079081135 11:17414476-17414498 GGAGGGAGGCAGGATGTGGAGGG - Intronic
1079455934 11:20636340-20636362 AGAGAGAGGCAGCCTGGTTAAGG - Exonic
1079850423 11:25526425-25526447 TCAAAGAGGCAGAATGGAGAAGG + Intergenic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1080812871 11:35723016-35723038 AGAGAGAGACAGAAGGAGGGAGG - Intronic
1081567441 11:44268717-44268739 TGAGAGAGGGAGAGTGAGGAGGG + Intronic
1081831748 11:46120825-46120847 GGAGAGAGGCAGAGGGGGAAGGG + Intronic
1082897280 11:58205277-58205299 TCAGGGAGGAAGAATGGGGATGG - Intergenic
1082949150 11:58791593-58791615 AGAAAGAGTCAAAGTGGGGAGGG + Intergenic
1083107647 11:60373932-60373954 ACAGGGAGCCAGAACGGGGATGG - Intronic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083735564 11:64678339-64678361 AGAGAGTGAGAGAATGGGGTTGG - Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084126561 11:67102917-67102939 AGAGAGAGGCAGAGTGTAGGCGG - Intergenic
1084364272 11:68687458-68687480 AGAGGGAGACAGGATGGGGGTGG - Intronic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1084892848 11:72244838-72244860 AGAGAGAGACAGGATGGAGCGGG + Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1085045976 11:73353679-73353701 GGTGAGAGGCAGTATGGGGTAGG - Intronic
1085181753 11:74542390-74542412 AGAGCATGGCAGGATGGGGACGG + Intronic
1085273660 11:75284606-75284628 ATAGAGAGGCAAAATGGGCCGGG + Intronic
1085279231 11:75319476-75319498 ACAGAGAGGCAGGGTGGGAAGGG - Intronic
1085754215 11:79190820-79190842 AGGGAGAGGGAGAAGGGAGAGGG - Intronic
1085793836 11:79519035-79519057 AGAGATAAGCAGATTGGTGATGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085907918 11:80787046-80787068 AAAGAGGGGAATAATGGGGAGGG + Intergenic
1085998282 11:81948929-81948951 AGAGAGAGAGAGAAAGGGGAAGG + Intergenic
1086056320 11:82651562-82651584 AGAGAGAGGAAGAGAGGGGGAGG + Intergenic
1086145649 11:83548353-83548375 AGAGAAAGGCAGAATAGAGATGG + Intronic
1086431618 11:86742082-86742104 AGAGAGAGAGAGAGTGGGGCAGG - Intergenic
1086867953 11:92002867-92002889 AGAAAGAGGAAGTGTGGGGATGG + Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087224225 11:95579864-95579886 AGAGATAGGGTGGATGGGGAAGG + Intergenic
1087315375 11:96596306-96596328 AGAATGGGGCAGAGTGGGGATGG + Intergenic
1087805892 11:102555052-102555074 AGAGACAGGGAGGAAGGGGAAGG - Intergenic
1087948149 11:104190237-104190259 AGAAAGAGGAACAATGGTGAAGG + Intergenic
1088047641 11:105472913-105472935 AGAAAGAGAAAGAAAGGGGAAGG + Intergenic
1088068848 11:105756256-105756278 AGATAGAGGTGGAATTGGGAAGG + Intronic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088365753 11:109038259-109038281 AGAGAGGGGCTTGATGGGGAAGG - Intergenic
1088400192 11:109415208-109415230 AGAAAGAGGAAGAATTGAGATGG + Intergenic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1088684434 11:112273106-112273128 AGAGAGAGAGAGAGGGGGGAAGG - Intergenic
1088954098 11:114601237-114601259 AGAAAGAGGGAGCATGGGAAGGG - Intergenic
1088998082 11:115021147-115021169 AGGGAGGGGAAGAAAGGGGAAGG - Intergenic
1089035851 11:115390350-115390372 AGAGAGAGGGAGAAGGGGAAAGG + Intronic
1089092129 11:115886625-115886647 AGAGGAAGCCACAATGGGGACGG + Intergenic
1089326331 11:117660083-117660105 AGAGAGAGGAAGAAATGGAAAGG - Intronic
1089350756 11:117820379-117820401 AGACAAAGGCAGGATGGGGTTGG + Intronic
1089351517 11:117824129-117824151 AGCCAGATGCAGAAAGGGGAGGG - Intronic
1089584529 11:119502115-119502137 AGAGAGAGGCAGGGCCGGGAGGG + Intergenic
1090082267 11:123622008-123622030 AGAGAGAGACAGAGGGGGAAAGG - Intronic
1090183396 11:124719998-124720020 AGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1090248506 11:125234974-125234996 AGTGAAAGCCAGGATGGGGAAGG - Intronic
1090264748 11:125346883-125346905 AGAGAGAGGGATAGAGGGGACGG - Intronic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1090547711 11:127783380-127783402 AGAGAGAGTCAGCATTTGGAAGG - Intergenic
1090612433 11:128483531-128483553 AAAAAGAGCCAGAAAGGGGAAGG + Intronic
1090634507 11:128682344-128682366 AGAGAGAGGCAGCTGGGGGCAGG - Intergenic
1090693829 11:129215948-129215970 AGAGAGAGGCAGAGGGGGTCTGG + Intronic
1090833710 11:130438552-130438574 AGAGAAAGAAAGAAAGGGGAAGG - Intergenic
1090858868 11:130635198-130635220 AGAGTCAGGCAGGATGGGAACGG + Intergenic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091690293 12:2591643-2591665 AGAGAGAGAGAGCATGAGGAAGG + Intronic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1091888975 12:4037972-4037994 AGAAAGAGGCAAAATGGAAAAGG - Intergenic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1092101790 12:5889598-5889620 AGAGACTGGCAGTCTGGGGAAGG - Intronic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092227563 12:6757887-6757909 AAAGCAAGGTAGAATGGGGATGG + Intronic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092470475 12:8773979-8774001 ATAGAGAGGCAGAATAGGTGGGG + Exonic
1092564007 12:9646410-9646432 AGAGAGAGTCAAAAGGTGGAAGG + Intergenic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092889591 12:12956286-12956308 AGAGGGAGGAAGGAAGGGGAAGG - Intergenic
1093318272 12:17678873-17678895 AGAGAGAGAGAGGAAGGGGAAGG + Intergenic
1093444675 12:19243092-19243114 TGAGAGAGGCAGCATGTGCATGG + Intronic
1093841497 12:23907995-23908017 GGAGAGAGCAAGAGTGGGGATGG - Intronic
1094325224 12:29230808-29230830 TGAGATAGGGAGAATGGTGAAGG + Intronic
1094653907 12:32402416-32402438 AGAGAGAGAGAGAGAGGGGAGGG + Intronic
1095095916 12:38149134-38149156 GGAGAGAGGGAGAAAGGGAATGG - Intergenic
1095108878 12:38268867-38268889 AGAGAGAGGGAGGATGAGAATGG + Intergenic
1095239553 12:39840463-39840485 AGAGACAGGCAAGATGGGCAGGG - Intronic
1095458917 12:42420690-42420712 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1095586048 12:43850517-43850539 AGAGAGGAGCATAATGGGCATGG - Intronic
1095668928 12:44835467-44835489 AGAGAGAGGCAGCAGGGACATGG + Intronic
1095825227 12:46524181-46524203 AGACAGAGGCAGAGATGGGAAGG - Intergenic
1095927863 12:47596891-47596913 AGAGAGAGAGAGACTGGGGCTGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096130371 12:49154225-49154247 AGAGAGAGAGAGAGTGGGGTGGG - Intergenic
1096609745 12:52793320-52793342 TGAGAGGGGCAGGATAGGGATGG - Intronic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1096745687 12:53725462-53725484 AGTGTGAGACAGGATGGGGACGG - Intronic
1096841622 12:54383402-54383424 AGAGAAAGGGAGAATGGGGGAGG - Intronic
1096958325 12:55549856-55549878 AGAGAAAGGTAAAATGTGGATGG + Intergenic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097191592 12:57221986-57222008 AGAGACTGAGAGAATGGGGAGGG + Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097459934 12:59849047-59849069 AGAGAGAGAGAGAGTGGGGAAGG - Intergenic
1097663607 12:62456296-62456318 AGAGAGAGACAGGAAGGGGTTGG - Intergenic
1097722289 12:63035507-63035529 AGAGAGAGGCACAAGTGGTAAGG + Intergenic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1097838789 12:64301016-64301038 AGAGAGAGAGAGAATGTGCAGGG - Intronic
1097981197 12:65739698-65739720 AGAGACAGACAAAAGGGGGAAGG - Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098402093 12:70086615-70086637 AGAGATACGGAGAATGGGGGCGG - Intergenic
1098411699 12:70191988-70192010 AGAGGGAGGTAGAATAGAGATGG + Intergenic
1098460766 12:70730810-70730832 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1098630186 12:72713402-72713424 AGAGACAGGGAGAAGGGGGTGGG + Intergenic
1098725280 12:73956956-73956978 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1099082332 12:78201016-78201038 AGAAAGAGAGAGAGTGGGGAGGG - Intronic
1099461036 12:82921507-82921529 AGAGAGCGAAAGAATGGGAAGGG - Intronic
1099808974 12:87556641-87556663 TTAGAGAGTCAGTATGGGGAAGG + Intergenic
1100017981 12:90035183-90035205 AGAATGAGGGAGAGTGGGGAGGG + Intergenic
1100017990 12:90035254-90035276 AGAGTGAGGGAGAGTGGAGAGGG + Intergenic
1100229526 12:92593136-92593158 AGAGAGAGGCTGTGTGGAGAGGG + Intergenic
1100405504 12:94269384-94269406 AGAAAGAGACAGACTGGGGTAGG - Intronic
1100523729 12:95400658-95400680 AGAGAGAGGGAGAAGGCAGAGGG - Intergenic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100722592 12:97374574-97374596 AGAGAGAGAGAGAAAGGGAAAGG - Intergenic
1100795489 12:98177373-98177395 AGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1101092153 12:101298306-101298328 AGAGGGAGACTGAATGGAGAGGG + Intronic
1101215063 12:102572928-102572950 AGTGTGAGGCAGCATGGGGCAGG + Intergenic
1101344125 12:103869601-103869623 AGAGAGAGAGAGATTGGGGAAGG - Intergenic
1101542512 12:105677628-105677650 ATAGAGAGGCAAAATGGCAAGGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101851152 12:108403470-108403492 AGAGAAAGGGAGAGAGGGGAGGG - Intergenic
1101851535 12:108406948-108406970 AGAGAGAGAGAGAATGAGGCAGG + Intergenic
1102001563 12:109560980-109561002 AGGGAGAGGAACAAGGGGGAGGG - Intronic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102231814 12:111267801-111267823 AGAGAGAGAGAGAAAGGAGAGGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102937073 12:116906558-116906580 AGAGGGAGGCAGGCTGGGCATGG + Intergenic
1103464215 12:121128978-121129000 AGAGAGAGAGAGAAGGGGGGTGG - Intergenic
1103542319 12:121674681-121674703 AGAGAGAGAGAGAAAGGGAAAGG + Intergenic
1103823052 12:123713238-123713260 AGACAGAGCCAGAAATGGGAAGG + Intronic
1103883253 12:124182694-124182716 AGAGGGTGGCAGTGTGGGGAGGG + Intronic
1103922485 12:124406159-124406181 AGACAGTGGCAGAATTGAGAAGG - Intronic
1104148143 12:126055315-126055337 ACAGAAATGCAGAATGGGGCAGG - Intergenic
1104348745 12:128026516-128026538 AGAAAAAGGCAAAATGGGGGTGG + Intergenic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1104649764 12:130523114-130523136 AGAGAGAGGCAGAGTGAGACTGG - Intronic
1105509260 13:21037781-21037803 AGAGACAGGCAGAGTGGGCAGGG + Intronic
1106107249 13:26743248-26743270 AGAGAGATGGAGAAGGGGGCTGG + Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106238406 13:27886147-27886169 AGAGAGAGGAAGCAAGGGCAGGG + Intergenic
1106525295 13:30535138-30535160 AGAGAAAGGCTGAGTGGGGAAGG - Intronic
1106579022 13:31001703-31001725 AGAGTGAGGCAGCATGGCCAAGG + Intergenic
1107091102 13:36481018-36481040 ACAGAGTGGCTGAATGGAGAAGG + Intergenic
1107195861 13:37650555-37650577 AGAGAGAGAGAGAAAGGTGAGGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107813186 13:44219529-44219551 TCAGGGAGGCAGAATAGGGAGGG - Intergenic
1107858065 13:44634814-44634836 AGAGAGAGACAGAGTGAGGCCGG - Intergenic
1107957301 13:45527933-45527955 AGAGCTAGGAAAAATGGGGATGG + Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108783530 13:53866952-53866974 AGAAAGAGGAAGATAGGGGAGGG + Intergenic
1109130309 13:58575965-58575987 AGAGAGACAGAGAAGGGGGAAGG + Intergenic
1109159610 13:58956276-58956298 AGACTGAGACTGAATGGGGATGG - Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1109925322 13:69129531-69129553 AGAGAGAGTGAGAGTGGGGTTGG - Intergenic
1109965061 13:69681301-69681323 AGAGAGAGAAAGAAGAGGGACGG + Intergenic
1110246735 13:73334046-73334068 AGAAAGTGGAAGAATGTGGAAGG - Intergenic
1110271337 13:73594237-73594259 AGAGAGAGAGAGAATGTGGCTGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110976186 13:81838485-81838507 AGAGAGTGGGAGAAGGGTGAGGG + Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111531479 13:89542431-89542453 AGAGAAAGAAAGCATGGGGAGGG - Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1111696035 13:91625524-91625546 AGAGAGTGGAAGAAGGGAGATGG + Intronic
1112026233 13:95413801-95413823 AGATAGAGGTAGATTGGGAAAGG + Intergenic
1112211782 13:97384948-97384970 GGAGAATGGGAGAATGGGGAGGG + Intronic
1112257603 13:97849352-97849374 AGTGAGAGAGAGAATGGGGCTGG - Intergenic
1112643423 13:101303392-101303414 AGAGAGAGGCTGAATTGTGATGG + Intronic
1112723327 13:102272191-102272213 TGAAAGAGGGAAAATGGGGAGGG - Intronic
1112867266 13:103920082-103920104 AGAGAGTGGCTGATTGGGCATGG + Intergenic
1113005832 13:105700812-105700834 AGAGAGAGGCAGGAAGGAAAGGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114004821 14:18300999-18301021 AGAGAGAGAGAGTATGGGAATGG + Intergenic
1114066589 14:19064430-19064452 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1114095677 14:19335593-19335615 AGATAGAGGGGGAATGGGGAAGG + Intergenic
1114350107 14:21841042-21841064 AGAAAGAGAGAGAATGGGAAGGG + Intergenic
1114529570 14:23387481-23387503 AGACAGCGGCAGAACAGGGATGG + Intronic
1115351337 14:32398807-32398829 AGAGAGAGGGAGAGAGGGGGAGG - Intronic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1116500827 14:45618852-45618874 AGAGAGAGGAAGAAGGGAGGAGG - Intergenic
1116762903 14:49037055-49037077 AGAGAGAAAAAGAATGGGAAAGG + Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1116983681 14:51196873-51196895 TGAGACAGGCAGAATAGGGAAGG - Intergenic
1117064244 14:51993852-51993874 AGAGAGAGGAAAGATGGGAAAGG + Intronic
1117471872 14:56054549-56054571 AGAGAGAGAGAGAAAGGGCAAGG - Intergenic
1117548773 14:56813255-56813277 AGAGAGAGGCAGACAAGGAAGGG + Intergenic
1117556618 14:56892987-56893009 GGAGAGAGGGAAAATGGGTAGGG - Intergenic
1117722801 14:58643818-58643840 TGGGAGAGGAAGGATGGGGAAGG + Intronic
1117730798 14:58719978-58720000 AGAAAGAGGAAAAATGGAGAAGG + Intergenic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1118083672 14:62390874-62390896 AGAGAGAGGAAGGGTGGGTATGG + Intergenic
1118089570 14:62458225-62458247 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1118422330 14:65620678-65620700 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1118503274 14:66383600-66383622 AGAGAGAGGCTGACTGGGTTGGG + Intergenic
1118647749 14:67856174-67856196 GGAGAGAGGAAGAGTAGGGATGG - Intronic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1118892789 14:69923816-69923838 GGAGGGAGGCAGAATAGGGCAGG + Intronic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119068491 14:71555794-71555816 AGAGGGAGGCAGATGGGGAATGG + Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119399068 14:74349514-74349536 AGGGAGAGGAAGAAAAGGGAGGG + Intronic
1119536996 14:75410589-75410611 GCAGAGTGGCAGAATGGGTAGGG + Intergenic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120095415 14:80382397-80382419 AGAGAGAGCTAGAAAGGGCACGG + Intronic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120454073 14:84709159-84709181 AGACAGACACAGAATGGGAAAGG + Intergenic
1120811710 14:88810568-88810590 AGGGAGAGGAAGAATGGTAAAGG - Intergenic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121005011 14:90484518-90484540 AGAGAGAGGTAGGAATGGGAAGG - Intergenic
1121031090 14:90659306-90659328 GGAGAAAGGGAGAATGGGGAAGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121108645 14:91297049-91297071 CGGGAGAGGCACAGTGGGGACGG - Intronic
1121188878 14:92005795-92005817 AGATAGAGGCAGAATTGTGTTGG - Exonic
1121417823 14:93791042-93791064 AGAGATAGTGAGAAAGGGGAGGG + Intergenic
1121657572 14:95608585-95608607 AGACACAGGAAGAATGGTGATGG - Intergenic
1121697961 14:95928341-95928363 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
1121709104 14:96024045-96024067 AGAGATAGGCTGAGTGGGGGAGG - Intergenic
1121714118 14:96060596-96060618 GGAGAAAGACAGAGTGGGGAAGG - Intronic
1121726546 14:96156223-96156245 AGAGAGAGGGAGAAGAAGGAAGG + Intergenic
1121793851 14:96719802-96719824 AGAGAGAGAGAGAGTGGGGGTGG + Intergenic
1121833642 14:97073016-97073038 AGAGAAAGGCAGAAAAGAGAGGG - Intergenic
1121836026 14:97093138-97093160 GGAGAGAGGCTGGGTGGGGATGG + Intergenic
1121894968 14:97638297-97638319 AGAAAGAGAGAGAAGGGGGAAGG - Intergenic
1122013680 14:98774739-98774761 AGAAAAAGGCAGATTGGGGAAGG - Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122448250 14:101783205-101783227 AGAGAGGGGGAGAAAGGGGGGGG - Intronic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1123049627 14:105534734-105534756 AGAGGGAGGCAGACGGGGGCAGG + Intergenic
1123062865 14:105602078-105602100 AGAGAGAGTTTGAAGGGGGAGGG - Intergenic
1202830218 14_GL000009v2_random:19817-19839 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1123428216 15:20190576-20190598 AGAGAGAGACAGAGTGGAGGAGG - Intergenic
1123941923 15:25220899-25220921 TGAGTGAGGCAGCATGGGGTTGG + Intergenic
1124345241 15:28917922-28917944 AGAAAGGAGCAGAATGGGGCGGG - Intronic
1124442547 15:29697676-29697698 GGAGAGTGTCAGAATGTGGAAGG + Intergenic
1124647658 15:31450396-31450418 AGAGAGAGGCTTAAGGGGGAAGG + Intergenic
1124804412 15:32867154-32867176 AGAGAGAGGCAGGGTGGATATGG - Intronic
1125285682 15:38090175-38090197 AGAGAGAGACAGAATGAAGCGGG - Intergenic
1125425276 15:39542592-39542614 AGAGGAAGGCAGAAGGGAGAGGG - Intergenic
1125431533 15:39599530-39599552 AGAGAGAGAAAGAAGGAGGAGGG - Intergenic
1125512947 15:40302653-40302675 AGAGAGAGCCACACTGGGCAGGG - Intronic
1125516160 15:40322593-40322615 AGAGAGCGGAAGGAGGGGGAGGG + Intergenic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1125955799 15:43790371-43790393 AGAGAGAGGCAGACAGGGAGAGG + Intronic
1126224157 15:46250460-46250482 AGAGAGAGACAGAGAGAGGAGGG + Intergenic
1126268064 15:46778322-46778344 AGAGAGAGCCACAATGGAGTAGG + Intergenic
1126325428 15:47471986-47472008 AGAGAGAGAGGGAAGGGGGAAGG + Intronic
1126475838 15:49064104-49064126 AGAGAGTGGCAAAATGGGGAAGG - Intergenic
1126477488 15:49080455-49080477 AGAGAGAGAGAGAAAGGGAAAGG - Intergenic
1126716816 15:51526159-51526181 AGAGAGAGAAAGAAGGGGGGTGG + Intronic
1126718019 15:51542882-51542904 AGTGAGAGGCAGTATTGGGGAGG - Intronic
1126860424 15:52877573-52877595 AGAGAGATGGAGGAAGGGGAGGG - Intergenic
1127309163 15:57737239-57737261 AGAGAGAGGAAGAGTGAGAAAGG - Intronic
1127381956 15:58438229-58438251 GGAGAGAGGCAGAAAGAGGCTGG + Intronic
1127572816 15:60261009-60261031 AGAGATAGCCAGATTGGGGAGGG + Intergenic
1127724660 15:61737302-61737324 AGAGAGAGGGAGGCTGGTGATGG - Intergenic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1127907572 15:63387637-63387659 AGACAGAGGCAGAGAGGGAAGGG + Intergenic
1128054857 15:64691963-64691985 AGAGAGAGCCAGGATGGGGTGGG - Intronic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1128575573 15:68772249-68772271 ACAGAGGGGCAGAATGGGAGTGG - Intergenic
1128676761 15:69615449-69615471 AGACAGAGCCTGAATTGGGAGGG + Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128759476 15:70206106-70206128 TCAGAGAGGAAGGATGGGGAAGG + Intergenic
1128825636 15:70713330-70713352 AGAGCGAGAAAGAATAGGGAAGG + Intronic
1128925968 15:71656476-71656498 AGAGAGATACATAATGGGGTTGG + Intronic
1129238442 15:74237637-74237659 AGAAAGAGGCTTAATGGGGAGGG - Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129681800 15:77662352-77662374 AGAGGGAGGAAGGATGGGGTTGG + Intronic
1129698474 15:77754155-77754177 AGAGTGGGGCAGAAGGGAGAGGG + Intronic
1129849516 15:78784393-78784415 AGGGAGAGGAAGAGGGGGGAGGG + Intronic
1129905262 15:79182793-79182815 AGAGAAAGGAAGGAAGGGGAGGG - Intergenic
1129973460 15:79801106-79801128 AGAGAGAGAGAGGATGGGGAGGG - Intergenic
1129990104 15:79954718-79954740 AAAAAGAGGGAGTATGGGGATGG + Intergenic
1130028221 15:80288334-80288356 AGAGAGAGAGAGAAAGAGGAGGG + Intergenic
1130047073 15:80453796-80453818 AGAGAGAGGAGGAATGGGGGTGG + Intronic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130540717 15:84819067-84819089 AAAACCAGGCAGAATGGGGAGGG + Intronic
1130721002 15:86386050-86386072 GGAGAGAGGGAGGAGGGGGAGGG - Intronic
1130726661 15:86446001-86446023 AGAGGGAGGAAGAATGAAGAAGG + Intronic
1130859528 15:87874268-87874290 AGAGAGGGGCAGAGCAGGGAAGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131641526 15:94298874-94298896 AGAGAGAGAAAGAGGGGGGAGGG - Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1131995606 15:98129994-98130016 AGATAGAGGCAGAATAGGGTGGG + Intergenic
1132092528 15:98957752-98957774 AGAGAAAGGGAGAACAGGGAAGG - Exonic
1132212708 15:100036212-100036234 GCAGAGAGGCAGCAAGGGGAAGG + Intronic
1132820502 16:1865585-1865607 AGAGAGAGAGAGAATGTGGGAGG + Intronic
1132868249 16:2104292-2104314 AGAGAGATGGAGAAAAGGGATGG + Intronic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133417296 16:5616569-5616591 AGGGAGAGGGAGAAGGGAGAGGG - Intergenic
1133421492 16:5650694-5650716 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
1133485579 16:6215312-6215334 AGAGAGAGACAGAGAGGGGAGGG + Intronic
1133526121 16:6607479-6607501 AGAGAGAGGAAGAAAGAGTAAGG - Intronic
1133826736 16:9284680-9284702 AGAGAGAGACAGGAAGGGAAGGG - Intergenic
1133870033 16:9677473-9677495 GGAGAGAGAGAGAGTGGGGAGGG + Intergenic
1134012762 16:10867473-10867495 AGAGACAGGGAGAAAAGGGAGGG + Intergenic
1134168310 16:11948082-11948104 AAAGGGAGGCAGAGTGGGGGTGG + Intronic
1134326916 16:13215865-13215887 AGAAAGTGGCAGGATGTGGAAGG - Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134506220 16:14809425-14809447 AGAGAGAGGCAGTAGAGGAAAGG + Intronic
1134523517 16:14928805-14928827 AGAGAGATGGAGAAAAGGGATGG - Intronic
1134549375 16:15132115-15132137 AGAGAGATGGAGAAAAGGGATGG + Intronic
1134574332 16:15319339-15319361 AGAGAGAGGCAGTAGAGGAAAGG - Intergenic
1134596288 16:15498623-15498645 AGAGAAAGGAAGAAAGAGGAAGG + Intronic
1134711111 16:16327289-16327311 AGAGAGATGGAGAAAAGGGATGG - Intergenic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134728085 16:16436959-16436981 AGAGAGAGGCAGTAGAGGAAAGG + Intergenic
1134799627 16:17071801-17071823 AGAGAGGGGAGGAAAGGGGAGGG - Intergenic
1134834033 16:17346524-17346546 AGAGAGGGGAAGAGTGGGGTTGG - Intronic
1134939351 16:18274867-18274889 AGAGAGAGGCAGTAGAGGAAAGG - Intergenic
1134948463 16:18341294-18341316 AGAGAGATGGAGAAAAGGGATGG + Intergenic
1134955721 16:18381404-18381426 AGAGAGATGGAGAAAAGGGAGGG + Intergenic
1135160475 16:20090769-20090791 AGAGGGAGGGAGAAGAGGGAGGG - Intergenic
1135616397 16:23914472-23914494 TGGGAGAGGCAGAATGGTGTTGG + Intronic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1135713249 16:24736525-24736547 AGAGAGAAGCAGAAAAGGGCAGG - Intronic
1135964037 16:27021300-27021322 AGTGAGAGGAAGGATGGGGGAGG - Intergenic
1136143733 16:28303140-28303162 AGAGGGAGGCAGAATATGGGGGG + Intronic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1136749420 16:32619865-32619887 AGAGAGAGACAGACTGCAGAAGG - Intergenic
1136776386 16:32874015-32874037 AGAGCTAGGCAGAAAGGGGCTGG + Intergenic
1136894229 16:33987497-33987519 AGAGCTAGGCAGAAAGGGGCTGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137465261 16:48702703-48702725 AGAGAGAGAAAGAAGGGGGAGGG - Intergenic
1137486490 16:48895623-48895645 TGAGAAAGGCAGGATGGGGCAGG + Intergenic
1137678014 16:50313733-50313755 AGAGGGAGACAGTGTGGGGACGG + Intronic
1137869870 16:51939786-51939808 AGAGAGAGCCAAGATGGGGGAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137977270 16:53042328-53042350 GGGGAGAGGCAGAATGGGAGAGG - Intergenic
1138119099 16:54383915-54383937 AGAGAGAGAGAAAAAGGGGAAGG - Intergenic
1138350978 16:56346064-56346086 AGAGAAAGGCAGGCTGGGGATGG - Exonic
1138487097 16:57352781-57352803 AGGGAGAGGGGTAATGGGGAGGG + Intergenic
1138755275 16:59476502-59476524 AGAGAGAGACAGAGAGGGGAGGG - Intergenic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1138918163 16:61493696-61493718 TGAGAGAAGCAGATTGGAGAGGG + Intergenic
1139006591 16:62578835-62578857 GGAGAGAGAGAGAAAGGGGAAGG + Intergenic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139147479 16:64341688-64341710 AGAGAGAGGAAGGAAGGAGAGGG - Intergenic
1139350311 16:66330919-66330941 AGAGGGAGAAATAATGGGGAAGG + Intergenic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139495587 16:67314859-67314881 AGAGAGAGAGAGAGAGGGGAAGG + Intronic
1139577511 16:67851185-67851207 AGAGAGACACAGAATAGGCAGGG + Intronic
1139815076 16:69663108-69663130 AGAGAGAGGTAGAAAAGGAAAGG + Intronic
1139954633 16:70687185-70687207 TGAGAAAGGCAGATTGGGGAAGG + Intergenic
1140056287 16:71528619-71528641 AAAGAGAGAGAGAATGGGGTTGG - Intronic
1140137565 16:72221024-72221046 AGAGAGAGCAAGGGTGGGGAAGG + Intergenic
1140509659 16:75497893-75497915 GGAGGGAGGAAGAATAGGGAGGG - Intergenic
1140766883 16:78168228-78168250 AGGAAGAGGAAGAATGGGCAGGG - Intronic
1140871479 16:79110611-79110633 CAAGAGAGACAGAGTGGGGACGG - Intronic
1141019312 16:80480024-80480046 AGACAGAGGCAGAGATGGGAGGG + Intergenic
1141141664 16:81500416-81500438 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141201931 16:81904848-81904870 AGAGAGTGGCAGGATAGGAAGGG + Intronic
1141603085 16:85137839-85137861 AGAGAAAGGCAGGAGGGGCAAGG - Intergenic
1141825885 16:86480136-86480158 AGAGGGAGGGAGGGTGGGGATGG - Intergenic
1141927401 16:87178520-87178542 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141927409 16:87178553-87178575 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142395967 16:89831791-89831813 AGAGCCGGGCAGAAGGGGGAGGG - Intronic
1142446229 16:90140130-90140152 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1203078801 16_KI270728v1_random:1136124-1136146 AGAGCTAGGCAGAAAGGGGCTGG + Intergenic
1142461276 17:95333-95355 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1142899577 17:3003828-3003850 AGAGAGGCGCACAATGAGGATGG + Intronic
1142968089 17:3593443-3593465 AGGGAGGGGAAGCATGGGGATGG - Intronic
1143008264 17:3851303-3851325 GGAGAGAGGGAGAATGGAGAAGG - Intergenic
1143018943 17:3906478-3906500 AGAAACACTCAGAATGGGGATGG + Intronic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143157565 17:4848038-4848060 AGAGAGAGGAAGAAGGAGGGAGG + Intronic
1143366500 17:6412169-6412191 AGAGAGAGGAAGGAAGGGAAGGG + Intronic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143457622 17:7078124-7078146 AGAGAGTGTCAGGATGAGGAGGG + Intronic
1143478912 17:7217626-7217648 GGAGAGAGGAAGCAGGGGGAGGG + Intronic
1143487799 17:7264091-7264113 AGAGAGAGCCAGAATAAGCAGGG - Intergenic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1143987749 17:10929793-10929815 GGAGAGAGGCAGGTTTGGGAGGG + Intergenic
1144027186 17:11287681-11287703 AGAGAGAGAGAGAAAGGGGAAGG + Intronic
1144217646 17:13070479-13070501 AGAGAGAGAAAGAAAGGGGGGGG + Intergenic
1144508582 17:15855842-15855864 GGAGAGTGGTAGAATGGGGAGGG - Intergenic
1144539702 17:16128840-16128862 AGAAGGAGGCATAATGTGGATGG - Intronic
1144733247 17:17540648-17540670 GGAGAGGGGCAGCATGGGGAGGG - Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145172704 17:20673482-20673504 GGAGAGTGGTAGAATGGGGTGGG - Intergenic
1146187193 17:30731747-30731769 AGAGAGGGGAGGAAAGGGGAAGG - Intergenic
1146297152 17:31659158-31659180 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297162 17:31659184-31659206 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297170 17:31659204-31659226 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146411865 17:32592969-32592991 AGAGTGAAGCAGAGTGGGGTGGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146555949 17:33824110-33824132 AGGGAGAGGAGCAATGGGGATGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146589948 17:34120312-34120334 AGAGAGAGGCAGAGGTGGGATGG - Intronic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1146833830 17:36093875-36093897 AGAGAGAGTCAGAAGTGTGATGG + Intergenic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147398221 17:40161885-40161907 GGAGAGAGGCAAAGTGGGGACGG + Exonic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147459068 17:40557091-40557113 AGAGAGAGGCAGAGAGGTGGGGG - Intronic
1147630131 17:41924856-41924878 AGAGAGAGTCAGAATGGAGTGGG - Intronic
1147761736 17:42802253-42802275 AGAGAGAGGTTAAAAGGGGAGGG + Intronic
1148193509 17:45697061-45697083 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1148281915 17:46354980-46355002 AGAGAGAGACAGAGATGGGAGGG + Intronic
1148304140 17:46572919-46572941 AGAGAGAGACAGAGATGGGAGGG + Intronic
1148548123 17:48532217-48532239 AGAGAGTGGGAGAATCGGGGTGG + Intergenic
1148554705 17:48571410-48571432 AGTAGGAGGGAGAATGGGGAGGG + Intronic
1148602077 17:48901778-48901800 AGAGAGAGGGAGACGGGGGCGGG - Intergenic
1148638184 17:49165297-49165319 AGAGAAAGAGAGAGTGGGGAGGG - Intronic
1148638249 17:49165585-49165607 AGAGAAAGAGAGAGTGGGGAGGG - Intronic
1148741784 17:49897267-49897289 AGAGAGAGAAAGAATGGGGAAGG + Intergenic
1148781034 17:50122105-50122127 AGAGAGATGGAGCATAGGGATGG - Intronic
1148805952 17:50264169-50264191 AGAGGGAGGGAGAGTGGGGAAGG + Intergenic
1148806399 17:50266208-50266230 AGAGAAAGGGAGAAAGTGGAAGG - Intergenic
1148810308 17:50286059-50286081 GGAGAGAGGAAGAAAGGGAAGGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150327035 17:64265457-64265479 AGAGAGAGAGAGAAAGGGTAGGG + Intergenic
1150551568 17:66215463-66215485 AGAGTGAGGCAGATTTGCGAGGG - Intronic
1150572396 17:66398530-66398552 GGAGAGAGTAAGATTGGGGAAGG + Intronic
1150638756 17:66934953-66934975 AGAGAGAGGGAGCATGTGCAGGG + Intergenic
1150689591 17:67353305-67353327 AGAGAGAGGGAGCGGGGGGAAGG - Intronic
1150707088 17:67496872-67496894 AGAGAAGGGCAGAATTGGGAGGG - Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150796671 17:68243882-68243904 AGTGAAGGGCAGAATTGGGAGGG + Intergenic
1150828960 17:68501447-68501469 AGAGAGAGAGAGAATGCTGAGGG - Intergenic
1151133648 17:71924389-71924411 AGAGAGAGGAAGGAAGGAGAAGG + Intergenic
1151377683 17:73702326-73702348 AGAGAGAGAGAGACAGGGGAAGG + Intergenic
1151429830 17:74055001-74055023 AGAGAGAGGGAGAAAGGGAAAGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151859051 17:76745682-76745704 AGAGGGAGGGAGATGGGGGATGG - Intronic
1152274196 17:79344873-79344895 GGACAGAGGCAGATTGGGGTGGG - Intronic
1152360728 17:79832047-79832069 CGAGAGAGCCAGTGTGGGGAAGG - Intergenic
1152486155 17:80594993-80595015 AGAGAGAGGGAGAAAGAGAATGG + Intronic
1152786008 17:82248482-82248504 AGAATGAGGAAGAATGAGGAAGG + Intronic
1152829580 17:82488957-82488979 AGAAAGAGCCAAAATGGGCAGGG - Exonic
1153450425 18:5221222-5221244 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1153540585 18:6149840-6149862 AGAGAAAGAGAGAAGGGGGATGG - Intronic
1153980129 18:10301707-10301729 TCAGAGAGGGAGAATGGTGAAGG - Intergenic
1154041457 18:10860026-10860048 GGAGGGAGGCAGATTGGAGACGG + Intronic
1154946483 18:21166682-21166704 AGAGAGAGAGAGTTTGGGGAAGG - Intergenic
1155048964 18:22130007-22130029 AGAGAGAGAAAGAAAGGGAAGGG - Intergenic
1155064266 18:22255108-22255130 AGGGAGAGGCAGTCTGGGAAGGG - Intergenic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155364182 18:25033849-25033871 AGAGAGAGGGAGAGAGGGGGGGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155767091 18:29649472-29649494 AGACAGACACAGAATGGAGAAGG - Intergenic
1155806464 18:30176180-30176202 AGAGAGAGGTGGAAGGGGCACGG + Intergenic
1155958259 18:31972340-31972362 AGAGAGGGGGAAAATGGAGAGGG - Intergenic
1156016752 18:32555401-32555423 AGAAAGAGGTAGGATGGGTAAGG - Intergenic
1156149607 18:34225349-34225371 AGAGAGGGGGAGAAAGGAGATGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156545551 18:37960611-37960633 AGAAAGTTGCAGGATGGGGAGGG + Intergenic
1156546110 18:37965216-37965238 AGAGAGAGAGAGAAAAGGGATGG - Intergenic
1156723856 18:40103755-40103777 AGAGAGAGGAAGAATGGAAAAGG - Intergenic
1156889871 18:42178382-42178404 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157011131 18:43650242-43650264 GGAGAGAGGAAGGATGGAGAAGG + Intergenic
1157323332 18:46650693-46650715 AGTGTGAGGGAGAATGGGGGAGG + Intronic
1157392500 18:47314587-47314609 AGAGAGAGGGAGAGAGGGGGGGG - Intergenic
1157502113 18:48198609-48198631 AGAGGGAGGCAATATGGGAAGGG - Intronic
1157723501 18:49944774-49944796 AGAGACAGGCTGAACAGGGAGGG - Intronic
1157976534 18:52334119-52334141 AGAGAGAGGCAGAGTAAGAAAGG - Intergenic
1158001068 18:52619826-52619848 AGAGAGAGGGTGACTGGGGCTGG - Intronic
1158219312 18:55133827-55133849 AGAGAGAGGCAGAAGAGTGAAGG + Intergenic
1158576862 18:58645500-58645522 AGAGATACGGAGAAGGGGGATGG + Intergenic
1158648965 18:59269709-59269731 AGAGAGAGAGAGAAAGGGGATGG - Intronic
1158951516 18:62499578-62499600 AGAGGAAGGAAGAAGGGGGAAGG - Intergenic
1159127809 18:64245513-64245535 AGATAGAGACAGAGAGGGGATGG + Intergenic
1159207057 18:65266408-65266430 AGAGAGAGAAAAAAAGGGGAAGG + Intergenic
1159402427 18:67955517-67955539 AGAGAGAGAGAGAAAGGGGGAGG + Intergenic
1159502998 18:69298083-69298105 AGGGAAAGGAAGAATGGGGGAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159916993 18:74196954-74196976 AGGGACAGGCAGCATGGGTAAGG + Intergenic
1160037567 18:75315904-75315926 AGAGAGAGCGAGAAAGAGGAAGG - Intergenic
1160172547 18:76566960-76566982 AGAGAGAGACAGGTAGGGGAAGG - Intergenic
1160341041 18:78088927-78088949 AGAGAGAGGAAGATTGGGAGAGG + Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160650977 19:227700-227722 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1160849005 19:1180713-1180735 GGAGAGAGGCAGGAGGGGAAGGG - Intronic
1160950454 19:1664401-1664423 AGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1160951524 19:1669846-1669868 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1160951540 19:1669907-1669929 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161845571 19:6710100-6710122 AGAGAGAGGGAGAGTGAGGGGGG + Intronic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1161914645 19:7219459-7219481 AGAGAGAGAGAGAAAAGGGAGGG + Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162153463 19:8661146-8661168 AGAGAGAGAGAGAAAAGGGAAGG - Intergenic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163101415 19:15099292-15099314 AGAGAAAGAAAGAAAGGGGAAGG + Intergenic
1163206054 19:15803472-15803494 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic
1163274726 19:16276357-16276379 AGAGAGAGAGAGACTGGGCATGG - Intergenic
1163378449 19:16948800-16948822 AGAGAGGGGAAGAGAGGGGAAGG + Intronic
1163455446 19:17403577-17403599 AGAGAGAGGCTGCAGGGGAAGGG - Intronic
1163621944 19:18366182-18366204 AGACAGGGACAAAATGGGGAAGG + Exonic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1164072987 19:21786293-21786315 AGAGATAGTGAGAAGGGGGATGG + Intergenic
1164753180 19:30670948-30670970 AGGGATGGGCAGAATGGGGTGGG - Intronic
1164770965 19:30808620-30808642 AGAGAAAGGCAGAGTTGGGATGG + Intergenic
1165001189 19:32763834-32763856 AGAGAGACTCAGAATGGACAGGG - Intronic
1165363845 19:35352092-35352114 AGAGAGAGGCTGAAGCGGGCCGG - Exonic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165774932 19:38398945-38398967 AGAGCTGGGCAGAGTGGGGAGGG - Intergenic
1165913538 19:39244318-39244340 GGAGAGAGGGACAATGGAGAAGG + Intronic
1166095660 19:40537428-40537450 AGAGAGAATGAGAATGGTGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166109538 19:40613792-40613814 AGCGTGAGGCAGGTTGGGGAAGG + Intronic
1166264826 19:41673197-41673219 AGAGAGAGGCGGAAGGGTCAGGG + Intronic
1166300194 19:41908558-41908580 AGAGGGAGGCAGCTTGGGGAAGG + Intronic
1166300668 19:41910404-41910426 ACAGTGAGGAGGAATGGGGAGGG + Intronic
1166343635 19:42152428-42152450 AGAGAGAGGGAGAGAAGGGAGGG - Intronic
1166399385 19:42466888-42466910 AGAGGCAGGCAGAACAGGGAGGG - Intergenic
1166505370 19:43368238-43368260 AGAGAGAGGCAGAGAGGAAAGGG - Intergenic
1166778721 19:45328422-45328444 AGAGAAAGGAGGAATGGGCAGGG - Intergenic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167103649 19:47418774-47418796 ACAGAGAGGCAGAAAGGAGGAGG + Intronic
1167271414 19:48508656-48508678 AGTGAGAGGCAGGATGGTGGAGG - Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167471769 19:49679616-49679638 AGAGAGGGGCAGCGTGGGGGTGG + Intronic
1167551606 19:50165064-50165086 AGAGAGAGGCAGAGTAGGAGAGG + Intergenic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167680224 19:50915340-50915362 AGAGAGAGACAGACAGGAGAGGG + Intergenic
1167752912 19:51391180-51391202 AGAGAGAGAGAGAAGGGGGCAGG - Intergenic
1167867083 19:52337146-52337168 GGAGAGGGGCAGAAAGGGGGAGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1167958877 19:53090246-53090268 GGAGAGGGGCAGAAAGGGGGAGG - Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168132172 19:54328548-54328570 AGAGAGAGGCAGGATGGGTGAGG + Intergenic
1168203274 19:54832818-54832840 AGAGGGAGGGAGCGTGGGGATGG + Intronic
1168205839 19:54850529-54850551 AGAGGGAGGGAGAGTGGGGATGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168514629 19:57001271-57001293 AGAGAGAGCGAGACAGGGGAGGG + Intergenic
1168519858 19:57040896-57040918 AGAGGGAGGCAGAAAAGAGAAGG + Intergenic
1168670683 19:58238907-58238929 AGGGACAGGCAGAACAGGGAGGG + Intronic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
1202642473 1_KI270706v1_random:107955-107977 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925350043 2:3194682-3194704 AGAGAGAGAGAGAAAGGGGGGGG + Intronic
925422451 2:3723940-3723962 AGAGAGACAGAGAAGGGGGAAGG - Intronic
925524941 2:4788959-4788981 AGAGAGAGAGAGAGTGAGGAGGG + Intergenic
925615394 2:5740487-5740509 AGCCAGAGGCAGAATGGGTAAGG - Intergenic
925704826 2:6674381-6674403 AGGGAGATGCAGCATTGGGAGGG + Intergenic
925957051 2:8977040-8977062 AGGGAGAGGCAGGAGGGAGACGG + Intronic
926062965 2:9815575-9815597 AGAGAGAGGGAGACTCGAGACGG - Intergenic
926067655 2:9857060-9857082 AGAGAGGGGGACACTGGGGAAGG + Intronic
926143174 2:10380644-10380666 AGAGAAAGAGAAAATGGGGAGGG - Intronic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926491572 2:13531516-13531538 AGAGAGAGAAAAAAAGGGGAGGG - Intergenic
926557351 2:14374558-14374580 GGAGAGGGGGAGGATGGGGAGGG + Intergenic
926590071 2:14731175-14731197 CAAGAGAGGCAGAATGGAGCCGG + Intergenic
926744431 2:16139229-16139251 AGAGAGAGGAAGAAAGGAGCTGG + Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
926931129 2:18042131-18042153 AGAGAGTGGGGGAATGGGAATGG - Intronic
926969565 2:18453179-18453201 GGAGAAAGGCAGCAAGGGGAGGG + Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927345634 2:22035606-22035628 AGAGAGAGCCAGAAGGGAAAAGG - Intergenic
927372165 2:22368809-22368831 ACAAAGAGAGAGAATGGGGAGGG + Intergenic
927414120 2:22858976-22858998 AGAGAAAGGAGGGATGGGGACGG - Intergenic
927574136 2:24187052-24187074 AGAGAAAGGCAAAATGTTGATGG - Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928191938 2:29178738-29178760 AGAGATAGGAAGTATTGGGAAGG - Intronic
928379046 2:30802528-30802550 AGAGAAAGGCAGGCTGGGGGGGG + Intronic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929049222 2:37820903-37820925 AGAGAGAGAGAAAAAGGGGAGGG - Intergenic
929285200 2:40127746-40127768 CCAGAGAGGCAGGATGGGGTGGG + Intronic
929379966 2:41337928-41337950 AAAGAGAGTCAGAATAAGGAAGG + Intergenic
929407219 2:41656602-41656624 AGAGAGAGAGAGAATGGAGGAGG - Intergenic
929973662 2:46609694-46609716 AGAGAGAGGGAGGGTGGGGAAGG + Intronic
930021702 2:47005582-47005604 AGAGAGAGGAACATTGAGGAAGG + Intronic
930826536 2:55701372-55701394 AGAGAGAGGCAGAGAGGGAGGGG + Intergenic
930927630 2:56838530-56838552 AGAGAGAGAGAGCATGGGGAGGG + Intergenic
930946217 2:57079230-57079252 AGAGAGAGAGAAAAGGGGGAGGG - Intergenic
931254680 2:60559638-60559660 AGAGAGAGGCATATAGGTGAAGG - Intergenic
931546997 2:63399588-63399610 AGAGAGAGGAAGAAGGGCGGGGG + Intronic
931664989 2:64604035-64604057 AGAGGGAGGGAGAAGGGGAAGGG - Intergenic
931707465 2:64959100-64959122 AGAGAGAGAGAGAGTGGTGATGG - Intergenic
931767432 2:65469416-65469438 AGAGAGAGAGAGAGCGGGGAGGG - Intergenic
932095315 2:68842340-68842362 AGAGACGGTCAGATTGGGGAGGG - Intergenic
932362751 2:71122581-71122603 AAAGAGAGACAGATTGGGCAGGG + Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
933158849 2:79002416-79002438 AGAGAGAGCCAGTAGGGGGAAGG + Intergenic
933354557 2:81196216-81196238 AGAGAGAGGCGGAAAGGGGGGGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933710303 2:85320372-85320394 AGAGAGAAGCAAAATGGGCTGGG + Intronic
934118037 2:88814098-88814120 AGAGAGAGGAAAACTGGGGTGGG + Intergenic
934245083 2:90298623-90298645 AGAGAGAGAGAGAAAAGGGAAGG + Intergenic
934263659 2:91498406-91498428 AGAGAGAGAGAGAAAAGGGAAGG - Intergenic
934485840 2:94709048-94709070 AGAGAGAGAGTGAAGGGGGAGGG + Intergenic
934526588 2:95055910-95055932 AGACAGAGGCAGAGAGGTGAGGG - Intergenic
935028621 2:99301428-99301450 AGAGAGAGTGAGAAGGGGAAGGG + Intronic
935029366 2:99307077-99307099 AGAGAGAGTGAGAAGGGGAAGGG - Intronic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
936060070 2:109289156-109289178 AGAGAGAGAGAGACAGGGGATGG - Intronic
936439132 2:112534958-112534980 AGAGAGAGGAAGAAAGAGAAAGG + Exonic
936578652 2:113676342-113676364 AGAGAGATAGAGAGTGGGGAGGG - Intergenic
936734564 2:115425899-115425921 AGAGCAAGGAAGAAAGGGGAAGG + Intronic
937032532 2:118752734-118752756 AGAGACAGGGAGAGTGGGCAAGG + Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937246925 2:120499583-120499605 AGAGAGAGGCCGAGGTGGGAAGG - Intergenic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938164147 2:129011453-129011475 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
938225475 2:129612241-129612263 AGAGAGAGAGAAATTGGGGATGG + Intergenic
938483980 2:131684558-131684580 AGATAGAGGGGGAATGGGGAAGG - Intergenic
938710892 2:133975525-133975547 AGAGTGGGGAAGAGTGGGGAAGG - Intergenic
938772547 2:134512716-134512738 AGAAAGAGGGAGAATGGTGAAGG + Intronic
938800557 2:134759613-134759635 AGAGGGAGAGAGAAAGGGGAGGG + Intergenic
938809036 2:134834751-134834773 AGAGAGAGAAAGAGAGGGGAGGG + Intergenic
938844431 2:135194358-135194380 AGAGAGAGAGAGAGTGGCGAGGG + Intronic
938860423 2:135362432-135362454 AGAGGAAGGCAGAAAGGAGATGG + Intronic
939011690 2:136854476-136854498 AGAGACAGGCCTGATGGGGAAGG - Intronic
939506054 2:143048453-143048475 AGAGAGAGAGAGAAAGAGGAGGG - Exonic
939702269 2:145407906-145407928 AGAGAAAGGCACATAGGGGAAGG + Intergenic
939737879 2:145872098-145872120 AGAGAGAGGAAGAAAGGGAAAGG + Intergenic
940112014 2:150165438-150165460 AAAGAGAGGTGGACTGGGGATGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940547815 2:155111917-155111939 AGAGAGAGAGAGATTGGGTAGGG + Intergenic
940736446 2:157458483-157458505 AGAAATGGGGAGAATGGGGAGGG - Intronic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941064698 2:160888787-160888809 AGAGAGAGGAAGATAGGAGAAGG + Intergenic
941378123 2:164756060-164756082 AGAGAGAGAGAGAATGAGGGAGG + Intronic
941381854 2:164802846-164802868 AGAGGGAGGAAGGAAGGGGAGGG + Intronic
941440364 2:165527969-165527991 AGAGAGAGAGAGAAAGGAGAGGG + Intronic
941673290 2:168318077-168318099 AGAGAGAGAGAGAAAGGAGAAGG - Intergenic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942784211 2:179682215-179682237 AGAGAGTCACAGAAAGGGGAAGG - Intronic
942832185 2:180250516-180250538 AGAGAGGGCAAGAATGGGGCAGG - Intergenic
942923927 2:181410458-181410480 AGAGAAAGACAGATTGAGGATGG - Intergenic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
943924215 2:193750800-193750822 GGAGAGAAGGAGAATGGAGAAGG - Intergenic
944260927 2:197676062-197676084 AGAGAGAGGCAGTAGGGGGGTGG + Intergenic
944512323 2:200476916-200476938 AGAGAGCTGGAAAATGGGGATGG + Intronic
944612495 2:201425762-201425784 AGAGAGAGAGAGAGTGAGGAGGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
944893635 2:204142511-204142533 AGAGCCAGGCAGAATAGGCAGGG - Intergenic
945114482 2:206397859-206397881 AGAAATAGGCAGAGTGAGGAGGG + Intergenic
945367815 2:208977920-208977942 AGAGAAAGACAGAAAGGGGAGGG - Intergenic
945462329 2:210123533-210123555 AGGGTGGGGGAGAATGGGGATGG + Intronic
945528593 2:210921797-210921819 AGAGAGAGAAAGTATTGGGAAGG + Intergenic
945766568 2:213987286-213987308 TGAGAAAGGCAGAATGAGGTAGG - Intronic
945834429 2:214822091-214822113 AGAGAGAGGGTGGTTGGGGAAGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946218922 2:218209538-218209560 GGAGAGAGAGAGAAAGGGGAAGG - Intergenic
946252306 2:218421178-218421200 GGTGAGAGGCAGCATGGGGGTGG + Intronic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946732029 2:222719304-222719326 AGAAGGAGGCAGAAAAGGGAAGG - Intergenic
946819987 2:223619582-223619604 TGAGAGAGGAAGACTGGGGCTGG + Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947082913 2:226419036-226419058 ACAGAGAGAGAGAATAGGGATGG + Intergenic
947139484 2:227008162-227008184 AGAGAGTGGCATCATGGGGAGGG + Exonic
947165216 2:227254940-227254962 AGAGAGAAGCAGAAGTGAGATGG - Intronic
947339019 2:229117494-229117516 AGAGAAAGGAAGGATGGAGAAGG - Intronic
947384222 2:229575191-229575213 AAAATGAGGCAGAATGAGGAAGG + Intronic
947916347 2:233834257-233834279 AGAGAGGGGCAGTGTGGGGAAGG + Intronic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948635388 2:239331285-239331307 AGAAGGAGGCAGGATGGGGGAGG + Intronic
948815838 2:240510053-240510075 AGGGAGGGCAAGAATGGGGAAGG - Intronic
948989212 2:241543515-241543537 AGAAAGAGGGAGAAGGGGAAGGG - Intergenic
1168771135 20:417698-417720 AAAGAGAGGGAGAGTGGGAAGGG - Intronic
1168799858 20:637471-637493 AGAGAAGGGCAGCCTGGGGAGGG - Intergenic
1168987903 20:2066154-2066176 CCAGACAGGGAGAATGGGGAAGG + Intergenic
1169541089 20:6600496-6600518 AGAGAAAAGCAGAAGGGGGTAGG + Intergenic
1169641604 20:7758425-7758447 AGGGGTAGGGAGAATGGGGAGGG - Intergenic
1170040371 20:12033896-12033918 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1171145733 20:22780529-22780551 AGAGAGAAGCAGCATGGTCAAGG - Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171177946 20:23068262-23068284 AGAGGGAGGGTGAGTGGGGAAGG - Intergenic
1171232636 20:23499975-23499997 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1172114024 20:32563167-32563189 GGAGGGAGGGAGAGTGGGGAGGG + Intronic
1172171687 20:32939251-32939273 AGAGAGAGAGAGAATATGGAAGG - Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1172292172 20:33784228-33784250 AGAGGGAGGGAGATGGGGGAGGG - Intronic
1172504296 20:35450005-35450027 AGAGAGAGAGAGAATGGGCCGGG + Intronic
1172897713 20:38312224-38312246 AGAGGGAGGCAGAAAGAGAATGG - Intronic
1173067814 20:39729756-39729778 AGAGAGAGAGAGACAGGGGAGGG - Intergenic
1173136585 20:40444081-40444103 AGAAAGACCCAGAATGGGGTGGG - Intergenic
1173143227 20:40502959-40502981 AGAGAGAGAGATAAAGGGGAGGG + Intergenic
1173254901 20:41387306-41387328 ATAGACAGGCAGCTTGGGGAGGG + Intergenic
1173283449 20:41649468-41649490 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173335971 20:42112672-42112694 TGAGAGAGCCAGGATGGGGTGGG - Intronic
1173443141 20:43095684-43095706 AGAGAGAGGAAGCAGGGAGAGGG - Intronic
1173580570 20:44143912-44143934 AGAGAGAGACAAATAGGGGATGG + Intronic
1173590236 20:44219396-44219418 AGAGAGAGAGAGAAGGGGGGTGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173804846 20:45917797-45917819 AGGGACAGGCTGAGTGGGGAAGG - Intergenic
1173806431 20:45928581-45928603 AGAGAGAGAGAGACTGGGCATGG + Intergenic
1174502597 20:50996648-50996670 GGAGGGAGGCAGGATGGGGCAGG + Intergenic
1175004704 20:55669923-55669945 AGAGAGAGAAAGAGTGGGAAGGG - Intergenic
1175145718 20:56894703-56894725 AGAGAGAGAGAGAAAGGGAAAGG - Intergenic
1175279079 20:57790736-57790758 AGAGGGAGACAGGATGGGGAGGG + Intergenic
1175597616 20:60247821-60247843 AGAGAGAGTGAGAAAGGAGAAGG - Intergenic
1175614887 20:60389544-60389566 AGAGAAAGGAAGAATGAGTATGG + Intergenic
1175674481 20:60934946-60934968 ACAGGGAGGCGGAAAGGGGAGGG - Intergenic
1175748070 20:61475495-61475517 AGAGAGAGGGAGAGGAGGGAGGG - Intronic
1175833041 20:61977514-61977536 TGAAAGTGGCAGAACGGGGAAGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1176609405 21:8864655-8864677 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1177046902 21:16182558-16182580 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1177953537 21:27568654-27568676 AGTGAGAGGCAGATATGGGATGG - Intergenic
1178088143 21:29133645-29133667 AAAGAAAGCTAGAATGGGGAGGG - Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178830401 21:36051572-36051594 ACAGAGAGGCAGAATAGGTGGGG + Intronic
1179147200 21:38778577-38778599 AGAGAGAGCAAGTAGGGGGAAGG - Intergenic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1180300327 22:11031955-11031977 AGAGAGAGAAAGAGAGGGGAGGG - Intergenic
1180340823 22:11616888-11616910 AGAGAGAGACAGTCTGGGCACGG - Intergenic
1180359500 22:11874502-11874524 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1180429335 22:15231789-15231811 AGAGAGAGAGAGTATGGGAATGG + Intergenic
1180485070 22:15787020-15787042 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1180583723 22:16866780-16866802 AGAGAGAGAAAGAACAGGGAGGG - Intergenic
1180727360 22:17956273-17956295 AGACAGTTGCAGAAAGGGGATGG + Intronic
1180751748 22:18129576-18129598 GGAGAGGGGCAAAGTGGGGAAGG - Intronic
1180958996 22:19754282-19754304 TGAGAGAGGCAGACATGGGATGG - Intergenic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181012956 22:20052926-20052948 AGAGACAGGAAGAGTGAGGAGGG + Intronic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181685156 22:24523087-24523109 ATAGAGATGCAGAAAGGGCAGGG + Intronic
1181786044 22:25227998-25228020 AGAGAGAGGGAGTAGGGTGATGG - Intronic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1181840964 22:25660366-25660388 AAAGGCAGGCAGACTGGGGAAGG - Intronic
1181977188 22:26738401-26738423 AGGGAGAGGGAGAAGGGGAAGGG - Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182103787 22:27674741-27674763 AGAGAAAGGGAGAAAGGGAAAGG - Intergenic
1182103812 22:27674917-27674939 AGAGGGAGACAGAATGGGAGAGG - Intergenic
1182111260 22:27725335-27725357 ACAGAGTGGCAGAGTGGGGCTGG - Intergenic
1182862166 22:33569651-33569673 AAAGAGGGGGAGAATGTGGATGG - Intronic
1183007645 22:34916630-34916652 GGAGGGAGGCAGAGAGGGGAAGG + Intergenic
1183097545 22:35562212-35562234 AGGGAAAGGCAGAGGGGGGAGGG + Intergenic
1183160608 22:36110556-36110578 AGCGGGAGGCAGATTGGGGTCGG + Intergenic
1183259929 22:36788127-36788149 TGAGAGAGGGAGAAGGAGGAAGG + Intergenic
1183270124 22:36856724-36856746 AGAGGGAGACAGAAAAGGGAGGG + Intergenic
1183337035 22:37255768-37255790 AGAGAGAGAAAGAAAAGGGAGGG + Intergenic
1183396924 22:37576947-37576969 AGAGACAGGCAGAACTGGGTGGG + Intronic
1183784907 22:40023666-40023688 AGAGAGCGGCAGCAGGGGCAGGG - Intronic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184048803 22:41989336-41989358 AAAGAGAGGCAGAATCTGCAAGG + Intronic
1184099835 22:42336290-42336312 AGAGAGAGGCTGTCTGGGGTGGG - Intronic
1184106282 22:42369177-42369199 AGAGAAAGGGAGAAGGGGGTGGG - Intergenic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184186552 22:42868884-42868906 AGAAACAGGCAGAACGGGGTTGG - Intronic
1184309347 22:43631164-43631186 ATCCAGAGGCAGAATGGAGATGG - Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1184886033 22:47345001-47345023 AGACAGAGGCAGATTCTGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185380598 22:50505990-50506012 AGAGAGAGGCAGACAGGGCTCGG - Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949332505 3:2937836-2937858 AGAGAGAGGAAGAGAGGGAAGGG + Intronic
949551500 3:5115968-5115990 AGAGAAAGGCAGAAGGGGAGGGG - Intergenic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
949647181 3:6109381-6109403 AGAGGGAGGGAGAAAGAGGAAGG - Intergenic
949758327 3:7439483-7439505 AGACAGAAGCAGCATGGGCAGGG - Intronic
950460564 3:13119895-13119917 TGAGTGAGGCAGAGTGTGGACGG - Intergenic
950739815 3:15041296-15041318 AGAGATACAAAGAATGGGGAGGG - Intronic
950776226 3:15352671-15352693 AGAGAGAGAGAGAATTGGGGAGG - Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951413014 3:22387959-22387981 AGAGAGAGGAAGAAAGGAGAAGG + Intergenic
951646213 3:24894269-24894291 AGAGAGAGGCAGGGCGGGGGCGG - Intergenic
951742688 3:25941795-25941817 AGAGAGGGGCAGAAAGAGAAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952554493 3:34516813-34516835 AGTGAGTGTAAGAATGGGGAAGG + Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953309392 3:41862792-41862814 AGAGAGAGAGAGAAAGGGGGGGG - Intronic
953312194 3:41890866-41890888 AGAAAGGGACAGAAGGGGGAAGG + Intronic
953550453 3:43898472-43898494 AACGTGAGGGAGAATGGGGAGGG + Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953575790 3:44112227-44112249 AGAGAGGAGGAGAATAGGGAGGG + Intergenic
953703752 3:45215907-45215929 TGAGGGAAGCAGAATGGGGCAGG - Intergenic
953973624 3:47366241-47366263 AAAGAGGGGCAGACTGGGCATGG - Intergenic
953987602 3:47457378-47457400 TGAGAGAGTCAGAATGAGCAAGG - Intronic
954411668 3:50373880-50373902 AGAGAGAGGCACCATGGGAAGGG + Intronic
955484391 3:59420938-59420960 AAAGAGAGGTAGAATGCTGAAGG - Intergenic
955501535 3:59589216-59589238 AAAGAGAGAGAGAATGGGAAAGG - Intergenic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
956111114 3:65870629-65870651 GGAGAGAGGCAGGGTGGGGGGGG + Intronic
956411454 3:68984199-68984221 AGAGAGAGAGAGAGAGGGGAGGG - Intronic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
957578755 3:82043505-82043527 AGAGAGAGTGAGAATGAGAATGG + Intergenic
957587949 3:82156945-82156967 AGAGAGAGACAAAAGGAGGAAGG - Intergenic
957756487 3:84494790-84494812 AGAGAGAGGGAGAAAGAGAAAGG - Intergenic
957875738 3:86144024-86144046 AGAGAGAGGCAGAGAAGGGATGG - Intergenic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
958080474 3:88740212-88740234 AGAAAGAGGAAGAAGGTGGAGGG - Intergenic
958168422 3:89907255-89907277 AGAGAGAGACAGATTGAGAAAGG - Intergenic
958945694 3:100359590-100359612 TGAGAGAGGCAGTATGAGCAAGG - Intergenic
959069248 3:101687264-101687286 TAAGAGAGGCAGAATGGGCCGGG - Intergenic
959105116 3:102056989-102057011 GGAGAAAGGGAGAATGGGGAAGG + Intergenic
959133296 3:102385254-102385276 TGGAAGAGGCAGAATGGGGGTGG - Intronic
959187736 3:103068088-103068110 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959346468 3:105201224-105201246 AGAGAGTGGCAGGGTGGGGAAGG + Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
960151438 3:114252655-114252677 AGAGAGAGAGAGAAGGGGGTGGG + Intergenic
960203824 3:114870874-114870896 AGAGACAGGAAAAATGAGGAGGG - Intronic
960259384 3:115548125-115548147 AGAAAAAGGCATAGTGGGGAGGG + Intergenic
960265712 3:115618725-115618747 ACAGGGACACAGAATGGGGAAGG + Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960633335 3:119755481-119755503 AGAGAGAGGGAGAATGGCAGAGG - Intronic
960949055 3:122987180-122987202 AGAGAGAGAGAGATTGGAGAGGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961175871 3:124834605-124834627 AGAGAAGGGAAGGATGGGGAGGG + Intronic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
961914210 3:130354097-130354119 AGAAAGAGAAAGAAAGGGGAAGG + Intronic
962003340 3:131323494-131323516 AAAGAGAGGAAGATGGGGGAAGG - Intronic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962297284 3:134202382-134202404 AGAGAAAGGGAGAATGATGAAGG + Intronic
962350706 3:134653602-134653624 AGAGGGAGACACCATGGGGAAGG + Intronic
962500383 3:135985320-135985342 AGAGAGAGAGAGAAAGGGAAAGG - Intronic
962826804 3:139106430-139106452 AGATGGAGGCAGAGTGGGGCAGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963387143 3:144611738-144611760 AGAGGGAAGCTGAGTGGGGAAGG - Intergenic
963607871 3:147427805-147427827 AGGAAGAGGCAAAAAGGGGAAGG - Intronic
963700107 3:148614946-148614968 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
964847075 3:161055766-161055788 AGAGAGAGAGAGATTGGGGAGGG - Intronic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965304928 3:167052185-167052207 AGAGTTAGGCACAATGGAGAGGG + Intergenic
965334615 3:167421004-167421026 AGAGAGAGACAGAAATGAGAAGG + Intergenic
965475210 3:169147767-169147789 AGAGAGAGAGAGATGGGGGATGG + Intronic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965599699 3:170442635-170442657 AGAGACAGCAAGAATGGAGAGGG - Intronic
965603487 3:170477281-170477303 GGAGAGAGGGAGAAGTGGGAAGG + Intronic
965610845 3:170542474-170542496 TGCAAGAGGCAGAATGGGGAAGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
965960660 3:174425034-174425056 AGAGACAGGCAGGATGGACAGGG - Intergenic
966377349 3:179309990-179310012 AGAGACAGGCAAAATGGGCAGGG - Intergenic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966405468 3:179592990-179593012 AAACGTAGGCAGAATGGGGAAGG - Intronic
966695350 3:182784647-182784669 AGAGAGGGGAAGATGGGGGAGGG - Intergenic
967149100 3:186631800-186631822 AGAGAGAGCTAGAAAGTGGAAGG - Intergenic
967153184 3:186668176-186668198 AGAGAGCGGGTGGATGGGGAGGG + Intronic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967732259 3:192917477-192917499 AGAGAGAGGCGGAACAGAGATGG + Intronic
967775064 3:193377785-193377807 AGACAGAGACAGACAGGGGAAGG - Intronic
967806109 3:193715873-193715895 AGAGAGAGTGGGAGTGGGGAGGG - Intergenic
967937017 3:194737152-194737174 AGAGAAAGGCAGGGTGGGGAGGG - Intergenic
967969957 3:194991415-194991437 AGAGAGAGACAGAAAGGGAGAGG - Intergenic
968366853 3:198192287-198192309 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
968612803 4:1564704-1564726 AGTGAGGGGCAGGATGGGGGAGG + Intergenic
968817432 4:2829275-2829297 ATAGGGAGGATGAATGGGGAAGG + Intronic
968941438 4:3640736-3640758 AGAGAGGGGCAGAGAGGGGGCGG + Intergenic
969163381 4:5281099-5281121 AGAGAGAGGGCAAAGGGGGAAGG + Intronic
969229198 4:5817921-5817943 AAAGTGAGACAGAATGGGCAAGG - Intronic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
969686835 4:8680282-8680304 AGAGAGAGACAGCAGAGGGAGGG + Intergenic
969928022 4:10603606-10603628 AGAAAGAGGCAGAATTGGGCAGG + Intronic
970015485 4:11507848-11507870 AGAAAGAGAGAGAGTGGGGAGGG + Intergenic
970097525 4:12480640-12480662 AGAGAGAGAGAGAATGGAGGAGG + Intergenic
970242305 4:14022218-14022240 AGAGGGAGGAAGATTGGGTAGGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970838689 4:20441506-20441528 AGAGAGAGACAGAAGTGGGGGGG - Intronic
970871243 4:20819432-20819454 AGAGAGAGGCAGAAATGGTCTGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971321337 4:25608301-25608323 AGAAAGAGGCAGAACTGGGCCGG + Intergenic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972574422 4:40338817-40338839 AGAGAGAGCGAGCACGGGGAGGG - Intronic
972727178 4:41755095-41755117 TGAGAGAGGAAGAATTGGGTAGG - Intergenic
972755226 4:42039764-42039786 AGATAGAGGGAAAAAGGGGAAGG - Intronic
973111129 4:46399550-46399572 AGAGAGGGTCAAAATGGAGAAGG - Intronic
973320377 4:48804231-48804253 AGAGAGAGAGAGAAAGAGGATGG - Intergenic
974291364 4:59935729-59935751 AGAGAGAGTAAAAATGAGGATGG + Intergenic
974310861 4:60208768-60208790 AGAGAGAGTCAGAAGGGTGGGGG + Intergenic
974348593 4:60715101-60715123 AGAGAGAGGGAGGAAGGGCAAGG + Intergenic
974497023 4:62644520-62644542 AGACAGAGGCAGAAAGGGACAGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974983753 4:68993918-68993940 TGAGGGAGCCAGAAAGGGGACGG + Intergenic
975159411 4:71108728-71108750 AGAGAGAGAGAGAAAGGGGTTGG - Intergenic
975169063 4:71212551-71212573 GGACAGAGGCACAATGGGGTTGG + Intronic
975359223 4:73447369-73447391 AGAAAAAGGAAGAAAGGGGAGGG - Intronic
975426079 4:74229397-74229419 AGAGGTAGCCAGAACGGGGAGGG + Intronic
975826070 4:78320648-78320670 AGAGAGAGACAGAAGGAGGGAGG - Intronic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976615223 4:87069420-87069442 AGAGAGAGGGAGAAGGGGAGAGG - Intronic
976720935 4:88168053-88168075 AGAGAGAGACAGCATCGGGGAGG + Intronic
977317388 4:95467412-95467434 ACAGAGAGAGAGAATGGGGCTGG + Intronic
977532551 4:98217348-98217370 AGAAACAGGCAGAGTGAGGAAGG + Intergenic
977600724 4:98931330-98931352 AGGGAGAGGAAGGGTGGGGAAGG - Intergenic
977600767 4:98931428-98931450 AGAGAGAGAGAGAATGGGAGGGG - Intergenic
977919223 4:102625198-102625220 AGAGAAAGGGAGAAAGAGGAAGG - Intergenic
978270178 4:106879083-106879105 GGAGAAAGGGAAAATGGGGAAGG + Intergenic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978555368 4:109973675-109973697 AGAGAGAGGCAGAGGTGGGAGGG - Intronic
978577241 4:110199254-110199276 GAACAGAGGCAGAGTGGGGAAGG + Intergenic
978723436 4:111942092-111942114 AGAGAGGGAGAGAAAGGGGAGGG + Intergenic
978858327 4:113418670-113418692 AGAGAGAGGAAGGAAGGAGAGGG - Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979101055 4:116615254-116615276 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
979255267 4:118601896-118601918 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
979333069 4:119438616-119438638 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
979448828 4:120844612-120844634 AGAGAGAGAGAGATGGGGGAAGG - Intronic
979516071 4:121611690-121611712 GGAGTGAGGGAGAATAGGGAAGG + Intergenic
980082107 4:128355079-128355101 TGAGAGAGGCAGCAAGAGGAAGG - Intergenic
980568898 4:134584164-134584186 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
980791578 4:137627637-137627659 AGACAGAGGCACAAAAGGGAAGG - Intergenic
980982769 4:139668604-139668626 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
981075200 4:140584379-140584401 TTAGGGAGGAAGAATGGGGAAGG - Intergenic
981099024 4:140810778-140810800 AGAGAGAGGGAGAGAGGGAAAGG - Intergenic
982797393 4:159662883-159662905 GGAGAGAGGGAGAATGAGGTGGG + Intergenic
982970551 4:161979515-161979537 AGAGAGAGACAGAAAGGAAAGGG - Intronic
983104425 4:163668495-163668517 AGATGGAGGTAGAATGGGCAAGG + Intronic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
983993432 4:174151206-174151228 AGGAAGAGGCATAATGGGAAAGG + Intergenic
984249640 4:177316577-177316599 AGAGTCAAGCAGGATGGGGATGG + Intronic
984325609 4:178246765-178246787 AGAGAGAGGCAGGGTGGGGGGGG + Intergenic
984467982 4:180125697-180125719 AGAGAGTGGAGGAAAGGGGAGGG + Intergenic
984742101 4:183174788-183174810 AGAGAGAGAGAGAAAGGAGAAGG - Intronic
984760077 4:183356361-183356383 GGAGGGAGGCAGAAAGGAGAAGG - Intergenic
985203615 4:187508746-187508768 AGACAGAGGAAGAAAGGTGATGG - Intergenic
1202769838 4_GL000008v2_random:193852-193874 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
985630343 5:1010684-1010706 AGAGAGAGCCAGATTGGGGCGGG - Intronic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985910805 5:2879514-2879536 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
985932805 5:3072382-3072404 AGAGAGAGGCAGGGGGGAGACGG - Intergenic
985983022 5:3488134-3488156 AGAGAGGGGAGGAAGGGGGAGGG + Intergenic
986125630 5:4880472-4880494 AGTGAGAGACAGGAAGGGGAAGG + Intergenic
986169100 5:5301524-5301546 AGTGAGAGACAGAAAGGAGAAGG - Intronic
986523126 5:8642991-8643013 AGAGAGAGGCAGAGTGTGCCTGG - Intergenic
986590638 5:9365813-9365835 AGAGACAGGCAGTAGTGGGAGGG - Intronic
986931865 5:12834982-12835004 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987917806 5:24238633-24238655 AGAAAGTGGGAGAAAGGGGAAGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988445441 5:31281306-31281328 AGAGAGAGGGAGAAAGAGAAAGG + Intronic
988672769 5:33399712-33399734 AGAGAGAGAGAGAATGGAGATGG + Intergenic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
988854413 5:35214017-35214039 AGCAAGAGGCACAACGGGGAAGG - Intronic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989105702 5:37861400-37861422 AGAGAGAGAAAGAGCGGGGAAGG - Intergenic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989322380 5:40151371-40151393 AAAGAGAGGAAGAAAGGAGATGG - Intergenic
989592727 5:43126855-43126877 TGGGAGAGGGACAATGGGGAGGG - Intronic
989755445 5:44947619-44947641 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
989823184 5:45820258-45820280 ATAAAGAGGCAGAATGGCAATGG + Intergenic
990021680 5:51135475-51135497 ACAGAGAGGTTTAATGGGGATGG - Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990210475 5:53478577-53478599 AAAGAGAGGGAGAAAAGGGAGGG + Intergenic
990224518 5:53634599-53634621 AGGGAGAGGAAGGAGGGGGAAGG - Intronic
990304277 5:54479712-54479734 AGAGAGTTGCAGAATGGAAAGGG + Intergenic
990566618 5:57036212-57036234 AGAGAAAGGCAGACTAGGGTAGG + Intergenic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991081464 5:62605417-62605439 AGAGAGAGGCTGAATGAAAAGGG - Intronic
991183267 5:63778970-63778992 AGAGAATGGGAGAAAGGGGAGGG + Intergenic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
991605437 5:68396135-68396157 AGACAGTGGAAGAATGAGGAAGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992184655 5:74232386-74232408 AGAGAGAGGGAGGACAGGGATGG - Intergenic
992374506 5:76175043-76175065 TGAGAGAGGCAGAAGGGGAAGGG + Intronic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994088775 5:95789695-95789717 AGAGAGAGGGAGTAAGGGAAAGG + Intronic
994095686 5:95845484-95845506 AGAGAGAGACAGCAAGGGAAGGG + Intergenic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994340906 5:98626634-98626656 AGAGAGAGGCACACTTGTGAAGG + Intergenic
994367684 5:98934059-98934081 GGAGAGAAGTAGAATTGGGAAGG + Intergenic
994638087 5:102367534-102367556 AGAGAGAGGAGGGAAGGGGAAGG + Intergenic
994727592 5:103454571-103454593 AATGAGGGGCAGAATGGGCAAGG - Intergenic
994760988 5:103853759-103853781 AGAGGGAGAAAGACTGGGGATGG + Intergenic
994824853 5:104699363-104699385 AGAGAGAGAGAGGATGGAGAGGG + Intergenic
994935770 5:106251568-106251590 AGAGAAAAACAGATTGGGGAGGG - Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996225668 5:120992486-120992508 AGAGAGAGGCTGATTTGGGAAGG + Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996280990 5:121728878-121728900 AAAGAGGGGGAGGATGGGGATGG - Intergenic
996508736 5:124295749-124295771 GGAGAGAGGAAGAATGATGAGGG - Intergenic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
997139263 5:131361730-131361752 TGAGGGAGCCAGAATGGAGATGG + Intronic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997259157 5:132452501-132452523 GGAGAGAGGAAAAGTGGGGATGG - Intronic
997466015 5:134088527-134088549 AGAAGGAGGCAAACTGGGGAAGG + Intergenic
997581266 5:135018874-135018896 AAAGACAGGCAGAACTGGGATGG - Intergenic
997677537 5:135724497-135724519 AGAGAGACGCACTGTGGGGAAGG - Intergenic
998005762 5:138655837-138655859 AGTGAGAGGCACAAAAGGGAAGG + Intronic
998114531 5:139526096-139526118 AGAGAGAAGCAGAACAGGGCAGG - Intergenic
998151329 5:139759148-139759170 GGAGAGACGGAGAATGGGGGAGG - Intergenic
998251547 5:140557101-140557123 AGACAGACGGAGAATGGGGGGGG - Intronic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998630992 5:143898475-143898497 AGAGAGAGGAAGAGAGGGAAGGG - Intergenic
999039712 5:148393955-148393977 GGAGAGAGGAGGAATGGAGAGGG - Intronic
999065660 5:148683119-148683141 AGAGAGGGGGAGAATGAGGGGGG + Intergenic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999194016 5:149769848-149769870 AGAGGGAGGCAGAAGGGTCAGGG - Intronic
999255977 5:150210235-150210257 AGAGAGAGGAAGAAGAGGGCAGG + Exonic
999262327 5:150245587-150245609 AGAGAGGGCCAGGGTGGGGAGGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999368001 5:151035415-151035437 AGAAAGAGTCAGAGAGGGGAAGG + Intronic
999408496 5:151328299-151328321 AGTAGCAGGCAGAATGGGGAAGG + Intronic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999719562 5:154388918-154388940 AGAGAGAGAAGGAGTGGGGAGGG + Intronic
999798518 5:155010651-155010673 AGAGAGAGGAAGAAGAGAGAAGG - Intergenic
999827308 5:155286168-155286190 AGAGAATGGAAGAAGGGGGAGGG - Intergenic
999835728 5:155368833-155368855 AGAGAGTAACAGAAAGGGGAGGG - Intergenic
999914923 5:156248134-156248156 AGAGAGAGAGAGAATGGGAATGG + Intronic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000531048 5:162420280-162420302 GGAGAGAGGGAGATGGGGGAAGG + Intergenic
1000727016 5:164784380-164784402 AGAGAAAGGGGGAAGGGGGAAGG + Intergenic
1000966472 5:167663118-167663140 AGAGACAGAGAGAATGGGGATGG + Intronic
1001175844 5:169468141-169468163 AGAGAGCGGGGGAATGGGGCAGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001329574 5:170752686-170752708 AGAGGGAGGCAGGAAGGAGAGGG - Intergenic
1001405187 5:171471447-171471469 AGAGAGAGGCAAAGAGGGAATGG - Intergenic
1001494032 5:172175386-172175408 GGAGAGAGGGAGAAGGGAGAAGG + Intronic
1001635010 5:173203420-173203442 AGAAAGAGGGAGGAGGGGGAGGG - Intergenic
1001800780 5:174542253-174542275 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
1001819843 5:174701644-174701666 AGAGAGAGACAGAGAGGGGGTGG - Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002765570 6:235866-235888 AGAGAGAGGGAGAGGAGGGAAGG + Intergenic
1002890371 6:1326697-1326719 AGAGAGAGGAAGTGAGGGGAGGG - Intergenic
1002895144 6:1374694-1374716 AGAGAGAAGTGGTATGGGGACGG - Intergenic
1003064598 6:2893006-2893028 AGTGAGAGGCAGTATAGGGCAGG - Intronic
1003160416 6:3629690-3629712 AGAGAGAAGCACAAAGGAGAGGG - Intergenic
1003427408 6:6006950-6006972 AGAGAGAGGCTGAGGGGGGGGGG + Exonic
1003436415 6:6092646-6092668 AGAGAGAGAAAGAAAGGTGAAGG + Intergenic
1003634438 6:7819542-7819564 AGAGAAAGGAAGAAAGGGAAGGG + Intronic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003893839 6:10588119-10588141 AGAGAGGGACAGAAAGAGGATGG + Intronic
1004205836 6:13591559-13591581 AGAGACAGGCAGCGTCGGGAAGG - Intronic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004542282 6:16562403-16562425 AGAAAGAAGGGGAATGGGGAAGG + Intronic
1005254332 6:23983923-23983945 ACAGAGAGAGAGAATGGGAAGGG + Intergenic
1005585111 6:27268743-27268765 AGAAAGAGGAAGATTGTGGACGG + Intergenic
1005808493 6:29497460-29497482 AGAGAGAGAGTGAAGGGGGAAGG - Intergenic
1006073782 6:31516259-31516281 AGAGAGGGGCAGGATCTGGATGG - Intergenic
1006076922 6:31539406-31539428 AGAGAGAGGTAAAATGGGTCTGG - Intronic
1006110660 6:31742974-31742996 GGATAGAGGGAAAATGGGGAAGG + Intronic
1006278743 6:33029131-33029153 TGAGAGAGACAGAAAGGAGAGGG - Intergenic
1006547577 6:34792372-34792394 GGAGAGAGGCAGACTGGGCCCGG - Intronic
1006562985 6:34929796-34929818 AGAGAGAGAGAGAAGGAGGAAGG - Intronic
1006576230 6:35048473-35048495 AGAGGGAGGCAGAAGGGGATGGG - Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1006860571 6:37169733-37169755 CGAGGGAGGAAGGATGGGGAGGG - Intergenic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1007351573 6:41277378-41277400 AGAGACAGGCAGCAAGGGGCAGG + Intronic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1007455354 6:41972917-41972939 GGAGAGGGGCAGAAGGGGCAAGG + Intronic
1007594526 6:43043346-43043368 AGGGAGGGGAAGGATGGGGATGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007739784 6:44003342-44003364 AGAGACTGGGAGAGTGGGGAGGG + Exonic
1007745330 6:44039897-44039919 AGACAGAGGCAGTGAGGGGAAGG + Intergenic
1007985904 6:46206617-46206639 AGAGAGAGGAAAAAAGGGCAGGG + Intergenic
1008291468 6:49721414-49721436 AGAGAGAGAAAGTAAGGGGAAGG + Intergenic
1008337960 6:50329017-50329039 AGAGATATGCATATTGGGGATGG - Intergenic
1008467471 6:51846861-51846883 AGAGAGAGGCTGAATTAAGACGG - Intronic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1008880819 6:56378500-56378522 AGAGGAAGGAAGAATGGGAAGGG + Intronic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1009514377 6:64596068-64596090 AGAGAGAGCCAGGGAGGGGATGG + Intronic
1009552570 6:65118021-65118043 AGTACGAGGAAGAATGGGGAAGG + Intronic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1010068889 6:71719836-71719858 AGAGAGAGGCTGAAGCGGGTGGG - Intergenic
1010477736 6:76309680-76309702 AGAGGCAGGTAGAGTGGGGAAGG - Intergenic
1010486903 6:76425678-76425700 AGAGAGAAACAGAATGGGATGGG + Intergenic
1010716611 6:79237528-79237550 AGAGAGAGGGAGAAGGGAGAAGG + Intergenic
1010731364 6:79394928-79394950 AAAGTGAGGGAGAATGTGGATGG + Intergenic
1010999183 6:82568557-82568579 TGAGAGTGGCAGAAGGGTGATGG - Intergenic
1011163426 6:84418876-84418898 AGATAGAGGGAGATTTGGGATGG - Intergenic
1011304848 6:85914734-85914756 AGAGAGGGGCTGCATGGGAAAGG - Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011472729 6:87723953-87723975 AAAGAGACCCAGAATGGGGCTGG - Intergenic
1011888316 6:92125768-92125790 GGAGAGAGGCAGAATGGGGTGGG - Intergenic
1011894546 6:92208714-92208736 AGAGAAAGGAGGAGTGGGGAAGG - Intergenic
1012120258 6:95356823-95356845 AGAGAGAGAGAGGACGGGGAGGG + Intergenic
1012888187 6:104868719-104868741 AGAGAGAGACAGGAGAGGGATGG - Intergenic
1013036543 6:106390381-106390403 AGAGAGAGGAGGGAAGGGGAGGG - Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013308305 6:108870510-108870532 AGAGAGAGACAGAAAGAGAAAGG + Intronic
1013482124 6:110561877-110561899 AGAGAGAGACAGAGAGGGCAGGG - Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014014199 6:116511007-116511029 AGAAAGAGGGAGAGTGGGAAGGG + Intronic
1014038840 6:116800185-116800207 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1014117503 6:117682191-117682213 AGACAGAGTAAGACTGGGGATGG - Intronic
1014234262 6:118937146-118937168 AGAGAGAGGGAGAATGAGTGAGG - Intergenic
1014522165 6:122457891-122457913 AGAGAGAGTCAGGTTGTGGAAGG - Intronic
1014571146 6:123009622-123009644 GGGAAGAGGCAGGATGGGGAGGG - Intronic
1014761306 6:125359741-125359763 AGAGAGAGGGAGAAGAGGGAGGG + Intergenic
1014786241 6:125623234-125623256 GGAGTGAGGCAGGATGGGGAAGG + Intergenic
1014908555 6:127061098-127061120 AGGGAGAGGAAAAATGGGTAAGG + Intergenic
1015526051 6:134175895-134175917 AGAAAGAGGGAAAAGGGGGAGGG + Intronic
1015843586 6:137496540-137496562 AGAGAGAGGCGGACGGGGGAGGG + Intergenic
1016428049 6:143955354-143955376 AGAGAGATGGAGAATCGTGAAGG + Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016555966 6:145338662-145338684 AGACAGTGGCAGAAAGGGCACGG + Intergenic
1016754056 6:147664118-147664140 TGATACAGGCTGAATGGGGAAGG - Intronic
1016882749 6:148927177-148927199 AGAGAGAGAGAGAAAGGGGAGGG + Intronic
1016953019 6:149599572-149599594 AGAGAGAGGGAGAGGGGAGAGGG - Intronic
1017122416 6:151037143-151037165 ACAGCAATGCAGAATGGGGAGGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017331276 6:153200436-153200458 AGACAGAGGCACATGGGGGAAGG - Intergenic
1017388666 6:153914243-153914265 AGAGAGAGAAAGAGTGGGGATGG + Intergenic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017795499 6:157840463-157840485 AGAGAGAGAGAGAAGGGAGAAGG - Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018298607 6:162376702-162376724 AGAGAGAGGGGGAAAGGGAAGGG + Intronic
1018618483 6:165709256-165709278 ACAGCGTGGCAGCATGGGGATGG - Intronic
1018618554 6:165709513-165709535 AGAGCGAAGCAGCATGGGGGTGG - Intronic
1018933389 6:168257193-168257215 AGAGAGAGACAGAAGAGAGAGGG - Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019327638 7:446120-446142 AGAGGGAGGAAGAAGAGGGAGGG + Intergenic
1019414141 7:919772-919794 AGAGGGAGGGAGATGGGGGAGGG + Intronic
1019511027 7:1417352-1417374 AGGAAGGGGCAGAAAGGGGATGG - Intergenic
1019551887 7:1607138-1607160 AGAGAGAGGAAAGATGGGGTGGG - Intergenic
1019557770 7:1641177-1641199 AGATAGGGGAAGACTGGGGAAGG - Intergenic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1019821000 7:3242661-3242683 AGAGAGAGACAGAGAGAGGAGGG - Intergenic
1019833632 7:3358786-3358808 AGATGGAGGCAAAATGGGGTGGG + Intronic
1020095985 7:5369606-5369628 AGAGAGAGAGAGACTAGGGAAGG + Intronic
1020546491 7:9539881-9539903 AGAGAGAGAGAGAATGGGGGAGG - Intergenic
1020595744 7:10205167-10205189 AGAGAAAGGGAGAAAGGGAAGGG + Intergenic
1020842039 7:13230197-13230219 GGAGAGAGGCAGAATAGAAAAGG - Intergenic
1020918343 7:14227603-14227625 GGAGGGAGGCAGAAAGGAGAAGG + Intronic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021432916 7:20581944-20581966 AGGGCAAGGCAGAATGGGGGAGG + Intergenic
1021586308 7:22212336-22212358 AGAGAGAGACAGAATCTGAAGGG - Intronic
1021805891 7:24354540-24354562 AGAGATAGCCAGAAGGGGGGTGG + Intergenic
1022297988 7:29074715-29074737 AGAGAGAGAGAGCATGGGCAGGG - Intronic
1022441097 7:30434057-30434079 AGAATGAGGTAGAATGAGGAGGG + Intronic
1022453581 7:30537843-30537865 AGAGAGAGGCTCCATGGGCATGG - Intronic
1022977769 7:35574799-35574821 AGAGAAAGGCAGAGTCTGGAAGG + Intergenic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023089132 7:36601358-36601380 AGAGGGAGGGAGAGGGGGGAAGG + Intronic
1023210785 7:37802834-37802856 AGAGAGAGAAAGAAAGGGAAGGG - Intronic
1023215506 7:37858615-37858637 ACACAGAGGCAGAATGGGCTTGG + Intronic
1023397366 7:39763749-39763771 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1023494072 7:40776008-40776030 AGTGGCAGGCACAATGGGGAAGG - Intronic
1023550865 7:41368563-41368585 AGATAGAGACAGAATTGGGAAGG - Intergenic
1023615171 7:42012381-42012403 AGAGAGAAGAAGAAAAGGGAGGG - Intronic
1023709649 7:42977917-42977939 AGAAAGAGACAGAAAGGGGAGGG - Intergenic
1023840550 7:44095067-44095089 AGAGAGAGGGAGAGAGGGAAGGG + Intergenic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024534727 7:50420599-50420621 AGAGAGAGAAAGAAAGGGGGTGG - Intergenic
1024586966 7:50850215-50850237 GGAGAGGGGGAGAATGTGGAAGG - Intergenic
1024702245 7:51916746-51916768 AGAGAGAGAGTGAAGGGGGAAGG + Intergenic
1024854126 7:53757192-53757214 AGAGAGAGGCAGAGTGAAGCAGG - Intergenic
1024937250 7:54722831-54722853 AAAGAGAGAAAGAAAGGGGAGGG - Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025135307 7:56406719-56406741 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1025871472 7:65438366-65438388 TGACAGAGGCAGAATGGAAAAGG + Intergenic
1026110548 7:67455761-67455783 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1026129922 7:67611932-67611954 AGGAAGAGGCAGAAGGGAGATGG - Intergenic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1026376554 7:69757093-69757115 AGAGGAAGGCAGAAAAGGGAAGG - Intronic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026529563 7:71185176-71185198 AGAGAGAGACAGAGAGAGGAAGG - Intronic
1026595712 7:71732748-71732770 AGAAAGAGGCAGAAAGGGACAGG + Intergenic
1026634531 7:72069783-72069805 AGATAGAGGGAGATTGGGTAGGG - Intronic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1026846274 7:73700640-73700662 GGAGAGAGGTGGGATGGGGAGGG + Intronic
1026927525 7:74204424-74204446 AGAGGGAGGAAGAAAGGGAAAGG + Intronic
1027232562 7:76281411-76281433 GGAGAGAGGCAGACAGGGCACGG - Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027611007 7:80360517-80360539 AGAGAGAGAGAGAAAGGTGAGGG - Intergenic
1027828290 7:83144994-83145016 AGAGAGAGAAAGAATAGGAAAGG + Intronic
1027899433 7:84091323-84091345 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1027941777 7:84691473-84691495 AGAAGGAGGGAGAATGGGGGTGG - Intergenic
1028133105 7:87200118-87200140 AGAGTCAGGCAAAATTGGGAGGG + Intronic
1028297714 7:89155951-89155973 AGAGAGAGACAGAGGAGGGAAGG - Intronic
1028482098 7:91318064-91318086 AGAGGGAGGGAGAACAGGGAAGG + Intergenic
1028616025 7:92767759-92767781 AGAGGGGTGCAGAGTGGGGAGGG + Intronic
1028621790 7:92834904-92834926 AGATAGCTGCTGAATGGGGAGGG - Intronic
1028636791 7:92998010-92998032 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1028988923 7:97028624-97028646 AGAGAGCCGCAGAAGGGGGTGGG + Intergenic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029027771 7:97435547-97435569 AGAGAGAGTCAGAGAAGGGATGG + Intergenic
1029106480 7:98180942-98180964 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1029253817 7:99255453-99255475 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1029392203 7:100282631-100282653 AGAGAAAGAAAGAAAGGGGAGGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029416345 7:100445562-100445584 AGACAGAGACAGAAAGGGGCAGG - Intergenic
1029443061 7:100598592-100598614 AGAGAGAGGCAGGAAGCGGCAGG + Intronic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029745132 7:102512353-102512375 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1029763124 7:102611514-102611536 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030509919 7:110471396-110471418 AGAGAGATGGAGGATGGAGAAGG + Intergenic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031122995 7:117742478-117742500 GGAGAGATGCGGGATGGGGAGGG + Intronic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1031773041 7:125870096-125870118 AGAGAGAGACAGCATGAGGTGGG + Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032090047 7:128907051-128907073 GGAGAGAGGCAGACAGGTGAGGG + Intronic
1032204589 7:129850842-129850864 AGAGAGAGAGGGAAGGGGGATGG + Intronic
1032355953 7:131210719-131210741 AAAGAGAGAGAGAAAGGGGAAGG + Intronic
1032403983 7:131642668-131642690 AGAGGGAGCCAGTCTGGGGAAGG + Intergenic
1032493208 7:132340572-132340594 AAAGAGGGGCATAATGGAGAAGG + Intronic
1032725541 7:134587109-134587131 AGAGAGAGACAGAGTGGGGGGGG + Intergenic
1032799833 7:135309142-135309164 AGAGGAAGGGAGAATAGGGAAGG + Intergenic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1033478650 7:141716332-141716354 AGAGAGAGGGAGAAGGGGAGGGG - Intronic
1033490705 7:141840936-141840958 AGACAGAGGCAGGATTGCGAAGG - Intronic
1033532767 7:142282050-142282072 AGAATGAGGCAGGATGGGGAAGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034059148 7:148069778-148069800 AAAGAAAGAAAGAATGGGGAGGG + Intronic
1034099055 7:148436105-148436127 AGGAAGAGCCAGCATGGGGAGGG + Intergenic
1034389432 7:150772974-150772996 AGAGAGAGGGAGAATTCAGAGGG - Intergenic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1034606829 7:152323843-152323865 AGAGAGAGAGAGAAGCGGGAGGG + Intronic
1034725638 7:153332787-153332809 AGAGAGAGAGACAGTGGGGAGGG + Intergenic
1034928517 7:155142100-155142122 CGAGAGAGGGAGAAGAGGGAGGG - Intergenic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035038047 7:155908162-155908184 AGAGGTAGGGAGAAGGGGGAGGG + Intergenic
1035088977 7:156289103-156289125 AGAGAGAGGCAGAATGTGTTTGG - Intergenic
1035100189 7:156389832-156389854 AGAGAGAGGAAGAAGGCTGAGGG - Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035457492 7:159018227-159018249 AGACAGAGACACAATGGGGGGGG - Intergenic
1035745482 8:1959606-1959628 TGAGAGAGGCAGACGCGGGAGGG + Intergenic
1036065299 8:5373827-5373849 AGAGAGAAACATAGTGGGGAAGG - Intergenic
1036134772 8:6150645-6150667 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
1036134787 8:6150800-6150822 AGAGAAAGGGAGAAAGGGAAGGG + Intergenic
1036181836 8:6592524-6592546 AGAGAGAGGAAGAATGGAATTGG - Intronic
1037514435 8:19616673-19616695 AGAGAGAGAGAGAATGAGGGGGG - Intronic
1037675253 8:21045418-21045440 AGAGAAAGGCTGTTTGGGGAGGG + Intergenic
1037677029 8:21059726-21059748 AGAGAAAGGCTGTTTGGGGAGGG - Intergenic
1037769127 8:21788892-21788914 GGAGAGTGGGAGAAGGGGGAGGG - Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038136552 8:24792259-24792281 AGAGAGAGAGAGAGAGGGGAAGG - Intergenic
1038162482 8:25053004-25053026 TTAGCCAGGCAGAATGGGGAAGG - Intergenic
1038645813 8:29361280-29361302 AGACACAGGCAGGGTGGGGAAGG - Intergenic
1038720475 8:30030920-30030942 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1039127814 8:34223388-34223410 AAAGAGAGACAGAAAGGTGATGG - Intergenic
1039498249 8:37997434-37997456 AGAGAAAGGGAGAAAGGGGGCGG - Intergenic
1039639913 8:39207690-39207712 AGAGAGAGGAAGACTGGGAGAGG - Intronic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1039987687 8:42461768-42461790 AGAGAGAGAAAGAAAGTGGAGGG - Intronic
1040307265 8:46218593-46218615 AGAGGAAGGCAGAGCGGGGAAGG - Intergenic
1040413641 8:47179461-47179483 GGAGAGAGACAGAGGGGGGAGGG + Intergenic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040531088 8:48266909-48266931 AGAGGGAGGCAGCCTGGGGCTGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1041023138 8:53658117-53658139 AGAGACACACAGAAAGGGGAGGG + Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041256446 8:55983237-55983259 AGAGAGAGGCAAGTAGGGGAAGG - Intronic
1041387279 8:57318020-57318042 AGAAAAACCCAGAATGGGGAAGG - Intergenic
1041734819 8:61098748-61098770 TCAGAGAGGCAGACTGGGGGTGG - Intronic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1042119019 8:65464062-65464084 AGAGAGAGGGAAAAAGGGAATGG - Intergenic
1042207676 8:66345427-66345449 AGAGAGAGGCAACAAGAGGAAGG + Intergenic
1042255831 8:66802682-66802704 AGAGAGAGGGAGAAGGGGATGGG + Intronic
1042339323 8:67662291-67662313 AGATGGAGACAGAATTGGGATGG - Intronic
1042348385 8:67750784-67750806 ACAGAAAGGCTGAATGGAGATGG - Intergenic
1042492068 8:69410797-69410819 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1042568203 8:70134042-70134064 AGAAAGGGGCAGAAAGGGGCGGG - Intronic
1042581567 8:70284834-70284856 GGAGAGAGGGAGAAGGGAGAAGG + Intronic
1042905651 8:73769175-73769197 AGAGAGAGAGAGAATGTGTATGG - Intronic
1043009279 8:74861709-74861731 AGACAGAGGAAGAACAGGGAGGG + Intergenic
1043313017 8:78886101-78886123 AGAGAGAGGGAGTTGGGGGATGG - Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043783841 8:84371579-84371601 AGAGAGAGAGAGAAGGGGGCAGG + Intronic
1043826138 8:84930798-84930820 GGAGAGAGAGAGAATAGGGAAGG + Intergenic
1043952073 8:86320497-86320519 AGAAAGAGACAAAATGGGGGTGG + Intronic
1044331530 8:90925880-90925902 AGAGAGATGGTGAATAGGGAAGG + Intronic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1044670839 8:94679375-94679397 AGAGGGTGGCAGATTGGGGCTGG - Intronic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045652288 8:104352492-104352514 AGAGAGAGGGAGAATTGAGGGGG - Intronic
1045923437 8:107560413-107560435 AGAGAGAGTGAGAAGGGGAAAGG - Intergenic
1046048304 8:108988782-108988804 AGAGAGAGGCAGGGAGGGAAAGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046180920 8:110646448-110646470 AGAGAGAGGGAGAAAGAGTAAGG + Intergenic
1046538392 8:115547300-115547322 AGAGAGAGGGAGAAAGGGAAGGG - Intronic
1046564203 8:115877902-115877924 AGAGAGTGGGGGAAAGGGGAGGG + Intergenic
1046964330 8:120147000-120147022 GGAGAGAGGCAGAATTGGAGGGG - Intronic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1047681121 8:127255296-127255318 AGAGAGAGACAGAGAGGGGCAGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1047843749 8:128783502-128783524 AGAGAGAGGCAGAACAGTGTTGG + Intergenic
1047969294 8:130070986-130071008 AGAGAGAGAGAGAGAGGGGAGGG + Intronic
1047980807 8:130180011-130180033 AGAGAGAGAAAGAAAGGAGAGGG + Intronic
1048031788 8:130640018-130640040 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
1048443026 8:134473928-134473950 AAAGAGATGCAGAATGGAGGAGG + Intergenic
1048507165 8:135032114-135032136 AGACAGAGACAGACTGGAGAAGG - Intergenic
1048575025 8:135683514-135683536 AGAGAGAGGGAGAAAGAGAAGGG + Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1049047147 8:140161816-140161838 AGAGAAAGGCAGAAAGGGCAAGG + Intronic
1049059424 8:140264583-140264605 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
1049249659 8:141581559-141581581 AGAGAGAGACAGAAAGAGGCGGG + Intergenic
1049294120 8:141821149-141821171 AGAGTGAGGGAGAGTGGGGGTGG - Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049465806 8:142750796-142750818 GGAGAGAGGAAGGAAGGGGAGGG + Intronic
1049997625 9:1046960-1046982 AGAGGGAGGCAGAGGGGGAAGGG + Intergenic
1050181652 9:2929221-2929243 AGAGAGAGAGAGAAGTGGGATGG + Intergenic
1050209034 9:3232789-3232811 AGAGAGAGAGAGAAATGGGATGG + Intronic
1050233586 9:3555151-3555173 AGAGAGAGGCATATGGGGTAGGG + Intergenic
1050568684 9:6914744-6914766 AGAGATAGAAGGAATGGGGAAGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388642 9:16539568-16539590 AGAGAGAGACAGAGAAGGGAGGG + Intronic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051480417 9:17554036-17554058 AAAGAGAGAGAGAAAGGGGAGGG - Intergenic
1051490140 9:17654093-17654115 AGAGAGCTGCAGACTGGGGGAGG + Intronic
1051794284 9:20847214-20847236 AGAGAGATGAAGGATTGGGAAGG - Intronic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1051922720 9:22286881-22286903 GGAAAGATGCAGAATAGGGAAGG + Intergenic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1052012073 9:23422253-23422275 AGAGAGAGAGTGAAAGGGGAAGG - Intergenic
1052055523 9:23902812-23902834 AGAGAGAGGCAGAAAGGGAGAGG - Intergenic
1052362911 9:27578923-27578945 AGAGAGAGGGAAAGTGGGGGAGG + Intergenic
1052370142 9:27655144-27655166 TGAGAGAGCCAGAAGGGAGATGG - Intergenic
1052412893 9:28145665-28145687 AGAGAGAGGGAGAAGGAGGGAGG - Intronic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052861463 9:33440371-33440393 AGAGTGAGGCAGAGCAGGGATGG + Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053474496 9:38372344-38372366 ACAGAGAGGCAGGGTGGGCACGG + Intergenic
1053508880 9:38670036-38670058 AGAGACAGCCAGATTGGGGCAGG + Intergenic
1055014603 9:71602623-71602645 AGGGAAAGGCAAGATGGGGAGGG - Intergenic
1055053420 9:72001730-72001752 AGAGAGAGACAGAATGGTACAGG - Intergenic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055103201 9:72486225-72486247 AGAGAGAGAGAGATTGGGAAAGG - Intergenic
1055307252 9:74942733-74942755 AGGGAGAGGCACAATGTGCAAGG - Intergenic
1055340796 9:75280742-75280764 AGAGGGAGGCAGGATGAGGCTGG - Intergenic
1055601625 9:77925056-77925078 AGAGAGCAGCAGTATGGAGAGGG - Intronic
1056165147 9:83933808-83933830 TGAGAGTGGCAAAATGGGAATGG + Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056499407 9:87193070-87193092 AGAAAGAGGGAGAATGGGCAGGG + Intergenic
1056749121 9:89333590-89333612 TGAGAGAGGGAGAGTAGGGAAGG + Intronic
1056816074 9:89802117-89802139 AGAGAGAGGCAGAATGCTGCTGG - Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057094736 9:92295453-92295475 AGAGAGAGGGGAAAGGGGGAAGG + Intergenic
1057115977 9:92522536-92522558 AGAGAGAGACAGAAAGAGGGAGG - Intronic
1057168741 9:92948100-92948122 AGAAATGGGAAGAATGGGGAAGG - Intronic
1057226804 9:93296909-93296931 CGAGGGAGGTAGAATGGGGAGGG - Intronic
1057387144 9:94614200-94614222 GGAGGGAGGGAGAAGGGGGAGGG + Intronic
1057835195 9:98438884-98438906 AGAGAGAGAGAGAAGGGAGAGGG - Intronic
1057852312 9:98575118-98575140 AGAGACAGGCAGAGTGGAGTGGG + Intronic
1057932778 9:99210690-99210712 AGAGAGAGAAAGAAAGGGGAAGG - Intergenic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1058049452 9:100392201-100392223 AGAGGGAGGGGGAAGGGGGATGG - Intergenic
1058237301 9:102505728-102505750 AGAAAAAGGCACAGTGGGGATGG + Intergenic
1058270689 9:102968145-102968167 AGAGTGAGGCTGAGGGGGGAGGG - Intergenic
1058815979 9:108683374-108683396 CGCTAGAGGCAGAATGGGGGTGG - Intergenic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059030306 9:110686249-110686271 AGAGAGAGGCAGATTGATAAAGG - Intronic
1059054101 9:110960688-110960710 AGAGAGAGGAAGAAATGGGAGGG + Intronic
1059146160 9:111901528-111901550 AGTGAGGGGCAGTGTGGGGAGGG + Intronic
1059309920 9:113381285-113381307 AGAGAGAGAGAGAAGAGGGAGGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059499310 9:114737507-114737529 AGGGAGAGGCAGAAGGGGAGGGG - Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1060121700 9:120997479-120997501 AGAGAGACACAGAAAGGGGGGGG - Intronic
1060315674 9:122508145-122508167 AGAGAGAGAGAGAAAGGAGAAGG + Intergenic
1060442689 9:123656233-123656255 AGTGAGAGGCAGGGCGGGGAGGG + Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060859590 9:126943758-126943780 AGAGACAGGCAGGGTGGGCAAGG - Intronic
1060860810 9:126953413-126953435 TGAGAGAGGCAGAAGGAGGGTGG + Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1062080858 9:134622650-134622672 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080889 9:134622751-134622773 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080920 9:134622850-134622872 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062158177 9:135065654-135065676 AGAGAGAGGCAGGGTAAGGAAGG - Intergenic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062440213 9:136566367-136566389 AGACTGAGGCAGGATGGGGCGGG + Intergenic
1062480939 9:136751028-136751050 AGAGGGAGGGAGAAATGGGAGGG + Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062670312 9:137704956-137704978 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1062751210 9:138255131-138255153 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1203694738 Un_GL000214v1:87531-87553 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203704812 Un_KI270742v1:29901-29923 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203559192 Un_KI270744v1:35910-35932 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203641535 Un_KI270751v1:16532-16554 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1185552104 X:990541-990563 AGAGAGAGAGAGAAAGGGGGAGG - Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1185575920 X:1172171-1172193 AGAGAGAAACAGAACGGGGCAGG - Intergenic
1185604604 X:1360868-1360890 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604609 X:1360892-1360914 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604614 X:1360916-1360938 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604624 X:1360962-1360984 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604629 X:1360986-1361008 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604639 X:1361032-1361054 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604644 X:1361056-1361078 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604649 X:1361080-1361102 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604654 X:1361104-1361126 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604659 X:1361128-1361150 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185679121 X:1873841-1873863 AGAGAGAGTCAGAAAGGAGAGGG - Intergenic
1185683974 X:1911695-1911717 AGAGAGAGGAAGAGAGAGGAGGG - Intergenic
1185693855 X:2179264-2179286 AGAGAGAAACAGAACGGGCAGGG - Intergenic
1185780325 X:2838448-2838470 AGAGAGAGGAAGGGAGGGGAGGG - Intronic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185874592 X:3692098-3692120 AGGGAGAGCGAGAGTGGGGAGGG + Intronic
1185954812 X:4478025-4478047 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
1185999789 X:4995914-4995936 AGAGAGAGAGAGAAAGGGGAAGG - Intergenic
1186032184 X:5380313-5380335 AGGGAAAGGCAGGATGGGGGTGG - Intergenic
1186156262 X:6729812-6729834 AGAGAGAGGGTAAAAGGGGAAGG - Intergenic
1187106812 X:16251759-16251781 AGTGAGAGGGTGAATGGGGCAGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187352044 X:18528571-18528593 AGAGAGAGGCAGGGAGGGAAGGG - Intronic
1187364076 X:18652100-18652122 AGCTAGGGGGAGAATGGGGAGGG - Intronic
1187765954 X:22642317-22642339 AGGTAGAGGAACAATGGGGATGG - Intergenic
1187775426 X:22751242-22751264 AGAGGGAGCAAGAAAGGGGAGGG + Intergenic
1188152487 X:26695204-26695226 AGAGGGAGGCAGAAGGGTCAAGG + Intergenic
1188259882 X:28009647-28009669 AGAGAGAGGAAGAATAGAGAAGG + Intergenic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1188909707 X:35831634-35831656 ACAGAGTGGTAGAATGAGGAAGG - Intergenic
1188920534 X:35971205-35971227 TGAGGGAAGCAGAATAGGGAAGG + Intronic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189346853 X:40248337-40248359 GGAGAGAAGCAGAGTGGGGGTGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1190357157 X:49616662-49616684 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1190359820 X:49638260-49638282 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1190497026 X:51036529-51036551 AAAGACTGGAAGAATGGGGAGGG - Intergenic
1190561929 X:51694925-51694947 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190723651 X:53172099-53172121 AAAGAGAGGAAGAAGAGGGAGGG + Intergenic
1190726195 X:53192508-53192530 AGGGAGAGGGAGAAGGGGGTAGG + Exonic
1191591182 X:62887380-62887402 AGAGGGAGGAAGAAAGGGGAAGG - Intergenic
1191713338 X:64176005-64176027 AGACACAGGCAGAGTGGTGAGGG + Intergenic
1191922949 X:66277171-66277193 AGAGAAAGGCAGACTGGCTAGGG + Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192461034 X:71317730-71317752 AGAGAGAGAGAGAATGGGCGTGG - Intergenic
1192798508 X:74444234-74444256 AGAGGGAGGCAGTATGGAGAGGG - Intronic
1192845652 X:74904693-74904715 AGAGAGAGGGAGAGAGGGAAAGG - Intronic
1193207309 X:78764484-78764506 AGAGAAAGCAAGAAGGGGGAGGG - Intergenic
1193833520 X:86315845-86315867 AGAGAGAGGGAGATTGGAGCAGG + Intronic
1193940536 X:87676616-87676638 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1194809567 X:98374326-98374348 GGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1195385644 X:104311531-104311553 AGAGAGAGACAGAAAGACGAAGG - Intergenic
1195514954 X:105763539-105763561 ATAGAGAGGAAGAATGGGATAGG + Intronic
1195529851 X:105941580-105941602 AGAGAGAGAGAGAATGCGTAGGG + Intronic
1195557202 X:106240810-106240832 AGAGAGAGGAAGAAGTGGGAGGG + Intergenic
1195652297 X:107297766-107297788 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1195822233 X:108957480-108957502 AGAGAGACAGAGAATGGGCAGGG - Intergenic
1196099670 X:111834454-111834476 AGAGAGAGACAGAGAGGGGAGGG - Intronic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1196216262 X:113055427-113055449 AGAGAGAGAGAGAGTGGGAAAGG + Intergenic
1196371471 X:114984200-114984222 AGAGAGAGGCAAAAGGGGAATGG + Intergenic
1196372998 X:114999854-114999876 AGAAAGAGTCAGTATGGTGAGGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197027584 X:121773501-121773523 GGAGAGAGGGAGGATGGTGACGG - Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1198043823 X:132880182-132880204 AGAGAGATGCAGAAAAGGAAAGG - Intronic
1198130673 X:133691604-133691626 AGAGAAAGGAAGAAAAGGGAGGG - Intronic
1198161562 X:134013593-134013615 TGACAGAGGCAGAATGGAAATGG - Intergenic
1198477797 X:137012305-137012327 AGAGAGAGAGAGAAAGGGGGGGG - Intergenic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1198710436 X:139495712-139495734 TGAGAGAGGCAGAGTGTGGTAGG - Intergenic
1198859340 X:141052917-141052939 AGAGAGATTCAGAGAGGGGATGG - Intergenic
1198903355 X:141534475-141534497 AGAGAGATTCAGAGAGGGGATGG + Intergenic
1199029684 X:142982065-142982087 GGGGACAGGAAGAATGGGGAGGG - Intergenic
1199168419 X:144705543-144705565 AGAGAAAGTCAGAATAAGGAAGG - Intergenic
1199191294 X:144974471-144974493 AGAAAGAGGGATGATGGGGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199586257 X:149420108-149420130 AGGGAGAGGCAGAGGGGAGAGGG - Intergenic
1199598817 X:149528482-149528504 AGAGAGAGGAAGAGAGGGAAGGG - Intronic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200019775 X:153192840-153192862 AGAGTGAGTCAGGAGGGGGAAGG - Intergenic
1200103482 X:153700030-153700052 AGAGCTAGGCAGAAAGGGGCTGG - Intergenic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200627093 Y:5532792-5532814 AGAGAGAAACAGAAAAGGGAAGG - Intronic
1201146321 Y:11067183-11067205 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201552404 Y:15231659-15231681 AGAGAAATGCAGAATGGAGTTGG - Intergenic
1201596017 Y:15670005-15670027 AGAGGCAGGCAGAATATGGAAGG + Intergenic
1201741091 Y:17325416-17325438 GGAGAGAGGAAGAGAGGGGAGGG + Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic