ID: 1121105707

View in Genome Browser
Species Human (GRCh38)
Location 14:91278126-91278148
Sequence GGGACCTGGCCACTTTGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 755}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121105707_1121105716 24 Left 1121105707 14:91278126-91278148 CCGGGGCAAAGTGGCCAGGTCCC 0: 1
1: 0
2: 4
3: 60
4: 755
Right 1121105716 14:91278173-91278195 TGAAGCTCTCAGACCGGCCATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1121105707_1121105715 18 Left 1121105707 14:91278126-91278148 CCGGGGCAAAGTGGCCAGGTCCC 0: 1
1: 0
2: 4
3: 60
4: 755
Right 1121105715 14:91278167-91278189 CGCTGCTGAAGCTCTCAGACCGG 0: 1
1: 0
2: 0
3: 8
4: 142
1121105707_1121105712 -9 Left 1121105707 14:91278126-91278148 CCGGGGCAAAGTGGCCAGGTCCC 0: 1
1: 0
2: 4
3: 60
4: 755
Right 1121105712 14:91278140-91278162 CCAGGTCCCTGCTGGGGATCAGG 0: 1
1: 0
2: 4
3: 57
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121105707 Original CRISPR GGGACCTGGCCACTTTGCCC CGG (reversed) Exonic
900124854 1:1064790-1064812 CGCACCTGGCCACCCTGCCCCGG - Intergenic
900255452 1:1695928-1695950 GGGATCTCGCTACTTTGCCCAGG + Intronic
900264013 1:1748159-1748181 GGGATCTCGCTACTTTGCCCAGG + Intergenic
900341739 1:2192789-2192811 GGGATCTTGCCATGTTGCCCAGG + Intronic
900398075 1:2461450-2461472 GGGACCTGGCCCCTGGGCACTGG + Intronic
900600580 1:3501121-3501143 GGGGCCTGGCCACCTACCCCAGG + Intronic
900990473 1:6096158-6096180 GGGGCCAGGCCACGTTGCCCTGG - Intronic
901299462 1:8188901-8188923 AGGATCTTGCCACATTGCCCAGG - Intergenic
901352157 1:8607167-8607189 GGGGCTTTGCCACATTGCCCAGG - Intronic
901468149 1:9436651-9436673 AGGACCTTGCCATGTTGCCCAGG - Intergenic
901485486 1:9557505-9557527 GGGATTTCGCCACATTGCCCAGG - Intronic
901498166 1:9634488-9634510 GGGGCCTCGCCATGTTGCCCAGG + Intergenic
901611902 1:10505277-10505299 GGCACCTCGTCACGTTGCCCAGG - Intronic
901760111 1:11465524-11465546 GGGGTCTTGCTACTTTGCCCAGG + Intergenic
901834011 1:11911999-11912021 GGGGCCTCGCCATGTTGCCCGGG - Intergenic
901940864 1:12660618-12660640 GGGTCCTGCCCACTTAGCCTGGG - Intronic
902352519 1:15868023-15868045 GGGATTTTGCCACGTTGCCCAGG + Intronic
902748287 1:18488221-18488243 GGGATTTTGCCACATTGCCCGGG - Intergenic
903162503 1:21499260-21499282 GGGATTTTGCCACATTGCCCAGG + Intergenic
903371711 1:22840650-22840672 GGGATCTTGCCATGTTGCCCAGG + Intronic
903602538 1:24553339-24553361 GGGACCTTGCCATGTTGCCCAGG + Intergenic
903630762 1:24768166-24768188 GGGATCTTGCCATGTTGCCCAGG + Intronic
903686195 1:25134047-25134069 GGGATCTTGCCAAGTTGCCCAGG + Intergenic
903793792 1:25913138-25913160 GGGGTCTCACCACTTTGCCCAGG + Intergenic
904637089 1:31890533-31890555 GGGGCCTTGCCATGTTGCCCAGG - Intergenic
904639687 1:31915729-31915751 GAGATCTCGCCACATTGCCCAGG + Intronic
905139423 1:35829966-35829988 GGGGTCTTGCCACATTGCCCAGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
906375648 1:45294500-45294522 GGGATCTTGCCATGTTGCCCAGG + Intronic
906384670 1:45357653-45357675 GGGATTTTGCCACTTTCCCCAGG - Intronic
906421880 1:45675730-45675752 GGGTCTTGGCCATGTTGCCCAGG + Intronic
906961137 1:50420052-50420074 TGGACCTGGCCACTTCTCCACGG - Intronic
907200472 1:52722425-52722447 GGGATTTTGCCATTTTGCCCAGG + Intergenic
907468488 1:54655569-54655591 GGGGCCTTGCTACGTTGCCCAGG + Intronic
907542089 1:55224954-55224976 GGGGTCTGGCTACATTGCCCAGG - Intergenic
910222711 1:84904400-84904422 GGGGTCTTGCCACATTGCCCAGG - Intergenic
911208543 1:95117281-95117303 GGGCCCCGCCCACTTTGGCCAGG + Intergenic
912347073 1:108973688-108973710 GGGATCTTGCCATGTTGCCCAGG - Intronic
912542558 1:110428151-110428173 GGGATCTTGCCATGTTGCCCAGG - Intergenic
912833433 1:112973826-112973848 AGGGTCTTGCCACTTTGCCCAGG - Intergenic
912998267 1:114553465-114553487 GGGATCTTGCTACGTTGCCCAGG + Intergenic
913368392 1:118068808-118068830 GGGACCTTGCTATGTTGCCCAGG + Intronic
913659967 1:120998104-120998126 GGGATCTTGCCATGTTGCCCAGG - Intergenic
913714639 1:121520950-121520972 GGGACCTTGCTATTTTGCCCAGG - Intergenic
914348757 1:146821834-146821856 GGGGTCTTGCCACTTTGCTCAGG - Intergenic
914780980 1:150784740-150784762 GGGACCTTGCCATGTTACCCAGG - Intergenic
914976537 1:152368944-152368966 GTGACCTGGAAACTTTCCCCAGG - Intergenic
915030302 1:152874261-152874283 GGGATTTTGCCACATTGCCCAGG - Intergenic
915188593 1:154128657-154128679 GGGATTTTGCCACATTGCCCAGG - Intronic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
916449015 1:164901898-164901920 GGCATCTTGCCACGTTGCCCAGG + Intergenic
917347149 1:174040012-174040034 AGGATCTCGCCACATTGCCCAGG - Intergenic
917605633 1:176625827-176625849 GGGATCTTGCCATGTTGCCCAGG - Intronic
917782997 1:178419477-178419499 GGGGTCTCGCCATTTTGCCCAGG + Intronic
917943421 1:179946007-179946029 GAGACCAGGTCACATTGCCCAGG - Intergenic
918043038 1:180924704-180924726 GGGACCTGGTGGCTTTGCTCTGG - Intronic
918147999 1:181774786-181774808 TGCACCTGGCCACTTGGCCTGGG + Intronic
919112811 1:193241704-193241726 GGCACCTGAGCACTTTTCCCAGG - Intronic
919620826 1:199862846-199862868 GGGACCTGGCCATTCTGCTGTGG - Intergenic
919642043 1:200055084-200055106 GGGATCTTGCGACGTTGCCCAGG + Intronic
919725609 1:200880929-200880951 GGGGTCTGTCCATTTTGCCCAGG + Intergenic
919804603 1:201373763-201373785 GGGATTTTGCCACATTGCCCAGG + Intronic
920557078 1:206911922-206911944 GGGACCTTGCCCCTTTGAGCTGG + Exonic
920926696 1:210348290-210348312 GGGATCTGGCTATGTTGCCCAGG + Intronic
922239799 1:223748211-223748233 GGGAGGTGGGCACTGTGCCCAGG + Intronic
922425060 1:225484825-225484847 GGGGTCTGGCCATGTTGCCCGGG - Intergenic
922471105 1:225877834-225877856 GGGATCTGCCCACTGTGTCCTGG - Intronic
923124663 1:231024731-231024753 GGGGCCTTGCCATCTTGCCCAGG + Intronic
923198394 1:231689521-231689543 GGGGCCTCGCCATGTTGCCCAGG + Intronic
923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG + Intronic
924284402 1:242470953-242470975 GAGACCTGGCCACATTGTCTTGG - Intronic
924472313 1:244353351-244353373 AGGACCTTGCTACGTTGCCCGGG - Intronic
924484604 1:244468725-244468747 GGGGTCTGGCCATGTTGCCCAGG - Intronic
924615970 1:245612302-245612324 GGGACCTTGCTATGTTGCCCAGG + Intronic
924672468 1:246143473-246143495 GGGATTTTGCCACATTGCCCCGG - Intronic
924804375 1:247350650-247350672 GAGGTCTGGCTACTTTGCCCAGG - Intergenic
1063263005 10:4411276-4411298 GGGAGCTGGCCACTCCACCCTGG + Intergenic
1063692237 10:8297638-8297660 GGGATTTTGCCACATTGCCCAGG + Intergenic
1063712912 10:8497450-8497472 GGGACCTTGCTATGTTGCCCAGG - Intergenic
1063794902 10:9502876-9502898 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1063923140 10:10951326-10951348 GGGTTCTTGCCACATTGCCCAGG + Intergenic
1063977819 10:11431045-11431067 GGGAGCTGCTGACTTTGCCCAGG - Intergenic
1064109554 10:12526724-12526746 GGGGCTTCGCCACATTGCCCAGG - Intronic
1064371187 10:14752738-14752760 GGGGTCTCGCCACATTGCCCAGG - Intronic
1064542923 10:16423392-16423414 GGGATCTCGCTACATTGCCCAGG - Intergenic
1064660838 10:17605983-17606005 GGGATCTTGCCATGTTGCCCAGG - Intronic
1065312823 10:24432644-24432666 GGGATCTTGCTACATTGCCCAGG + Intronic
1065733650 10:28731871-28731893 GGGATCTCGCCATGTTGCCCAGG + Intergenic
1065796096 10:29309685-29309707 GGGATCTTGCTACGTTGCCCAGG + Intronic
1065875546 10:29994483-29994505 GGGGTCTGGCTACATTGCCCAGG + Intergenic
1065950925 10:30650344-30650366 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1066091476 10:32025565-32025587 GGGACTTCACCACTTTGGCCAGG + Intronic
1066100463 10:32113424-32113446 GGGGTCTTGCTACTTTGCCCAGG + Intergenic
1066243910 10:33563495-33563517 GGGACCTGACCAACTTGCACAGG + Intergenic
1067405301 10:46017353-46017375 GGGGTCTGGCTATTTTGCCCAGG - Intronic
1068672840 10:59741573-59741595 GGGATTTTGCCACGTTGCCCAGG + Intergenic
1068715367 10:60181621-60181643 GGGACCTTGCCATGTTGGCCAGG - Intronic
1069550736 10:69362267-69362289 GGGATCTTGCCAGGTTGCCCAGG + Intronic
1070254714 10:74804210-74804232 AGGACCTGGCCCTGTTGCCCAGG - Intergenic
1070599048 10:77853172-77853194 GGGATCTTGCCATGTTGCCCAGG + Intronic
1071006702 10:80891687-80891709 GGGGTCTTGCCACATTGCCCAGG + Intergenic
1071354831 10:84784062-84784084 GGCACCTGGCCACTTCCCTCAGG - Intergenic
1071788881 10:88933461-88933483 GGGATCTTGCCATGTTGCCCAGG - Intronic
1071890707 10:90003814-90003836 GGGATTTTGCCATTTTGCCCAGG - Intergenic
1072118179 10:92383458-92383480 GGGATCTCGCCATGTTGCCCAGG + Intergenic
1072696413 10:97607076-97607098 GGGGTCTGGCCATGTTGCCCAGG - Intronic
1072939439 10:99746957-99746979 GGGGTCTTGCCACATTGCCCAGG + Intronic
1073003801 10:100305989-100306011 AGGATCTTGCCACGTTGCCCAGG - Intronic
1073128608 10:101169905-101169927 GGGACCTCGCTATATTGCCCAGG + Intergenic
1073482702 10:103797053-103797075 GGGATCTTGCCGCATTGCCCAGG + Intronic
1074112998 10:110436038-110436060 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1074153694 10:110780978-110781000 GGGACATGGCCACTTTGGAGAGG - Exonic
1074513455 10:114141084-114141106 GGGACCTCGCTATGTTGCCCAGG + Intronic
1075134812 10:119774523-119774545 TGGGCCTGGCTATTTTGCCCAGG + Intronic
1075509516 10:123059575-123059597 GGGGTCTTGCCACATTGCCCAGG - Intergenic
1075761231 10:124858517-124858539 GGGATCTTGCCATATTGCCCAGG - Intergenic
1075960162 10:126561780-126561802 GGGAGCAGGCCCCTTTCCCCGGG + Intronic
1076293590 10:129366445-129366467 GTGGCCTGGTCACTTTCCCCAGG - Intergenic
1076333453 10:129689119-129689141 GGGGTTTAGCCACTTTGCCCAGG + Intronic
1076391183 10:130103613-130103635 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1076648357 10:131969985-131970007 GGGGCTTCGCCACGTTGCCCAGG - Intronic
1076788342 10:132762797-132762819 GGGGTCTTGCCACATTGCCCTGG - Intronic
1077049104 11:558803-558825 GGCCCCTGGCCACCTGGCCCAGG + Intronic
1077532411 11:3103426-3103448 GGAAACAGGCCACTTGGCCCAGG + Intronic
1078276244 11:9850447-9850469 GGGATCTTGCTACATTGCCCAGG + Intronic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1080529323 11:33159402-33159424 GGGATTTTGCCACGTTGCCCAGG - Intronic
1080888090 11:36384860-36384882 GGGATCTGGCTAGATTGCCCAGG + Intronic
1080973773 11:37309855-37309877 GGGACCTCACCATGTTGCCCAGG + Intergenic
1081582547 11:44362218-44362240 GGGACCTGGCGACCTGGACCTGG + Intergenic
1082020143 11:47525886-47525908 GGGTTCTCGCCACATTGCCCAGG - Intronic
1082025225 11:47566289-47566311 GGGGCCTCGCCATGTTGCCCAGG - Intronic
1082026763 11:47578450-47578472 AGGACCTGGCCACTAGGCCGGGG - Intronic
1083179039 11:60972501-60972523 GGCACCTGGCCACCTGGGCCAGG + Intronic
1083466472 11:62850066-62850088 GGGACATGCCTACTATGCCCAGG - Intergenic
1083718264 11:64591484-64591506 TTGCCCTGGCCTCTTTGCCCTGG + Exonic
1083942406 11:65903463-65903485 GGGACCCTGCCACTGTGCCTTGG + Intergenic
1084592990 11:70101183-70101205 TGGACCTGGAAGCTTTGCCCAGG + Intronic
1084730670 11:71071524-71071546 TGGTCCTGGACATTTTGCCCTGG + Intronic
1085421500 11:76365576-76365598 GGCATCTGGCCATGTTGCCCAGG + Intronic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1085590882 11:77759317-77759339 GGCATCTCGCCACATTGCCCAGG - Intronic
1086319286 11:85628200-85628222 GGGAACTCGCCCCTTTGCCCTGG - Intergenic
1088496378 11:110435240-110435262 GGGATCTTGCCATGTTGCCCAGG + Intronic
1089428363 11:118400005-118400027 GGGGTCTTGCCACATTGCCCAGG - Intronic
1089598285 11:119596565-119596587 GGGATTTTGCCACTTTGGCCAGG + Intergenic
1090364209 11:126192636-126192658 GGGAGCGAGCCACTGTGCCCTGG - Intergenic
1090779268 11:129992503-129992525 GGGTCCTGGCCACTTTGCCTAGG - Intronic
1091122490 11:133067667-133067689 TCCACCTGGCCACTTTGCCCAGG - Intronic
1091662354 12:2393912-2393934 GGGATCTGGCTATGTTGCCCGGG - Intronic
1091721451 12:2816981-2817003 GGGATCTTGCCATGTTGCCCAGG + Intronic
1091768533 12:3137282-3137304 GGGCCCTGCCCACGTTTCCCCGG + Intronic
1092213014 12:6660266-6660288 AGGATCTGGCCATATTGCCCAGG - Intronic
1092652419 12:10648755-10648777 GGGGCCTTGCCATGTTGCCCAGG + Intronic
1092844476 12:12571382-12571404 GAGGCCTGGCTACGTTGCCCAGG - Intergenic
1093106134 12:15089821-15089843 GGGATTTGACCATTTTGCCCCGG + Intergenic
1094089201 12:26629393-26629415 GGGACTTCGCCATGTTGCCCAGG - Intronic
1095239975 12:39846641-39846663 GGGATTTTGCCACGTTGCCCAGG + Intronic
1096185310 12:49576369-49576391 GAGGTCTCGCCACTTTGCCCAGG - Intronic
1096371531 12:51073027-51073049 GGGATCTTGCAACGTTGCCCAGG - Intronic
1096765920 12:53889493-53889515 GGGATCTGGCCATTTTGCTCAGG + Intergenic
1097426836 12:59456271-59456293 GGGGTTTCGCCACTTTGCCCAGG + Intergenic
1097853170 12:64434191-64434213 GGGATCTCACCACGTTGCCCAGG + Intronic
1097887628 12:64745409-64745431 GGGGTCTCGCCATTTTGCCCAGG + Intronic
1098150132 12:67538115-67538137 GGGCCCTGGTCACTTTTCCAAGG + Intergenic
1100270056 12:93016125-93016147 GTCACCTGCCCTCTTTGCCCAGG + Intergenic
1100286310 12:93169778-93169800 GGGGTCTTGCTACTTTGCCCAGG - Intergenic
1100572472 12:95856278-95856300 GGGGTCTTACCACTTTGCCCAGG - Intergenic
1100859725 12:98791570-98791592 GGGATCTGGCTATGTTGCCCCGG + Intronic
1101004659 12:100390154-100390176 GGGGTCTCGCCACGTTGCCCAGG + Intronic
1101371774 12:104137712-104137734 GGGCCCTGGCCCCGTAGCCCCGG - Intronic
1101449249 12:104761346-104761368 GGGACCCGCACACTTTGCTCTGG - Exonic
1101675383 12:106912388-106912410 GGGATTTCGCCACATTGCCCAGG + Intergenic
1102022011 12:109689835-109689857 GGGGCCTTGCTACGTTGCCCAGG - Intergenic
1102034044 12:109760853-109760875 AGGCCCTGGCCACCTGGCCCAGG - Intronic
1102045151 12:109825148-109825170 GGGATCTCACCATTTTGCCCAGG - Intronic
1102087934 12:110159270-110159292 GAGACCTTGCCATGTTGCCCAGG - Intronic
1102134285 12:110559917-110559939 GGGTCCTCGCCATGTTGCCCAGG + Intronic
1102467569 12:113138873-113138895 GGGTCCTGGGGACATTGCCCAGG + Intergenic
1102557648 12:113738383-113738405 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1102593685 12:113976264-113976286 GGGATCTTGCCATGTTGCCCCGG - Intergenic
1102886064 12:116522870-116522892 GGGATCTTGTCACGTTGCCCAGG + Intergenic
1103533234 12:121617125-121617147 GGGGTCTTGCCACGTTGCCCAGG - Intergenic
1103605307 12:122081628-122081650 GGGATCTTGCTACATTGCCCAGG - Intronic
1103618145 12:122168478-122168500 GGGATCTCGCCATGTTGCCCAGG + Intronic
1103958426 12:124592600-124592622 GTTGCCTGGTCACTTTGCCCTGG - Intergenic
1104281903 12:127386144-127386166 GGGGTCTTGCCACATTGCCCAGG - Intergenic
1104948988 12:132430311-132430333 GGGAGCTTGCCACCGTGCCCGGG + Intergenic
1106118062 13:26833892-26833914 GGGAATTTGCCACGTTGCCCAGG - Intergenic
1106325557 13:28685300-28685322 GGGGTCTGGCCACTGTGCACAGG - Intergenic
1106514622 13:30442665-30442687 GGGATCTCGCCATGTTGCCCAGG - Intergenic
1107696968 13:43009954-43009976 GGGGTCTCGCCATTTTGCCCAGG + Intergenic
1108371294 13:49771845-49771867 GGGATCTAGCCATGTTGCCCAGG + Intronic
1108816930 13:54304295-54304317 GGGGCTTTGCCATTTTGCCCAGG + Intergenic
1108889273 13:55233002-55233024 CGGATCTTGCCATTTTGCCCAGG - Intergenic
1110236828 13:73225755-73225777 GGGGTCTTGCCACGTTGCCCAGG + Intergenic
1110453814 13:75667781-75667803 GGGAAGTGGCCACTTTCTCCTGG + Intronic
1110798672 13:79669948-79669970 GGGACCTTGCTATATTGCCCAGG - Intergenic
1111768941 13:92571845-92571867 GGGACCTCGCCATGTTGCCCAGG - Intronic
1111949214 13:94697179-94697201 GGGATCTTGCTACATTGCCCAGG - Intergenic
1112364372 13:98744046-98744068 GGGGTCTTGCCACATTGCCCAGG - Intronic
1112499126 13:99928986-99929008 GGGATTTTGCCACGTTGCCCAGG + Intergenic
1112588803 13:100744926-100744948 GGGATTTTGCCACGTTGCCCAGG - Intergenic
1113254632 13:108494628-108494650 GGGGTCTCGCCACGTTGCCCAGG + Intergenic
1113592947 13:111513469-111513491 GGGGTCTTGCCACATTGCCCAGG + Intergenic
1114644291 14:24245677-24245699 GGGGTCTCGCCATTTTGCCCAGG - Intergenic
1115195130 14:30790116-30790138 GGGACCTTGCTATGTTGCCCAGG - Intergenic
1115902149 14:38163861-38163883 GGGATCTTACCACGTTGCCCAGG + Intergenic
1117281464 14:54245592-54245614 GCGACCTTGACACTTTGCCTGGG + Intergenic
1117415478 14:55491539-55491561 GGGATTTTGCCACATTGCCCAGG + Intergenic
1117720012 14:58619928-58619950 TGGATCTGGCCACTTTGGACAGG - Intergenic
1118712267 14:68530250-68530272 GGGGTCTCGCCACATTGCCCAGG - Intronic
1118738137 14:68717157-68717179 GGGACCTTGCTATTTTTCCCAGG + Intronic
1119374088 14:74174812-74174834 GGGACCTTGACATGTTGCCCAGG - Intronic
1119457894 14:74772245-74772267 GGGATCTTGCCATGTTGCCCAGG + Intronic
1119465183 14:74851979-74852001 GGGGCCTCACCACATTGCCCAGG + Intronic
1119647391 14:76357705-76357727 GGGATCTTGCTACATTGCCCAGG + Intronic
1119820353 14:77610475-77610497 GGGGTCTCGCCACGTTGCCCAGG + Intronic
1120273751 14:82347197-82347219 GGGGTCTTGCCACGTTGCCCAGG + Intergenic
1121008609 14:90506499-90506521 AGGATCTGGCTACATTGCCCAGG + Intergenic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1121495791 14:94390665-94390687 AGGAACTGGGCACTGTGCCCAGG - Exonic
1121914995 14:97830638-97830660 GAGACATGGCAACTTTGACCAGG - Intergenic
1122186032 14:99996840-99996862 GGGATCTAGCCATGTTGCCCAGG + Intronic
1123929654 15:25158832-25158854 GGGACCTGGCAATTGTACCCAGG + Intergenic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1124346680 15:28927616-28927638 GGGACTTTGCCATGTTGCCCAGG + Intronic
1124649623 15:31465189-31465211 GGGCGGTGGCCACTTTCCCCTGG - Intergenic
1125080741 15:35669850-35669872 GGGATCTGGCTACGTTGCCCAGG - Intergenic
1125714305 15:41810513-41810535 GGGATCTTGCCACGTTGCCCAGG - Intronic
1126156532 15:45570742-45570764 GGGACCTTGCTATGTTGCCCAGG + Intergenic
1126773675 15:52081617-52081639 GGGATTTTGCCATTTTGCCCAGG + Intergenic
1127070672 15:55285871-55285893 TGGCCCTGCCCAGTTTGCCCAGG + Intronic
1127108099 15:55639164-55639186 GGGATCTGGCTATGTTGCCCAGG + Intronic
1127407170 15:58662535-58662557 GAGATCTGGCTAGTTTGCCCAGG + Intronic
1127422731 15:58823480-58823502 GGGATCTTGCTACATTGCCCAGG - Intronic
1127541588 15:59944322-59944344 GGGGTCTGGCCATCTTGCCCAGG - Intergenic
1127589346 15:60408042-60408064 GGGATCTTGCCTTTTTGCCCAGG - Intergenic
1127611422 15:60641141-60641163 GGGGTCTCGCCACATTGCCCAGG + Intronic
1128183933 15:65628148-65628170 GGGACCTCACCATGTTGCCCAGG + Intronic
1128419912 15:67482030-67482052 GGGATCTTGCCATGTTGCCCAGG - Intronic
1128760616 15:70213960-70213982 GGGACCTGGCCTCTATCCTCAGG - Intergenic
1129628720 15:77234055-77234077 GGGATCTTGCCAACTTGCCCTGG + Intronic
1129716392 15:77853791-77853813 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1130738201 15:86571862-86571884 GGGACCTGCCTCCTTCGCCCAGG + Intronic
1131991739 15:98099549-98099571 GGGATCTGGCTGCTGTGCCCAGG - Intergenic
1132181629 15:99757783-99757805 GGGACCTCGTCATGTTGCCCAGG + Intergenic
1132350044 15:101133786-101133808 GGCACCTGGCAGCTGTGCCCCGG - Intergenic
1132717507 16:1299282-1299304 GTGAGCTGGGCACTTTTCCCAGG - Intergenic
1132768561 16:1547866-1547888 GGGGTCTTGCCACGTTGCCCAGG + Intronic
1132914695 16:2337574-2337596 GGGATCTTGCCATGTTGCCCAGG + Intronic
1133791096 16:9009677-9009699 GGGACCTTGCTATGTTGCCCAGG + Intergenic
1133993316 16:10727584-10727606 GGGGTCTCGCCACGTTGCCCAGG - Intergenic
1134414675 16:14033206-14033228 GGGGCCTTGCTACATTGCCCAGG - Intergenic
1134562435 16:15222145-15222167 GGGATCTAGCTACATTGCCCAGG - Intergenic
1134632883 16:15769618-15769640 GGGATCTTGCCATGTTGCCCAGG + Intronic
1134922977 16:18133772-18133794 GGGATCTAGCTACATTGCCCAGG - Intergenic
1135022077 16:18971108-18971130 GAGATCTGGCCATGTTGCCCAGG + Intergenic
1135069744 16:19341414-19341436 GGGGTCTGGCCATGTTGCCCAGG - Intergenic
1135292421 16:21251295-21251317 GGGGTCTTGCCACATTGCCCAGG + Exonic
1135535315 16:23289361-23289383 GGGATCTTGCTACATTGCCCAGG - Intronic
1135602335 16:23794038-23794060 GGAGTCTGGCCACGTTGCCCAGG + Intergenic
1135633429 16:24054166-24054188 GGGATCTGGCTATGTTGCCCAGG + Intronic
1135645691 16:24159800-24159822 GGGATCTTGCCATGTTGCCCAGG - Intronic
1135731937 16:24901891-24901913 GGGATCTTGCCATGTTGCCCAGG - Intronic
1136020659 16:27437853-27437875 GGGATCTTGCCATGTTGCCCAGG + Intronic
1136042134 16:27588081-27588103 AGGATCTCGCCATTTTGCCCAGG + Intronic
1136101828 16:28002427-28002449 GGGATCTTGCCACGTTGCCCAGG - Intronic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1136588012 16:31200308-31200330 GGGATTTTGCCACGTTGCCCAGG - Intergenic
1136612633 16:31376427-31376449 GGGACCTCGCTATATTGCCCAGG - Intronic
1137496569 16:48973765-48973787 AGGACCTGTCCACTCAGCCCTGG - Intergenic
1137625294 16:49903913-49903935 GAGATCTTGCCACATTGCCCAGG + Intergenic
1138365412 16:56472159-56472181 GGGATCTTGCCATGTTGCCCAGG + Intronic
1138457512 16:57129876-57129898 GAGACCTGGCCACCTGGGCCAGG + Intronic
1138480958 16:57303237-57303259 AGGATCTTGACACTTTGCCCAGG + Intergenic
1138511626 16:57512049-57512071 GGGATTTGGCCATGTTGCCCAGG + Intergenic
1138562714 16:57811529-57811551 GGGGTCTTGCCACGTTGCCCAGG - Intronic
1139146340 16:64329844-64329866 CGGATCTGGCTACATTGCCCAGG - Intergenic
1139382461 16:66542092-66542114 GGGACCTTGCCAGTTTCCCGAGG - Intronic
1139491052 16:67286228-67286250 GGGAGCTGGCCCCTTTGCACTGG + Intronic
1139517051 16:67458360-67458382 GAGACCTGGCCACCCAGCCCTGG + Intronic
1139706620 16:68745288-68745310 GGGGTCTCGCCACGTTGCCCAGG - Intronic
1139985279 16:70893714-70893736 GGGGTCTTGCCACTTTGCTCAGG + Intronic
1140433439 16:74924810-74924832 GGGATCTTGCCATGTTGCCCGGG + Intronic
1140463168 16:75157977-75157999 GGGATCTCGCCAGGTTGCCCAGG + Intronic
1140488203 16:75311332-75311354 GGGATCTTGCTATTTTGCCCAGG + Intronic
1140923372 16:79560100-79560122 GGGGTCTTGCTACTTTGCCCAGG + Intergenic
1141115362 16:81304042-81304064 GGGATCTCACCATTTTGCCCAGG - Intergenic
1141215655 16:82020821-82020843 GGAACCTCGCCCTTTTGCCCAGG - Intergenic
1142325394 16:89411603-89411625 GGGGTCTTGCCACGTTGCCCAGG + Intronic
1142397076 16:89838206-89838228 GGGATCTTACCACATTGCCCAGG + Intronic
1143425348 17:6831775-6831797 GGAACCAGCCCTCTTTGCCCTGG - Intergenic
1143443657 17:6995228-6995250 GGGAACTGGCCACGTAGGCCAGG + Intronic
1143487076 17:7261132-7261154 GGGACCTGCCCGCTTGGCCCAGG - Intronic
1143525762 17:7471376-7471398 GGGGTCTTGCCACGTTGCCCAGG + Intronic
1143654000 17:8282532-8282554 GGGGTCTGGCTACATTGCCCAGG + Intergenic
1143703118 17:8676165-8676187 GGGATCTCGCCATTTTGCCCAGG + Intergenic
1144140173 17:12340578-12340600 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1144785442 17:17828722-17828744 GGGGCCTTGCTACATTGCCCAGG - Intronic
1145033461 17:19523258-19523280 GGGATCTTGCTACGTTGCCCAGG + Intronic
1145110765 17:20159252-20159274 GGGATCTTGCCATGTTGCCCAGG + Intronic
1145188737 17:20820145-20820167 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1145267175 17:21385514-21385536 GGGACCTGGCCGCTCTGACTGGG - Intronic
1146044436 17:29492074-29492096 GGGGCTTTGCCACATTGCCCAGG + Intronic
1146178521 17:30682353-30682375 GGGGTCTTGCTACTTTGCCCAGG + Intergenic
1146516721 17:33495361-33495383 TGGACATGGCTTCTTTGCCCAGG - Intronic
1146906096 17:36618732-36618754 GGGACCTGGTCAGTTGGCTCTGG - Intergenic
1147220159 17:38923933-38923955 GGGGTCTTGCCATTTTGCCCAGG - Intergenic
1147230601 17:39015164-39015186 GGAATTTTGCCACTTTGCCCAGG - Intergenic
1147814504 17:43199264-43199286 GGGATTTCGCCACGTTGCCCAGG + Intronic
1148550408 17:48546888-48546910 TGTCGCTGGCCACTTTGCCCAGG - Intergenic
1148651085 17:49250476-49250498 GGGGTCTCGCCACGTTGCCCAGG - Intergenic
1148661504 17:49337140-49337162 GGGATCTCGCCATGTTGCCCAGG - Intronic
1148675877 17:49444661-49444683 GGGGTCTTGCCACATTGCCCAGG + Intronic
1148881356 17:50730161-50730183 GGGGTCTTGCCACGTTGCCCGGG + Intronic
1149605610 17:57923015-57923037 CGGGCCTTGCCACATTGCCCAGG + Intronic
1149701261 17:58656998-58657020 GGGATCTTGCTACATTGCCCAGG + Intronic
1149754264 17:59174624-59174646 GGGATCTCGCCATGTTGCCCAGG + Intronic
1149804744 17:59605768-59605790 GGGATCTCACCACATTGCCCAGG - Intronic
1149874249 17:60215161-60215183 GGGTCTTGGCCATATTGCCCTGG + Intronic
1150052138 17:61975110-61975132 GGGGTCTTGCTACTTTGCCCAGG - Intronic
1150088034 17:62292412-62292434 GGGTCTTGGCCATGTTGCCCTGG + Intergenic
1150192822 17:63261038-63261060 AGGGCCTTGCCACATTGCCCAGG - Intronic
1150232348 17:63563015-63563037 GGGATCTCGCCATATTGCCCAGG + Intronic
1150238790 17:63615269-63615291 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1150356258 17:64487808-64487830 GGGATCTTGCCATGTTGCCCAGG - Intronic
1150424337 17:65065449-65065471 GGGATCTCGCCATGTTGCCCAGG - Intergenic
1150481086 17:65511793-65511815 GGGGCTTTGCCACGTTGCCCAGG + Intergenic
1150552557 17:66224277-66224299 GGGCCTTTGCCACATTGCCCAGG - Intronic
1150778009 17:68097399-68097421 GGGATTTTGCCACGTTGCCCAGG + Intergenic
1151524583 17:74655723-74655745 GGGGTTTTGCCACTTTGCCCAGG - Intergenic
1151599608 17:75098111-75098133 AGGAGCTGGCCACCATGCCCAGG - Exonic
1151609226 17:75160933-75160955 GGGATCTTGCCACATTGCCCAGG - Intronic
1151701073 17:75742837-75742859 GCGACCTGGCCACGTGGCCTGGG + Intronic
1151823072 17:76507563-76507585 GGCATCTGGCCACGTTGCCCAGG - Intergenic
1151895133 17:76974966-76974988 GGGACCTGCCCACTTCTGCCGGG - Intergenic
1152086425 17:78222004-78222026 GAGGTCTGGCCACATTGCCCAGG - Intronic
1152091903 17:78251889-78251911 GGGACCTCTCCACATAGCCCTGG - Intergenic
1152121481 17:78421520-78421542 GCGGCCTGGCCACAGTGCCCTGG + Intronic
1152181976 17:78828030-78828052 GGGGTCTGGCCATGTTGCCCAGG - Intronic
1152204133 17:78965048-78965070 GGGGTCTTGCTACTTTGCCCAGG - Intergenic
1152243310 17:79171651-79171673 TAGATCTTGCCACTTTGCCCAGG + Intronic
1154270578 18:12915054-12915076 GGGATCTCGCCATGTTGCCCAGG - Intronic
1155029702 18:21973518-21973540 GGGGTCTCGCCACGTTGCCCAGG + Intergenic
1155526050 18:26717264-26717286 GGGCCCCTGACACTTTGCCCAGG + Intergenic
1156864456 18:41873411-41873433 GGGGCCTGGTCACTCTGCTCAGG - Intergenic
1157174518 18:45439091-45439113 GGCACCTGGCCATATTGCCTAGG - Intronic
1157620625 18:49015385-49015407 GGGGTCTTGCCACGTTGCCCAGG + Intergenic
1157669004 18:49512567-49512589 GGGATCTCGCTACATTGCCCAGG - Intergenic
1157890782 18:51415651-51415673 GGGGTCTTGCCACGTTGCCCAGG - Intergenic
1158886036 18:61828448-61828470 GGGATCTTGCCATGTTGCCCAGG + Intronic
1159031924 18:63240178-63240200 GGGGTCTTGCCACCTTGCCCAGG + Intronic
1159184875 18:64956719-64956741 GGCTCCAGGCCACTTTACCCAGG - Intergenic
1159857605 18:73607718-73607740 GGGGTCTGGCCATGTTGCCCAGG + Intergenic
1160221065 18:76978179-76978201 GGGATCTCGCCATGTTGCCCAGG - Intergenic
1160683160 19:421725-421747 GGGGCCTTGCCACGTTGCCCAGG - Intronic
1160761015 19:784487-784509 GGGGTCTCGCCACGTTGCCCAGG + Intergenic
1160775808 19:855180-855202 GGGGCTTTGCCACATTGCCCAGG + Intronic
1160962333 19:1728452-1728474 CAGCCCTGGCCACTTTGCTCAGG + Intergenic
1161095309 19:2387027-2387049 GGGATCTTGCTACATTGCCCAGG - Intergenic
1161171574 19:2814869-2814891 GGGGTCTTGCCACGTTGCCCAGG - Exonic
1161261821 19:3341981-3342003 GGGATTTCGCCACTTTGGCCAGG - Intergenic
1161350502 19:3788650-3788672 GGGATCTGGCTATGTTGCCCAGG + Intronic
1161366136 19:3880834-3880856 GGGCGCTGGCCACGTCGCCCTGG + Exonic
1161608338 19:5227241-5227263 GGGATCTTGCCATGTTGCCCAGG + Intronic
1161611466 19:5245482-5245504 GGGGCCTGGCTATGTTGCCCAGG + Intronic
1161664750 19:5568432-5568454 GGGGCCTGGCCGTGTTGCCCAGG + Intergenic
1161687944 19:5712821-5712843 GGGATCTCGCTACGTTGCCCAGG + Intronic
1161720958 19:5902455-5902477 GGGATCTTGCTATTTTGCCCAGG + Intronic
1161804539 19:6435029-6435051 GGGGTCTGGCCATGTTGCCCAGG - Intergenic
1161825000 19:6557505-6557527 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1161910699 19:7191627-7191649 GGGGTCTGGCTATTTTGCCCAGG - Intronic
1162116524 19:8433025-8433047 GGGGTTTTGCCACTTTGCCCAGG - Intronic
1162151535 19:8649155-8649177 GGGGTCTTGCCACGTTGCCCAGG + Intergenic
1162152166 19:8654424-8654446 GGGACCTCGCCATGTTGCCCAGG - Intergenic
1162306560 19:9878040-9878062 GGGGTCTGGCCACATTGCCCAGG + Intronic
1162322416 19:9977996-9978018 AGGACCTGGCTATGTTGCCCAGG + Intronic
1162626322 19:11887876-11887898 GGGACCTGGTTCCTCTGCCCAGG + Exonic
1162980092 19:14233213-14233235 GGGGTCTTGCTACTTTGCCCAGG - Intergenic
1162995979 19:14335590-14335612 GGGATCTGGCTATGTTGCCCAGG + Intergenic
1163232026 19:16010448-16010470 AGGATTTTGCCACTTTGCCCAGG - Intergenic
1163236112 19:16031590-16031612 GGGACCTGGACATTGTGGCCTGG + Intergenic
1163236124 19:16031633-16031655 GGGACCTGGACATTGTGGCCTGG + Intergenic
1163348441 19:16759683-16759705 GGGGCCTCGCTACGTTGCCCAGG - Intronic
1163428051 19:17249955-17249977 GGGACCTGGTCCCATAGCCCAGG + Exonic
1163533176 19:17862526-17862548 GGGAGCTGGCACCTTTTCCCTGG + Intronic
1163563601 19:18036143-18036165 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1163824863 19:19517401-19517423 GGGATCTCGCCATCTTGCCCAGG + Intronic
1163852216 19:19670563-19670585 GGGGTCTCGCCACTTTGCCCAGG - Intronic
1163863331 19:19753850-19753872 GGGACCTGGCCAGTGGGACCTGG - Intergenic
1164483390 19:28633289-28633311 GGCACCTAACCACTTTTCCCAGG + Intergenic
1164524941 19:29006802-29006824 GGGGCCTTGCCATGTTGCCCAGG + Intergenic
1164654779 19:29912313-29912335 GGGGTCTTGCAACTTTGCCCAGG + Intergenic
1165297818 19:34942249-34942271 GGGGTCTTGCCACATTGCCCAGG - Intronic
1165888212 19:39094629-39094651 GGGATCTTGCCATGTTGCCCAGG - Intronic
1166065023 19:40352769-40352791 GGGATCTCACCACATTGCCCAGG - Intronic
1166327685 19:42061368-42061390 GGGATCTCGCCATGTTGCCCAGG + Intronic
1166646244 19:44533700-44533722 GGGATCTTGCTACATTGCCCAGG - Intergenic
1166689692 19:44814937-44814959 AGGACCTGGCTACGTTGCCCAGG + Intronic
1166773603 19:45299229-45299251 GGGGCTTTGCCACATTGCCCAGG - Intronic
1166835253 19:45663871-45663893 GGGATCTGGCTATGTTGCCCAGG + Intergenic
1166864483 19:45827709-45827731 GGGACCGGGCCCTTTTGTCCAGG - Intronic
1166933106 19:46313429-46313451 GGGTCCTAACCACTTTGCCCAGG - Intronic
1167098336 19:47387976-47387998 GGCATCTGGCCATGTTGCCCAGG + Intergenic
1168044188 19:53782267-53782289 GGGTCTTGGCCATGTTGCCCAGG - Intergenic
1168169079 19:54574456-54574478 GGGAACTGGCCATTCTTCCCAGG - Exonic
1168532692 19:57142331-57142353 GGGATCTCGCCATGTTGCCCAGG + Intronic
925048169 2:790117-790139 GGGACCTGTCCCCTCTGCTCAGG - Intergenic
925370802 2:3344011-3344033 GGGATCTTGCCATGTTGCCCAGG - Intronic
925944483 2:8848060-8848082 GGGGCCTTGCCATGTTGCCCAGG - Intergenic
927016737 2:18971207-18971229 GGGAACTGTCCACACTGCCCAGG - Intergenic
927800769 2:26097023-26097045 GGGGTCTTGCCACGTTGCCCAGG - Intronic
927813401 2:26193318-26193340 GGGGCCTCGCCATGTTGCCCAGG + Intronic
927822191 2:26277425-26277447 GGGATCTCGCCATGTTGCCCAGG + Intronic
927857186 2:26535121-26535143 GGGCTGAGGCCACTTTGCCCAGG + Intronic
928030702 2:27776341-27776363 GGGGCCTGCCCCCATTGCCCAGG + Intronic
928077715 2:28280250-28280272 GGGATCTTGCCATGTTGCCCAGG + Intronic
928440999 2:31291934-31291956 GGGATCTCTCCACGTTGCCCAGG + Intergenic
928457908 2:31440362-31440384 GGGAAGTGGCCATTTTGACCAGG + Intergenic
929185308 2:39087868-39087890 GGGGCTTAGCCACATTGCCCAGG + Intronic
929685277 2:44028082-44028104 GGGGTTTGGCCACGTTGCCCAGG + Intergenic
930784358 2:55256888-55256910 GGGTTCTTGCCATTTTGCCCAGG + Intronic
931312638 2:61096603-61096625 GGGATCTTGCTACATTGCCCAGG + Intronic
931652568 2:64481787-64481809 GGGGTCTTGCCACGTTGCCCAGG + Intergenic
932025477 2:68127726-68127748 GGAACCTGGCCACCATGCTCAGG + Intronic
932588668 2:73049444-73049466 GGGGTCTGGCCATGTTGCCCAGG + Intronic
932610357 2:73194637-73194659 GGGACATTGCCATGTTGCCCAGG - Intergenic
937035851 2:118781291-118781313 GGGATCTGGCTATGTTGCCCAGG + Intergenic
937314539 2:120922677-120922699 GGCACATTGCCACTCTGCCCTGG + Intronic
939902652 2:147868822-147868844 GGGATCTTGCCATGTTGCCCAGG + Intronic
940229071 2:151430843-151430865 GGGATTTGACCACGTTGCCCGGG + Intronic
940695582 2:156973534-156973556 GGGACATGGCCATTTTGCTGAGG + Intergenic
941928973 2:170922566-170922588 GGGATCTTGCTAGTTTGCCCAGG - Intergenic
943747908 2:191481304-191481326 GGGACCTTGCTATGTTGCCCAGG + Intergenic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
944441727 2:199750160-199750182 GGGATCTTGCCATGTTGCCCAGG - Intergenic
945477106 2:210296591-210296613 AGGACCTTGCCATGTTGCCCAGG - Intronic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
946269251 2:218576774-218576796 GGGACCTTCCCACGTTGGCCAGG - Intronic
946293513 2:218764672-218764694 GGGATCTGGCCATGTTGCCCAGG + Intergenic
947746416 2:232509894-232509916 GGGATCTCGCCATCTTGCCCAGG + Intergenic
947855890 2:233324198-233324220 GGGGTCTCGCCACGTTGCCCGGG - Intronic
948248156 2:236503770-236503792 GGGACCTGGGCACCATGCCTCGG + Intronic
948701809 2:239765318-239765340 GGAAGCTGGCCACGTTGCTCTGG - Intronic
948998099 2:241594531-241594553 GGGGTCTTGCCACATTGCCCAGG - Intronic
949078191 2:242074686-242074708 GGGCTCTCGCCACGTTGCCCAGG - Intergenic
1169785648 20:9356922-9356944 GGGGTCTGGCCATGTTGCCCAGG - Intronic
1169833537 20:9852524-9852546 AGGCTCTGGCCACATTGCCCAGG - Intergenic
1170615896 20:17950687-17950709 GGAACATGGCCACTTAGCCTTGG + Intronic
1171509814 20:25672792-25672814 GGGATTTTGCCACTTTGGCCAGG + Intergenic
1172133952 20:32674838-32674860 GGGATCTTGCCATTTTGCCTAGG + Intergenic
1172365175 20:34343621-34343643 GGTATCTGGCCATGTTGCCCAGG + Intergenic
1172373048 20:34410656-34410678 GGGAACTCGCTACTTTGCCCTGG - Intronic
1172547917 20:35775999-35776021 GAGATCTTGCCATTTTGCCCAGG + Intronic
1172704341 20:36872109-36872131 GTGACCTGGGCACATTCCCCAGG + Intergenic
1172798188 20:37557789-37557811 GGGGTCTTGCCACGTTGCCCAGG - Intergenic
1172958935 20:38783541-38783563 GGGGCCTTGCTACATTGCCCAGG - Intergenic
1173487888 20:43455106-43455128 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1173737062 20:45369808-45369830 AGGGCTTTGCCACTTTGCCCAGG + Intronic
1173791808 20:45832948-45832970 GGGATTTGGCCATGTTGCCCAGG - Intronic
1173994898 20:47330393-47330415 TGGGTCTTGCCACTTTGCCCAGG + Intronic
1174356264 20:50000122-50000144 GGGGTCTTGCCACATTGCCCAGG + Intergenic
1174460559 20:50679449-50679471 GGGATCTTGCCATGTTGCCCAGG - Intronic
1174516940 20:51099980-51100002 GGTCCCTGGCCACTGGGCCCTGG + Intergenic
1175103162 20:56594667-56594689 GGGATCTGGCTATGTTGCCCAGG - Intergenic
1175118339 20:56699858-56699880 GGGATCTTGCCATATTGCCCAGG + Intergenic
1175173044 20:57093126-57093148 GGCACCTGGCCTCCCTGCCCAGG - Intergenic
1176229342 20:64023828-64023850 GGGCACTGCCCACTGTGCCCAGG - Intronic
1177151378 21:17458698-17458720 GGGATTTTGCCACGTTGCCCAGG - Intergenic
1178247747 21:30970447-30970469 GGGGCCTTGCCACATTGTCCAGG + Intergenic
1178507489 21:33174464-33174486 GGGTTCTTGCCACGTTGCCCAGG - Intergenic
1178937548 21:36876096-36876118 GGGGTCTGGCCACTGTGCACAGG - Intronic
1181573103 22:23778519-23778541 GGCACCTGGCCACTGAGGCCTGG - Intronic
1182070660 22:27461523-27461545 GGGTCCTGGCCACCTTGCCTGGG + Intergenic
1182423380 22:30259310-30259332 GGGATCTTGCTATTTTGCCCAGG - Intergenic
1182580925 22:31310431-31310453 GGGGCCTCGCCATGTTGCCCAGG + Intergenic
1182698779 22:32214534-32214556 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1183213575 22:36465503-36465525 GGGGTCTGGCCTCTCTGCCCGGG - Intergenic
1183382217 22:37495951-37495973 GGCACCTGGTCCCTTTGCCCAGG + Exonic
1183735375 22:39642120-39642142 CTGCCCTGGGCACTTTGCCCTGG + Intronic
1184041704 22:41947824-41947846 GGGATCTGGCCATGTTGCCCAGG + Intergenic
1184327857 22:43804565-43804587 GGGATCTTGCCATATTGCCCAGG - Intronic
1184982840 22:48106475-48106497 GGGCTCTGGCCACTCTGCCTCGG + Intergenic
1185377670 22:50489608-50489630 AGGACCTGGCCATGCTGCCCTGG + Exonic
1185380196 22:50504416-50504438 GATACCTGGCCACTTGGCTCTGG + Exonic
949255706 3:2043435-2043457 GGGATCTTGCCATGTTGCCCAGG - Intergenic
949528513 3:4930219-4930241 GGGATCTTGCCATGTTGCCCAGG + Intergenic
949547736 3:5086610-5086632 AGGACTTCGCCACATTGCCCAGG + Intergenic
950068043 3:10129228-10129250 GGGGTCTTGCCACATTGCCCAGG - Intergenic
950100456 3:10353437-10353459 GGGAACTGTCCACTCTGCACTGG + Intronic
950191518 3:10979985-10980007 GGGGTCTTGCTACTTTGCCCAGG + Intergenic
951542379 3:23794436-23794458 GGGATCTTGCCATGTTGCCCAGG - Intergenic
951702015 3:25506412-25506434 GGGGTCTTGCCACGTTGCCCAGG - Intronic
951888969 3:27551553-27551575 GAGATCTGGCCACTGTGCCAAGG - Intergenic
952136434 3:30427530-30427552 GGGGCCTGGCTATGTTGCCCTGG - Intergenic
952452175 3:33442380-33442402 GGGATCTTGCCATGTTGCCCAGG - Intergenic
952566162 3:34661075-34661097 GGGGTCTTGCCATTTTGCCCAGG - Intergenic
952942139 3:38453641-38453663 GGCTCCTGACCACTTTGCCCGGG - Intergenic
953245427 3:41186819-41186841 AGGATCTCGCCACATTGCCCAGG - Intergenic
953595283 3:44306677-44306699 GGAATCTGTCCACATTGCCCAGG - Intronic
954268973 3:49492453-49492475 GGGGCCTTACCACGTTGCCCAGG - Intronic
954280707 3:49575160-49575182 GGGATTTTGCCATTTTGCCCAGG - Intronic
954637617 3:52079766-52079788 CTTTCCTGGCCACTTTGCCCAGG - Intronic
955189552 3:56747629-56747651 GGGATTTTGCCACGTTGCCCAGG - Intronic
956672012 3:71699979-71700001 GGGATCTTGCCACATTGCCCAGG - Intronic
956822078 3:72963118-72963140 GGGGTCTTGCCACGTTGCCCAGG - Intronic
957208326 3:77228570-77228592 GGGACCTGTCCACCTGTCCCAGG + Intronic
957790543 3:84935424-84935446 GGGATCTTGCCATGTTGCCCAGG + Intergenic
958918828 3:100080173-100080195 GGGATCTCGCCATATTGCCCAGG + Intronic
958942775 3:100333934-100333956 GGGGCCTTGCTATTTTGCCCAGG - Intergenic
959086882 3:101860366-101860388 AGGATCTTGCCACCTTGCCCAGG + Exonic
959089854 3:101890160-101890182 AGGACCAGACCACTTTGACCAGG - Intergenic
959919049 3:111850572-111850594 GGGATCTTGCTACATTGCCCAGG - Intronic
960245706 3:115398276-115398298 GGGATCTTGCTACATTGCCCAGG + Intergenic
960420129 3:117435189-117435211 GGGATCTGGCTATGTTGCCCAGG + Intergenic
961132400 3:124481396-124481418 GGGATCTGGCCATGTTGCCCCGG + Intronic
961495762 3:127289689-127289711 GGGGCCTTGCTACGTTGCCCAGG - Intergenic
961947033 3:130701938-130701960 GGGGTCTCGCCACATTGCCCAGG - Intronic
962600660 3:136988546-136988568 GGGACTTCACCACATTGCCCAGG - Intronic
962780316 3:138708632-138708654 GGGGTCTTGCCACATTGCCCAGG + Intronic
963073068 3:141320854-141320876 GGGACCTGTTCACATTGACCAGG + Intergenic
963349234 3:144132179-144132201 GGGATCTTGCCATCTTGCCCAGG - Intergenic
964284274 3:155100825-155100847 GGGGTCTTGCCACATTGCCCAGG - Intronic
966520363 3:180868161-180868183 TGGACCTGGCCACTCTTCTCTGG + Intronic
966561767 3:181328633-181328655 GAGAGCTTGCCACTGTGCCCAGG - Intergenic
966685064 3:182684414-182684436 GGCATCTGGCTACGTTGCCCAGG - Intergenic
968110381 3:196041517-196041539 GGGATCTTGCCATCTTGCCCAGG + Intronic
968386892 4:148415-148437 GGGATTTGGCCAATTTGGCCAGG - Intronic
968809181 4:2792515-2792537 GGGACCTCGCCTCTTGGACCAGG - Intergenic
968853463 4:3100918-3100940 GGGATCTCGCCAGGTTGCCCAGG + Intronic
968888362 4:3350488-3350510 GGGATCTTGCCATGTTGCCCAGG - Intronic
969252242 4:5975678-5975700 GGGATTTGGCCATGTTGCCCAGG + Intronic
969514989 4:7642163-7642185 AGGACCTGGCCTCCTTGCCAAGG + Intronic
969530380 4:7727069-7727091 GAGACCGGGAGACTTTGCCCAGG - Intronic
969620057 4:8274326-8274348 CTGCCCTGGCCACTGTGCCCAGG + Intronic
969649794 4:8459005-8459027 GGGATTTTGCCACGTTGCCCTGG - Intronic
970924331 4:21433408-21433430 GGGGTCTTGCCATTTTGCCCAGG - Intronic
971203140 4:24531519-24531541 AGGGCCTCGCCACGTTGCCCAGG - Intronic
971676796 4:29641642-29641664 GGGGTCTTGCCATTTTGCCCAGG + Intergenic
972306318 4:37833362-37833384 GGGATCTTGCCATATTGCCCAGG - Intronic
972425920 4:38932686-38932708 CAGGCCTGGCCACGTTGCCCAGG + Intronic
972450111 4:39188946-39188968 GGGACCTTGCCATGTTGCTCAGG + Intronic
972581301 4:40397931-40397953 GGCATCTCGCCACGTTGCCCAGG + Intergenic
973586037 4:52392358-52392380 GGGATCTTGCCATGTTGCCCAGG - Intergenic
973705271 4:53574663-53574685 GGGCTCTGGACACTTTGCCTGGG + Intronic
973978853 4:56289478-56289500 GGGATCTTGCCATGTTGCCCAGG - Intronic
974034311 4:56804154-56804176 GAGGCCTGGCCATGTTGCCCAGG - Intergenic
974055644 4:56980115-56980137 GGGGTCTGGCCATGTTGCCCAGG + Intronic
974508434 4:62807170-62807192 GGCACCTGACCACTTCCCCCAGG - Intergenic
975333620 4:73149673-73149695 GGGATCTCACCATTTTGCCCAGG - Intronic
976260244 4:83138406-83138428 GGAATCTTGCCACGTTGCCCAGG - Intergenic
976660006 4:87530917-87530939 GGAAACTGGGCACTTTGCCTAGG + Intronic
976723333 4:88191977-88191999 GGGATTTTGCCACGTTGCCCAGG - Intronic
976818738 4:89180526-89180548 GGGGCTTGGCCATGTTGCCCAGG + Intergenic
978445869 4:108779419-108779441 GGGGTCTCGCCACTTTGGCCAGG + Intergenic
979467261 4:121055023-121055045 GGGATCTTGCCACGTTGCCCAGG + Intronic
979540451 4:121874931-121874953 GGGGCCTTGCTATTTTGCCCAGG - Intergenic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
980856449 4:138446438-138446460 GGGGCCTTGCCATATTGCCCAGG + Intergenic
980931152 4:139184551-139184573 AGGATCTTGCCACGTTGCCCAGG + Intergenic
981965957 4:150603689-150603711 GGGATCTTGCTACATTGCCCAGG + Intronic
983077940 4:163348435-163348457 GGGGCCTGGCTATGTTGCCCAGG - Intronic
983233168 4:165150107-165150129 AGGATCTTGCCACGTTGCCCAGG + Intronic
983266311 4:165511882-165511904 GGGACCTTGCCATGTTGGCCAGG + Intergenic
984096204 4:175437942-175437964 GGGTTCTTGCCCCTTTGCCCAGG - Intergenic
984761383 4:183365767-183365789 AGGATCTTGCCACGTTGCCCAGG - Intergenic
984883234 4:184428604-184428626 GGGATCTCGCCATGTTGCCCAGG - Intronic
985082549 4:186281046-186281068 GGGATCTTGCCATGTTGCCCAGG + Intronic
985866389 5:2517613-2517635 GGGACTTGACAACTGTGCCCCGG + Intergenic
986548304 5:8924097-8924119 GGGTCCTCGCAACTTTGCCTGGG - Intergenic
986730019 5:10628510-10628532 GGGATCTTGCCATGTTGCCCAGG + Intronic
987320950 5:16768865-16768887 GGGGTTTGGCCACATTGCCCAGG + Intronic
987325925 5:16811740-16811762 GGGACTTCGCCAAATTGCCCAGG + Intronic
988448315 5:31312505-31312527 AGGATTTGGCCATTTTGCCCGGG - Intronic
988574289 5:32405007-32405029 GGGATTTGGCCATGTTGCCCAGG + Intronic
988883918 5:35534551-35534573 GGGATCTCGCCACATTGCCCAGG - Intergenic
989051480 5:37324742-37324764 GGCATCTGGCCGCGTTGCCCTGG + Intronic
989963100 5:50439516-50439538 GGGACCTTGCTATGTTGCCCGGG + Intronic
990096211 5:52117117-52117139 GAGTCCTGGCCACTTTGTCTAGG + Intergenic
990805787 5:59659991-59660013 GGGGCCTCGCCATGTTGCCCAGG - Intronic
991689301 5:69211097-69211119 GGGATTTTGCCACGTTGCCCAGG + Intergenic
992032909 5:72741370-72741392 AGGGCCTGGCCATGTTGCCCAGG + Intergenic
992323787 5:75640234-75640256 GGGGCTTTGCCACGTTGCCCAGG + Intronic
992637261 5:78736841-78736863 GGGGCTTGACCACGTTGCCCAGG + Intronic
992639139 5:78753276-78753298 GGGAGCTGGTCAGTCTGCCCTGG - Intronic
992695160 5:79278818-79278840 GGGATCTCGCCATGTTGCCCAGG + Intronic
992749573 5:79849801-79849823 GAACCCTGGCCACTGTGCCCTGG + Intergenic
992792285 5:80224283-80224305 GGGGTTTTGCCACTTTGCCCAGG - Intronic
992840781 5:80690108-80690130 GGGTTCTGGCTATTTTGCCCAGG + Intronic
992907121 5:81357521-81357543 AGGTGCTGGCCAGTTTGCCCCGG - Intronic
992997375 5:82346714-82346736 GGAGCCTGGCCTCTCTGCCCTGG + Intronic
993896500 5:93541563-93541585 GGGACTTTGCAACTTTACCCTGG + Intergenic
994102632 5:95910617-95910639 GTCACCTGGCCTCATTGCCCAGG - Intronic
994110907 5:96003042-96003064 GGGATCTTGCTACATTGCCCAGG - Intergenic
994638499 5:102374479-102374501 GGGATCTTGCTAGTTTGCCCAGG + Intronic
995148717 5:108816908-108816930 GGGATTTTGCCACGTTGCCCAGG - Intronic
995474749 5:112536487-112536509 AGCACCTGGCCACTGTGCACAGG - Intergenic
995531188 5:113093419-113093441 GGGATCTGGCTATGTTGCCCAGG - Intronic
997132447 5:131290669-131290691 GGGATTTGGCCATGTTGCCCAGG + Intronic
997244683 5:132337466-132337488 GGGATTTTGCCAGTTTGCCCAGG + Intronic
997501947 5:134382259-134382281 GGGACCTCGCTATGTTGCCCAGG - Intronic
998282468 5:140824649-140824671 GGGGTCTTGCTACTTTGCCCAGG + Intronic
998310597 5:141126110-141126132 GGGATTTTGCCATTTTGCCCAGG - Intronic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
998865089 5:146491176-146491198 GGGATTTTGCCACGTTGCCCAGG + Intronic
999229029 5:150050670-150050692 GGGGTTTGGCCATTTTGCCCAGG + Intronic
1001429312 5:171646905-171646927 GTGAGCTGGGCACTGTGCCCGGG + Intergenic
1001582424 5:172807847-172807869 GGGATCTTGCTACGTTGCCCGGG - Intergenic
1002465447 5:179406062-179406084 GGGACCTGTCCAGCTTCCCCAGG - Intergenic
1002542897 5:179917810-179917832 GGGACTTTGCCATGTTGCCCAGG - Intronic
1002606165 5:180384187-180384209 GGGATCTAGCCATGTTGCCCAGG - Intergenic
1002613732 5:180437445-180437467 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1002848845 6:972976-972998 GGGATCTGGCTATCTTGCCCAGG - Intergenic
1002894402 6:1367973-1367995 GGGATGTGGCCATGTTGCCCAGG + Intergenic
1003636304 6:7834647-7834669 GGCACCTCGCTATTTTGCCCAGG - Intronic
1003661823 6:8069395-8069417 GGGACCTGGCCTCTTTGAAGTGG + Intronic
1004623821 6:17355948-17355970 GGGATTTTGCCATTTTGCCCAGG - Intergenic
1005343921 6:24870703-24870725 GGGATTTTGCCACATTGCCCAGG + Intronic
1006426915 6:33970236-33970258 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1006829424 6:36959679-36959701 GGGATCTCGCCATGTTGCCCAGG - Intronic
1006981909 6:38154107-38154129 CAGACCTGGCCCCTCTGCCCTGG - Exonic
1007025761 6:38571765-38571787 GGGGCCTTGCCATGTTGCCCAGG - Intronic
1007557240 6:42776537-42776559 GGGATCTGACCATGTTGCCCAGG + Intronic
1008621205 6:53273193-53273215 GTGACTTGGCCTCTTTCCCCAGG - Intronic
1008878419 6:56354688-56354710 GGGATCTTGCCATGTTGCCCAGG - Intronic
1009415729 6:63414721-63414743 GGGATTTGGCCATGTTGCCCAGG - Intergenic
1010198915 6:73265893-73265915 GGGATCTCGCCATGTTGCCCAGG - Intronic
1010210839 6:73362085-73362107 GGGGCCTGGCTATGTTGCCCAGG - Intergenic
1011457782 6:87570609-87570631 GGGGCCTTGCCATTTTGGCCAGG + Intronic
1012800302 6:103819163-103819185 GGGATTTTGCCACGTTGCCCAGG + Intergenic
1012853166 6:104470787-104470809 GGGATCTCGCTACATTGCCCAGG - Intergenic
1013039983 6:106423894-106423916 GGGGCTTTGCCACATTGCCCAGG + Intergenic
1013202234 6:107910272-107910294 GGGGTCTTGCCACGTTGCCCAGG - Intronic
1013501645 6:110757998-110758020 GGGGTCTTGCCACGTTGCCCAGG - Intronic
1013729962 6:113153936-113153958 GGGATTTTGCCACTTTGGCCAGG + Intergenic
1014196313 6:118563640-118563662 GGGGTCTGGCCATGTTGCCCAGG + Intronic
1014248162 6:119089492-119089514 GGGATCTTGCTACATTGCCCAGG + Intronic
1014440663 6:121470209-121470231 GGGACCTGGCTGTTTTGCCCAGG - Intergenic
1014441066 6:121474394-121474416 GGGGTCTGGCCATGTTGCCCAGG + Intergenic
1015936049 6:138406833-138406855 GGGGCCTTGCCATGTTGCCCAGG - Intronic
1016199978 6:141395009-141395031 GGGACCTGCCCCTTCTGCCCAGG - Intergenic
1016323788 6:142876829-142876851 GGGATTTGGCCACGTTGCCCAGG - Intronic
1016941516 6:149486128-149486150 GGGATTTGGCCATGTTGCCCAGG - Intergenic
1017092484 6:150772426-150772448 GGGATTTCGCCACGTTGCCCAGG - Intronic
1017167359 6:151421921-151421943 GGGGTCTGGCCATGTTGCCCAGG - Intronic
1017935165 6:158999357-158999379 GGGGTCTGGCCCCTTCGCCCTGG - Intronic
1018005944 6:159621979-159622001 GAGGCCTTGCTACTTTGCCCAGG + Intergenic
1018199296 6:161380261-161380283 GGGACCTGGCCAGTTCTCCACGG - Intronic
1018230813 6:161673491-161673513 GGTGCCTGGCCAATGTGCCCTGG - Intronic
1018694295 6:166379300-166379322 GGGACCTTGCTATGTTGCCCAGG - Intronic
1019192801 6:170263141-170263163 GGGGTCTTGCCACATTGCCCAGG + Intergenic
1019551457 7:1604798-1604820 GGGGTCTTGCCACGTTGCCCAGG - Intergenic
1019606792 7:1913999-1914021 GAGACCTGCCCACGCTGCCCTGG - Intronic
1019973388 7:4560592-4560614 GGGACCTCACCATGTTGCCCAGG + Intergenic
1020044542 7:5031453-5031475 GGGATCTTGCCATGTTGCCCAGG + Intronic
1020289903 7:6715475-6715497 GGGATCTCGCCACGTTGCTCAGG + Intergenic
1020659751 7:10967649-10967671 GGGACCTCGCTACGTTGCCAAGG - Intergenic
1021054149 7:16026453-16026475 GGGGCCTGGCCAGTTGACCCTGG + Intergenic
1022026220 7:26450225-26450247 GGGATCTTGCTAATTTGCCCAGG + Intergenic
1022263242 7:28727775-28727797 GGGCTCTGACCACTCTGCCCAGG + Intronic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1022942619 7:35254573-35254595 TGGACCTGGCCAGTTGGCGCCGG - Intergenic
1023239331 7:38126976-38126998 GGGAGTTGGCCATCTTGCCCAGG + Intergenic
1023428910 7:40069040-40069062 GGGGTTTGGCCACGTTGCCCAGG - Intronic
1023642146 7:42270106-42270128 GGGATCTTGCTACATTGCCCAGG + Intergenic
1023825807 7:44007901-44007923 GGGATCTCGCCACGTTGCCCAGG - Intronic
1023828646 7:44026529-44026551 GGGATTTCGCCACATTGCCCAGG + Intergenic
1026089379 7:67286752-67286774 GGGATCTCACCACGTTGCCCAGG - Intergenic
1026150613 7:67785237-67785259 GGGATCTCGCTACGTTGCCCAGG + Intergenic
1026324110 7:69294098-69294120 GAGGGCTGGCCATTTTGCCCAGG - Intergenic
1026339870 7:69425860-69425882 GGGGTCTTGCTACTTTGCCCAGG - Intergenic
1026724904 7:72863748-72863770 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1026747040 7:73021944-73021966 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1026750690 7:73050087-73050109 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1026754339 7:73078197-73078219 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1026757991 7:73106230-73106252 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1026759625 7:73116770-73116792 GGGATCTTGCTACGTTGCCCAGG + Intergenic
1026953904 7:74364828-74364850 GGGATCTTGCTACGTTGCCCAGG - Intronic
1027033143 7:74906515-74906537 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1027035970 7:74925613-74925635 GGGGTCTTGCCACGTTGCCCAGG - Intergenic
1027087785 7:75276703-75276725 GGGATCTTGCTACGTTGCCCAGG - Intergenic
1027089412 7:75287254-75287276 GGGATCTCGCCACGTTGCCCAGG - Intergenic
1027093057 7:75315182-75315204 GGGATCTCGCCACGTTGCCCAGG - Intergenic
1027096700 7:75343149-75343171 GGGATCTCGCCACGTTGCCCAGG - Intergenic
1027118967 7:75502070-75502092 GGGATCTCGCCACGTTGCCCAGG - Intergenic
1027272854 7:76533539-76533561 GGAATCTCGCCACGTTGCCCAGG + Intergenic
1027322647 7:77024531-77024553 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1027326302 7:77052623-77052645 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1027394683 7:77742136-77742158 GGGTTCTTGCCACGTTGCCCAGG - Intronic
1028710440 7:93901744-93901766 GGGATCTCGCCATGTTGCCCAGG - Intronic
1028980897 7:96967158-96967180 GGGACATGGGCACATTCCCCTGG + Intergenic
1029111703 7:98216070-98216092 TCCACCTGGACACTTTGCCCGGG - Exonic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1029230770 7:99066584-99066606 GGGATCTTGCCATGTTGCCCAGG - Intronic
1029323717 7:99787805-99787827 GGGACCTAGCTATGTTGCCCAGG + Intergenic
1029488384 7:100856971-100856993 GGGAGCCGGCCTCTATGCCCGGG + Exonic
1029539683 7:101175297-101175319 GGGATCTCACTACTTTGCCCAGG + Intronic
1029584896 7:101464155-101464177 GGGATCTTGCCATGTTGCCCAGG + Intronic
1029718525 7:102347947-102347969 GGGATCTCGCCACGTTGCCCAGG + Intergenic
1029738943 7:102480809-102480831 GGGATTTCGCCACGTTGCCCAGG + Intergenic
1029754091 7:102561308-102561330 GGGATCTCGCCACGTTGCCCAGG - Intronic
1029756944 7:102579972-102579994 GGGATTTCGCCACGTTGCCCAGG + Exonic
1029772041 7:102660398-102660420 GGGATCTCGCCACGTTGCCCAGG - Intronic
1029774883 7:102679032-102679054 GGGATTTCGCCACGTTGCCCAGG + Intergenic
1029981063 7:104879526-104879548 GGGATCTTGCCACATTGCCTAGG - Intronic
1030269703 7:107657643-107657665 GGGATCTTGCTATTTTGCCCAGG - Intergenic
1030362549 7:108610277-108610299 GGGGCCTTGCTATTTTGCCCAGG + Intergenic
1031127174 7:117788164-117788186 GGGATTTTGCCATTTTGCCCCGG + Intronic
1031898837 7:127387667-127387689 GGGGTCTTGCCATTTTGCCCAGG - Intronic
1032149173 7:129413030-129413052 GGGACTTTGCCATGTTGCCCAGG + Intronic
1032219735 7:129985137-129985159 AGGATCTTGCCACATTGCCCAGG - Intergenic
1032579206 7:133088383-133088405 GGGGTCTTGCCAGTTTGCCCAGG - Intergenic
1032723259 7:134568084-134568106 GAGACCTTGCCATGTTGCCCAGG - Intronic
1033069961 7:138192949-138192971 GGGGCCTGGCTATGTTGCCCAGG + Intergenic
1034044632 7:147914741-147914763 GGGGTCTTGCCATTTTGCCCAGG + Intronic
1034101821 7:148457297-148457319 GGGACCTCCCCATTTTACCCAGG + Intergenic
1035189550 7:157153783-157153805 GGGATCTCGCCATGTTGCCCAGG - Intronic
1035199798 7:157254846-157254868 GGGATTTCGCCACATTGCCCAGG - Intronic
1035420320 7:158724278-158724300 GGGGCTTTGCCACATTGCCCAGG - Intergenic
1035434583 7:158849973-158849995 GGGGCCTGGCCCTTTTGCCCAGG + Intergenic
1035647980 8:1243029-1243051 GGGAGCTGGCAAGTTTGCCTAGG - Intergenic
1036397075 8:8378666-8378688 GGGATTTGGCCATGTTGCCCAGG - Intronic
1036429976 8:8681150-8681172 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1036570244 8:9974071-9974093 GTGCCCAGGCCACTCTGCCCAGG - Intergenic
1036713672 8:11100243-11100265 GGGGTCTTGCCACGTTGCCCAGG + Intronic
1037724455 8:21471953-21471975 GGGAGCTGGCCACATATCCCTGG - Intergenic
1037845262 8:22276707-22276729 GGGATCTTGCCATGTTGCCCAGG - Intronic
1037918334 8:22786473-22786495 GGGGCCTTGCCATGTTGCCCAGG + Intronic
1038209524 8:25503088-25503110 GGGATCTCACCACGTTGCCCAGG - Intronic
1038422555 8:27442759-27442781 GGGACCTAGCAACCTTGCCCAGG + Intronic
1038588045 8:28809148-28809170 GGGATCTTGCCATGTTGCCCAGG + Intronic
1038822842 8:30968654-30968676 GGGGTCTCGCCACATTGCCCAGG - Intergenic
1038944613 8:32344644-32344666 GGGATTTTGCCACATTGCCCAGG + Intronic
1039467385 8:37794435-37794457 GGGATCTCGCCATGTTGCCCAGG - Intronic
1039484498 8:37900080-37900102 GGGATCTGGCTATGTTGCCCAGG - Intergenic
1039508019 8:38066297-38066319 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1042592907 8:70415109-70415131 GGGGCCTTGCCATGTTGCCCAGG - Intergenic
1043476222 8:80608502-80608524 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1044281832 8:90365560-90365582 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1044414016 8:91915716-91915738 GGGATTTTGCCACGTTGCCCAGG - Intergenic
1044987001 8:97764618-97764640 GGGACCTGGGCACTGTGACCTGG + Intergenic
1044989095 8:97779591-97779613 GGGATCTTGCCATGTTGCCCAGG - Intronic
1044997186 8:97848626-97848648 GGGGTCTTGCCACGTTGCCCAGG - Intronic
1045183840 8:99816021-99816043 GGGATCTTGCCATGTTGCCCAGG + Intronic
1047427329 8:124758565-124758587 GGGATATGGTCACTTTGCCTGGG - Intergenic
1047434715 8:124826679-124826701 GGGATCTTGCTATTTTGCCCAGG - Intergenic
1047722106 8:127650583-127650605 GGGATCTTGCCAGTATGCCCAGG - Intergenic
1047735851 8:127764456-127764478 GGGATCTGGCTATGTTGCCCAGG - Intergenic
1048010061 8:130448266-130448288 GGGGTCTTGCCATTTTGCCCAGG - Intergenic
1048474004 8:134726798-134726820 GGGATTTTGCCATTTTGCCCAGG + Intergenic
1049527796 8:143137376-143137398 GGGGTCTGGCCATGTTGCCCAGG - Intergenic
1049930494 9:451429-451451 GGGATTTTGCCACATTGCCCAGG - Intronic
1051155948 9:14145843-14145865 GGGGTCTTGCCACATTGCCCAGG + Intronic
1051490292 9:17655880-17655902 GGGTCCAGGTCACTTTGCACAGG + Intronic
1053196401 9:36122493-36122515 GGGATCTTGCTACATTGCCCAGG + Intronic
1056383873 9:86079535-86079557 GGGAACTGGCCACACTGCCCTGG - Intronic
1056398132 9:86200274-86200296 AGGATCTTGCTACTTTGCCCAGG + Intergenic
1056828332 9:89891964-89891986 GTTACCAGGCCACTTTGCCTTGG + Intergenic
1057074120 9:92126253-92126275 GGGATCTTGCTACGTTGCCCAGG - Intergenic
1057085164 9:92203382-92203404 GGGATCTTGCTACGTTGCCCAGG + Intergenic
1057778399 9:98029294-98029316 GGGATCTTGCCACATTGCCTAGG - Intergenic
1057928160 9:99170956-99170978 GGGTCCTGCCCACTTGACCCTGG + Intergenic
1058402215 9:104632501-104632523 GGGATTTTGCCACTTTGCCCAGG + Intergenic
1058681478 9:107444006-107444028 GGGATCTTGCTACGTTGCCCAGG - Intergenic
1059231022 9:112721718-112721740 GTGACCTGCCCACCTTGGCCCGG + Intergenic
1060097320 9:120803457-120803479 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1060155379 9:121316660-121316682 GGGATCTTGCCATGTTGCCCAGG + Intronic
1060364112 9:122991795-122991817 GGGGTCTTGCCACATTGCCCAGG + Intronic
1060650277 9:125319790-125319812 GGGATTTTGCCACGTTGCCCAGG + Intronic
1060703142 9:125777203-125777225 GGGATTTTGCCACGTTGCCCAGG + Intronic
1060824851 9:126682117-126682139 GGGCTTTGGCCATTTTGCCCAGG + Intronic
1061050555 9:128192178-128192200 GGGATTTCGCCATTTTGCCCAGG - Intronic
1061111137 9:128572049-128572071 GGGATCTTGCCATGTTGCCCAGG + Intronic
1061183996 9:129041524-129041546 AGGGCCTTGCCATTTTGCCCAGG + Intronic
1061678325 9:132230607-132230629 GGGCCCTGGCCACCCTCCCCAGG - Intronic
1061781227 9:132997144-132997166 GGGATCTGGCTATGTTGCCCAGG - Intergenic
1062079972 9:134618671-134618693 GGGCCCTGGCCGCTTTGCTGAGG + Intergenic
1062301450 9:135874279-135874301 GGGATTTTGCCACGTTGCCCAGG - Intronic
1062593685 9:137287794-137287816 GGGGCTTTGCCACATTGCCCAGG + Intergenic
1062620774 9:137421005-137421027 GGGACCTCGCTATGTTGCCCAGG + Intronic
1185446928 X:262895-262917 AGGACCTGGCTATGTTGCCCCGG - Intergenic
1186044748 X:5523305-5523327 GGGATCTTGCCATTTTGCCCAGG + Intergenic
1186102409 X:6171013-6171035 GGGATTTCGCCACATTGCCCAGG + Intronic
1186162121 X:6788509-6788531 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1186374806 X:8988027-8988049 GGCACCTGACCACTTCCCCCAGG - Intergenic
1186382854 X:9079071-9079093 GGGGCCTTGCCATGTTGCCCAGG - Intronic
1187172453 X:16865191-16865213 GGGATTTTGCCACGTTGCCCAGG - Intronic
1187243736 X:17535771-17535793 GGGATCTTGCTACATTGCCCAGG + Intronic
1187447381 X:19371687-19371709 GGGTCCTGGCCCCTTCTCCCTGG + Intronic
1187899919 X:24017909-24017931 GAGGTCTGGCCACATTGCCCAGG - Intronic
1187904911 X:24056664-24056686 GGGGTTTGGCCACGTTGCCCAGG - Intronic
1187953096 X:24490167-24490189 GGGGTCTTGCCACATTGCCCAGG + Intronic
1188181532 X:27062227-27062249 GGGATCTTGCTACATTGCCCAGG + Intergenic
1188572980 X:31611750-31611772 GGGGCCTTGCCATGTTGCCCAGG + Intronic
1189114849 X:38331771-38331793 GGGGTTTGGCCACATTGCCCAGG + Intronic
1189150389 X:38700381-38700403 GGGATCTTGCCATGTTGCCCAGG - Intergenic
1189292195 X:39894480-39894502 GGTGCCTGGCCACTTTGCTCAGG - Intergenic
1189363703 X:40371961-40371983 GGGATCTCACCACATTGCCCAGG - Intergenic
1190151300 X:47952073-47952095 GGGATCTTGCCATGTTGCCCAGG + Intronic
1190195807 X:48317342-48317364 GGGATTTTGCCACATTGCCCAGG + Intergenic
1190228755 X:48565199-48565221 GGGATTTTGCCACGTTGCCCAGG - Intergenic
1190253658 X:48746651-48746673 GGGACTTCGCCATGTTGCCCAGG + Intergenic
1190268817 X:48846660-48846682 GGGATCTTGCCATGTTGCCCAGG + Intergenic
1190299685 X:49049830-49049852 GGGATCTGGCCATGTTGTCCAGG + Intergenic
1190710218 X:53062732-53062754 GGGATTTGGCCATGTTGCCCAGG + Intronic
1190860651 X:54341568-54341590 GGGACCTCGCTATATTGCCCAGG - Intronic
1191227215 X:58055755-58055777 TGGACCTGACCACTTTCCCCAGG + Intergenic
1192094789 X:68199308-68199330 GGGACCTTGCTATGTTGCCCAGG - Intronic
1192615423 X:72616172-72616194 GGGGTCTGGCCATGTTGCCCAGG - Intronic
1195386948 X:104322629-104322651 GGGACCTTGCTATTTTGCCTAGG + Intergenic
1197089903 X:122523827-122523849 GGTACCTGACCACTTCTCCCAGG + Intergenic
1198064640 X:133084388-133084410 GGGGTCTAGCCACATTGCCCAGG + Intronic
1199727985 X:150603857-150603879 GGGACATGGACACTTTTCCATGG + Intronic
1199998517 X:153043526-153043548 GGGATCTTTCCATTTTGCCCAGG + Intergenic
1200113676 X:153759143-153759165 GGGATCTTGTTACTTTGCCCAGG - Intergenic
1201390201 Y:13489732-13489754 GGCACCTGGGCACTTCTCCCAGG - Intergenic
1201768889 Y:17598603-17598625 AGGACCTTGCCATGTTGCCCAGG + Intergenic
1201832665 Y:18307382-18307404 AGGACCTTGCCATGTTGCCCAGG - Intergenic