ID: 1121106318

View in Genome Browser
Species Human (GRCh38)
Location 14:91282142-91282164
Sequence CAGGGTCTCCATTTTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 481}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121106315_1121106318 -8 Left 1121106315 14:91282127-91282149 CCTCCAAAATGACAACAGGGTCT 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106314_1121106318 -7 Left 1121106314 14:91282126-91282148 CCCTCCAAAATGACAACAGGGTC 0: 1
1: 0
2: 0
3: 19
4: 138
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106305_1121106318 28 Left 1121106305 14:91282091-91282113 CCTGCTAGTTTCTACCTGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106310_1121106318 1 Left 1121106310 14:91282118-91282140 CCTGGGTCCCCTCCAAAATGACA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106308_1121106318 14 Left 1121106308 14:91282105-91282127 CCTGAGAGCAGACCCTGGGTCCC 0: 1
1: 0
2: 0
3: 38
4: 279
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106309_1121106318 2 Left 1121106309 14:91282117-91282139 CCCTGGGTCCCCTCCAAAATGAC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481
1121106313_1121106318 -6 Left 1121106313 14:91282125-91282147 CCCCTCCAAAATGACAACAGGGT 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG 0: 1
1: 0
2: 7
3: 75
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121106318 Original CRISPR CAGGGTCTCCATTTTGGAGA TGG Intronic
901421354 1:9153369-9153391 CAGGGTCACCTGTTTGGAGGAGG - Intergenic
901445225 1:9304306-9304328 CTGGGTCTCCAGCTTGCAGATGG + Intronic
901481230 1:9526738-9526760 CAGAGTCTGCATTCTGGAGCTGG - Intergenic
901838306 1:11938276-11938298 CATCAACTCCATTTTGGAGATGG + Intronic
902407452 1:16192452-16192474 CACCGTCCCCATTTTGCAGATGG + Intergenic
902571285 1:17348432-17348454 CAGGGGCTCCATCTGGGATATGG + Intronic
903608157 1:24590127-24590149 CAGGGTCTTCATTTGAGAGAAGG + Intronic
904078658 1:27858369-27858391 CAGTGTCTGCATTTTACAGATGG + Intergenic
904651529 1:32009464-32009486 CAGGGTCTCCAGCTTGCAGAAGG + Intergenic
904698271 1:32342728-32342750 CAGTGTCTTCATTTTAGAGTGGG - Intergenic
904812928 1:33175518-33175540 CACGCTCCCCATTTTGCAGATGG - Intronic
905460682 1:38120887-38120909 CAGGGTCTTCCTTATGGAGAAGG - Intergenic
905467801 1:38168800-38168822 CTGGGTCTCCAGTTTGCAAATGG + Intergenic
905869837 1:41396857-41396879 CAGGACATCCATTTTAGAGAGGG + Intergenic
906926179 1:50119304-50119326 GAGGGACTTGATTTTGGAGAAGG + Intronic
907500825 1:54878701-54878723 CTGGGTCTCAATTTTTTAGATGG - Intronic
907768543 1:57436675-57436697 CAATGTCTCCATTTTGTAGAGGG - Intronic
907854806 1:58292190-58292212 CTGGGTCTCCAGCTTGCAGATGG + Intronic
908902878 1:68976451-68976473 CAGGATCTCCTTATTGGTGAGGG + Intergenic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
909609279 1:77535837-77535859 GTGGGTCTCCAATCTGGAGATGG - Exonic
910300386 1:85700284-85700306 CATGAGCTCCATTTTGCAGACGG + Intronic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
910393614 1:86769725-86769747 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
910454617 1:87384150-87384172 CAGGGTCTACATTTAGAAGCAGG + Intergenic
910529883 1:88223773-88223795 CAGGGTCTTCATTTGTAAGAGGG + Intergenic
911090981 1:94016595-94016617 CAGCGTCTCACTGTTGGAGAAGG + Intronic
911924549 1:103812129-103812151 CAGGTTCTGCATTTTGGGCATGG + Intergenic
913045045 1:115067156-115067178 CAGGGACTGCACTTTGGAGTAGG - Intronic
914244717 1:145876975-145876997 CAGGAGGTCCACTTTGGAGAAGG + Intronic
914423533 1:147552413-147552435 CAGGGTTTCCATGTTGGTCAGGG - Intronic
916434050 1:164760253-164760275 AAGGGGCACTATTTTGGAGAGGG - Intronic
916552293 1:165860451-165860473 CAGGGTCTCACTTTTTGAGACGG + Intronic
916635327 1:166662006-166662028 CAGGGTCTCCATCTTGCAGATGG + Intergenic
918533396 1:185548238-185548260 AAGGGTCTCCAGCTTGCAGATGG - Intergenic
918845734 1:189609045-189609067 CTGGGTCTCCAGTTTGCAGCTGG - Intergenic
919067063 1:192705791-192705813 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
919411964 1:197257013-197257035 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
920117350 1:203629979-203630001 CAGGCTTTCCATTGTGCAGAGGG - Intronic
921987376 1:221326971-221326993 CATGGTCATCACTTTGGAGATGG - Intergenic
922039607 1:221883833-221883855 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
922528494 1:226325084-226325106 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
922549083 1:226480770-226480792 CAGGGTCTCCAGCTTGCGGATGG + Intergenic
922718660 1:227889359-227889381 CAGGGTATGCATCTGGGAGAGGG + Intergenic
923683057 1:236134889-236134911 CAGGCTCTCCCTTTTGGCCATGG - Intergenic
923791665 1:237116634-237116656 CTGGGTCTCCAGCTTGCAGATGG - Intronic
923906828 1:238394354-238394376 CTGGGTCTCCAGTTTGCAGAAGG - Intergenic
923998825 1:239528034-239528056 GAGGGTCCTCATTTTAGAGATGG - Intronic
924153290 1:241150784-241150806 CTGGTTCTCCAGTTTGCAGAAGG - Intronic
924478066 1:244398891-244398913 CTGGGCCTCCAGTTTGCAGATGG - Intergenic
924806815 1:247367927-247367949 GAGGGACTCCATCTTGAAGATGG + Intergenic
1063717897 10:8546700-8546722 CTGGGTCTCCAACTTGCAGATGG - Intergenic
1063721735 10:8589368-8589390 CAGTTTCTCCATTTGGAAGAAGG + Intergenic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1064114121 10:12563086-12563108 CCGGGTCTCCAGTTTGCAGATGG - Intronic
1064331096 10:14394907-14394929 CCGGGTCTTCAGTTTGAAGACGG + Intronic
1064357688 10:14634664-14634686 AAGGGTCTACATTTGGGAGGAGG + Intronic
1064638610 10:17393253-17393275 CTGGGGCTCCAGCTTGGAGAAGG + Intronic
1064648505 10:17484642-17484664 CTGGGTCTCCAGCTTGCAGAAGG - Intergenic
1064692462 10:17931932-17931954 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1065164443 10:22960482-22960504 CAGGGTCTCTTTTTTAGGGAGGG - Intronic
1065194522 10:23249957-23249979 CAGTTTCTCCATTTTGAAAAAGG + Intergenic
1065407908 10:25389318-25389340 CAGGGTCTCCTCTTTGCTGAGGG + Intronic
1065492828 10:26299347-26299369 CATGGTCTCCATTTTGAACCGGG + Intronic
1065867363 10:29925682-29925704 CTGGGTCTCCAGCTTGCAGAAGG + Intergenic
1065875154 10:29991495-29991517 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1066263546 10:33752687-33752709 CAGGCTTTCCATCTTGAAGAGGG - Intergenic
1066641085 10:37554840-37554862 CTGGGTCCCCGTGTTGGAGAAGG + Intergenic
1066792428 10:39080724-39080746 CAGAGACTCCATTTTGAATAAGG - Intergenic
1067664101 10:48258495-48258517 CAGCATCTCCGTTTTGTAGATGG - Intronic
1067665916 10:48279123-48279145 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1067775212 10:49159487-49159509 CAGGGTTTTTACTTTGGAGAAGG + Intronic
1067823806 10:49554798-49554820 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1067906016 10:50291932-50291954 AAGGGTCTCCATTGTGATGATGG - Intergenic
1069194401 10:65531200-65531222 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1070551044 10:77491036-77491058 CAGTGTCTCCATCTTTGAAATGG - Intronic
1070997671 10:80800198-80800220 CTGGGTCCCCAGTTTGCAGATGG + Intergenic
1071898707 10:90094536-90094558 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1072277786 10:93839826-93839848 CAGGGTCTACAGCTTGCAGATGG - Intergenic
1073854455 10:107658783-107658805 CAGGGTGTCCTTTGTGAAGAAGG - Intergenic
1074219737 10:111424773-111424795 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1074632129 10:115270530-115270552 CTGGGTCTTCAGTTTGCAGACGG - Intronic
1075119902 10:119657133-119657155 CTGGGTCTGGATTTAGGAGATGG + Intronic
1075270705 10:121047715-121047737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1075535844 10:123271495-123271517 CTGGGTCTCCAACTTGCAGATGG + Intergenic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1075777630 10:124998565-124998587 CAGGGTCTCCCTCATGGAGCTGG + Intronic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076124109 10:127961286-127961308 CAGCGTCCCCTTTTTGGAGCAGG + Intronic
1077108827 11:853293-853315 GAGGGTCTGCATTTGGAAGAAGG - Intronic
1077399287 11:2345790-2345812 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1078318575 11:10312353-10312375 CTGGTTCTCCAGTTTGCAGACGG + Intronic
1078486817 11:11730945-11730967 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1078744141 11:14095513-14095535 CTGGGTCTCCGGTTTGCAGATGG - Intronic
1078949890 11:16118285-16118307 AAGTGTTTCCCTTTTGGAGAGGG + Intronic
1080429881 11:32188641-32188663 CAGGGGCTCCATGTTGGAGAGGG - Intergenic
1081243784 11:40738308-40738330 CAGGGTCTTCAGTTTGCAGATGG + Intronic
1081539777 11:44024317-44024339 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1081595865 11:44459086-44459108 CAGGGCAGACATTTTGGAGAGGG + Intergenic
1081808763 11:45903749-45903771 CAGCCTCTCCATTTTAGAGGGGG + Intronic
1083311170 11:61784496-61784518 CAGAGTGTCCCTTGTGGAGAAGG - Intronic
1083438114 11:62657019-62657041 AAGGGTGTTCATTTTGGAGTTGG + Intronic
1083492485 11:63023132-63023154 CATTGTCCCCATTTTGCAGATGG - Intergenic
1083611547 11:64006811-64006833 TAGCGTCTCCATTTTGCAGGTGG - Intronic
1084302477 11:68260540-68260562 CACAATCTCCATTTTGAAGACGG - Intergenic
1084314165 11:68334448-68334470 CAGGCTTTGCACTTTGGAGAAGG + Intronic
1084400083 11:68938406-68938428 CAGGGTCTGCTTCCTGGAGACGG - Intronic
1084469734 11:69352064-69352086 CTGGGTCTCCAGCTTGCAGAGGG - Intronic
1085145531 11:74192275-74192297 CAGTTTCTCCATTTTGGAATGGG + Intronic
1085251709 11:75148238-75148260 CAGGATCTCCATTTAACAGATGG + Intronic
1086490094 11:87350326-87350348 TAGGGTCTCCAGCTTGCAGACGG + Intergenic
1088343142 11:108791683-108791705 CAAGGTTTCCATTCTGGAAAAGG - Intronic
1089649459 11:119903142-119903164 CAGAGTCTCCAGCTTGCAGATGG - Intergenic
1090369600 11:126239557-126239579 CAGGGACTCCATTTTGTTCATGG + Intronic
1090464432 11:126921296-126921318 CTGGGTCTCCACCTTGCAGAAGG + Intronic
1090801804 11:130177596-130177618 CATGGTCTCAACTTAGGAGATGG - Intronic
1092643574 12:10543814-10543836 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1092746642 12:11678705-11678727 CTGGGTCTCCAACTTGCAGATGG - Intronic
1092813993 12:12297159-12297181 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093010181 12:14099336-14099358 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093828950 12:23731271-23731293 CAGGGTCTCCAGCTTGCAGAAGG + Intronic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1094731795 12:33185057-33185079 AAGGGTCTCCAATTTGGAGCTGG - Intergenic
1095424395 12:42060002-42060024 CAGGTTCTCCAGCTTGCAGAGGG + Intergenic
1095683715 12:45008092-45008114 CTGGTTCTCCATCTTGCAGATGG + Intergenic
1096468499 12:51862076-51862098 CAGGGTCTCCATTTCACAGATGG - Intergenic
1098158697 12:67626324-67626346 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1098763881 12:74460172-74460194 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1099028634 12:77496784-77496806 CAGGGTCTTCATTTTGCACTGGG - Intergenic
1099324938 12:81202999-81203021 CAGGGTCTCAAACTTGCAGATGG - Intronic
1099403796 12:82234456-82234478 CAGGCTCTTCATATTGGGGATGG + Intronic
1099597181 12:84681908-84681930 CTGGGTCTCCAAATTGTAGATGG + Intergenic
1100130335 12:91484920-91484942 CTGGGTCTCCATTTCCAAGATGG + Intergenic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1100285929 12:93166346-93166368 CAGAGTCTGCATTTTGCTGATGG - Intergenic
1101172944 12:102118996-102119018 TCTGGTCTCCATTTTGTAGATGG + Intronic
1101837161 12:108303722-108303744 CAGGGTGTGCATTTTACAGACGG + Intronic
1101894946 12:108749351-108749373 CTGAGTCTCCAGTTTGCAGATGG - Intergenic
1102387350 12:112520751-112520773 AAGTGCTTCCATTTTGGAGAGGG + Intergenic
1103968160 12:124653120-124653142 CAGTGACTCCATCTTGGAGGTGG + Intergenic
1106076698 13:26466540-26466562 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1107292189 13:38867612-38867634 CTGGTTCTCCATCTTGCAGATGG - Intronic
1107453680 13:40535512-40535534 TAGGGTCTTCATTTTGAAAAGGG - Intergenic
1107676805 13:42806167-42806189 CAGAGTCTCCAGCTTGCAGATGG + Intergenic
1107994198 13:45844548-45844570 CAGGGTCTCTAGCTTGCAGATGG + Intronic
1108264104 13:48687246-48687268 CAGGGTCTCTATCTTGCCGACGG + Intronic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1109153282 13:58871637-58871659 CTGGGTCTCCAGTTTGCAGATGG + Intergenic
1110187286 13:72690359-72690381 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1110799998 13:79683777-79683799 CATGATCTACATTATGGAGAGGG - Intergenic
1111457961 13:88508460-88508482 CAATTTCTCCCTTTTGGAGAGGG - Intergenic
1111887229 13:94037604-94037626 TATGATCTCCATTTTGCAGATGG + Intronic
1112988385 13:105480627-105480649 CAGGATCTCCAGCTTGCAGATGG - Intronic
1113302628 13:109038533-109038555 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1114363607 14:22003320-22003342 CATGGTCTCCAGTTTGGAAGGGG - Intergenic
1114707485 14:24741978-24742000 GATGTTCTCCATTGTGGAGAAGG + Intergenic
1114728769 14:24967954-24967976 CGGGGTCACCATTTTGGAAGTGG - Intronic
1115806291 14:37055608-37055630 CAAGGTGTCTATGTTGGAGAGGG + Intronic
1116256456 14:42562653-42562675 GAGGGACTCCATCTTGGATAGGG + Intergenic
1116861292 14:49997669-49997691 CTGGGTCTCCAGCTTGTAGATGG + Intronic
1117500110 14:56343216-56343238 CAGTCTCTCCATTTTACAGATGG + Intergenic
1117906035 14:60588441-60588463 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1118427310 14:65680137-65680159 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1118607812 14:67515884-67515906 CAGTTTCTCCATCTTGGAAATGG - Intronic
1118934063 14:70269876-70269898 CAAGGTCTCCAGCTTGCAGATGG + Intergenic
1119571307 14:75675917-75675939 CAGGGTCTCCAACTTGCAAATGG - Intronic
1119771531 14:77223076-77223098 GAGGCTCTGCACTTTGGAGAGGG - Intronic
1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1120362146 14:83518435-83518457 CAGGGTCTCCAGCTTGCAGAAGG - Intergenic
1120712104 14:87803842-87803864 CTAGGTCTCCAGCTTGGAGAGGG - Intergenic
1121053737 14:90836584-90836606 CAGGGTCTCCATCTCAGAGAGGG - Intergenic
1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG + Intronic
1121181057 14:91929051-91929073 CAGGGTCTTTTTTTTTGAGATGG - Intronic
1121486182 14:94316990-94317012 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1121643638 14:95502647-95502669 CACCATCTCCATTTTGCAGAAGG + Intergenic
1121710442 14:96034758-96034780 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1122030709 14:98909447-98909469 CAGGCTTTCCATGTTAGAGAGGG - Intergenic
1122116456 14:99529958-99529980 TAGTGTCCCCATTTTGCAGAGGG + Intronic
1124026855 15:25974786-25974808 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
1124356566 15:28999838-28999860 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1124384292 15:29193568-29193590 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1128020471 15:64385951-64385973 CAGGGTCTCCTGCTTGCAGATGG + Intronic
1129281364 15:74487772-74487794 CAGGGTCTCCAGCTTGCATATGG - Intergenic
1129391840 15:75224629-75224651 CAGGGACCACACTTTGGAGAGGG - Intergenic
1129703553 15:77781888-77781910 CAGGGCTACCATTTTGCAGATGG - Intronic
1130081998 15:80742212-80742234 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1130999543 15:88928636-88928658 CAGGGACTCTATTGTGGACAGGG - Intergenic
1131470263 15:92690345-92690367 AAGGGTCTCCATATTGGCGTGGG + Intronic
1132231961 15:100190976-100190998 CAGAGTCGACATTTTGCAGACGG - Intronic
1133045072 16:3083440-3083462 CAATTTCTCCATTTTGGAAAGGG - Intergenic
1133326710 16:4946307-4946329 GAGTGTCCCCATTTTGCAGATGG - Intronic
1133966959 16:10538454-10538476 GGGGGTCTCCATTTTAGAGAGGG + Intronic
1134419001 16:14069411-14069433 CTGGCTTTCCAGTTTGGAGATGG + Intergenic
1134978517 16:18589445-18589467 TAGGTTCTCCATTTTACAGAAGG - Intergenic
1135177982 16:20248032-20248054 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1135253654 16:20922853-20922875 CTGGGTCTCCAGCTTGCAGACGG - Intronic
1135698662 16:24612305-24612327 CAGTTTCTCCATCTTGGAAATGG - Intergenic
1135930945 16:26736122-26736144 CTGGGTCTCCATCTTGCAGACGG + Intergenic
1136407815 16:30058938-30058960 CAGGGCTTCCATTCTGGTGATGG + Exonic
1136427780 16:30180768-30180790 AAGGCTCTCCATGTTTGAGAGGG - Intergenic
1137529328 16:49267385-49267407 CAGGGGCTCCATTTTAAACATGG + Intergenic
1137727085 16:50664206-50664228 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1138022324 16:53495928-53495950 CAGGGTGTCCATTTGAGAGCAGG - Intronic
1138719381 16:59061149-59061171 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1138812305 16:60165529-60165551 CTGGGTCTCTAGTTTGCAGATGG - Intergenic
1138973509 16:62174580-62174602 CTCGGTCTCCAGTTTGTAGATGG + Intergenic
1138976973 16:62219959-62219981 CTGGGTCTCCTGTTTGCAGATGG - Intergenic
1139063259 16:63281660-63281682 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1139345712 16:66302231-66302253 CAGTCTCTCCATCTTGCAGATGG - Intergenic
1139824346 16:69745334-69745356 CACCGTCTCCATTTTACAGATGG + Intronic
1140231856 16:73123843-73123865 CTGGGTCTTCATATTGCAGAAGG - Intergenic
1141095449 16:81159766-81159788 CAGGACCTGCGTTTTGGAGAAGG - Intergenic
1142121486 16:88388654-88388676 CCGGGTCTCCATACTGGAGGAGG + Intergenic
1144324180 17:14161825-14161847 TAGGGTCTCCAGCTTGCAGATGG + Intronic
1145112294 17:20174568-20174590 CCTGGTCTCCATTTGGGACACGG - Intronic
1146559415 17:33855240-33855262 CAGGGTCTCCAGTCTGGAGTTGG - Intronic
1146667482 17:34714825-34714847 CAGGATCCCCATTTTACAGACGG + Intergenic
1147553113 17:41458904-41458926 CATGGTATCCATTTTAGACATGG - Intergenic
1147701743 17:42400468-42400490 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1147901060 17:43785139-43785161 CAGGGTCTCCAGCTTGCAGATGG - Exonic
1148498509 17:48070694-48070716 CAAAGTTGCCATTTTGGAGATGG - Exonic
1148629439 17:49095469-49095491 CAGGGCCTCCAGCTTGCAGACGG + Intergenic
1149086553 17:52724378-52724400 TAGGGTCTCCAGCTTGTAGAAGG + Intergenic
1149118828 17:53135991-53136013 CAGGGTCTCTAAAATGGAGATGG - Intergenic
1149597977 17:57875232-57875254 CAGGGTCTTCATCTGGGACATGG + Intronic
1150523008 17:65889236-65889258 CAGGGAGTCCATTTTAGAGGTGG - Intronic
1150714944 17:67564267-67564289 CAGGGTCTCCAACTTGCAGGTGG - Intronic
1150948928 17:69779971-69779993 CTGGTTCTCCAATTTGCAGACGG - Intergenic
1151785011 17:76271189-76271211 CAGGCTCTCCACTTTGGACCTGG - Exonic
1151825114 17:76519665-76519687 CAGAGTCTCCACTTTCGAGGGGG - Intergenic
1152025083 17:77803591-77803613 CGCGGTCTCCAAATTGGAGACGG - Intergenic
1152089999 17:78241132-78241154 CTGGGTCTCCGTTTTGGAAACGG + Intergenic
1152738437 17:82008703-82008725 CAGGGTCTCCATGGGGGGGAGGG - Intronic
1153077555 18:1182270-1182292 CTGGTTCTCCATATTGCAGATGG + Intergenic
1153139517 18:1955108-1955130 GAGGGGCTCCAATGTGGAGATGG - Intergenic
1153453953 18:5260112-5260134 GAGAGACTCCATTTGGGAGAAGG + Intergenic
1154000808 18:10480868-10480890 CAGGGTCTCACTGTTGGAGGTGG - Intronic
1156082959 18:33362218-33362240 CAGGCTCTCCATTTTTTATAAGG - Intronic
1156329353 18:36104832-36104854 CAGGGTCTCCAGCTTGCAGACGG + Intergenic
1156659018 18:39323642-39323664 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1157176589 18:45457829-45457851 CATGATCTCCATTTTACAGATGG - Intronic
1157444421 18:47734029-47734051 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1157475656 18:48021878-48021900 CAGGAACCCCATTTTGGGGAGGG + Intergenic
1157574209 18:48732816-48732838 CAGGGTCTCCAATTTGTGCAAGG + Intronic
1157687249 18:49652234-49652256 CAGGGTCTCCTGAATGGAGAGGG - Intergenic
1157690658 18:49679318-49679340 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1157715417 18:49882323-49882345 CCGGGTTTCCATTTTATAGAGGG - Intronic
1158323169 18:56285430-56285452 CACGGTCTCCAGCTTGCAGACGG + Intergenic
1158758199 18:60351771-60351793 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1160020484 18:75176826-75176848 CTGGGTCTCCAGTCTGCAGACGG + Intergenic
1160055677 18:75477669-75477691 CAGTGTTTGCATTTGGGAGATGG - Intergenic
1160697834 19:493262-493284 CAGGGCCTCCTTGTTGGACAAGG - Intronic
1161976714 19:7611538-7611560 CAGGGCCTCCATATGGGACATGG - Exonic
1162251449 19:9447380-9447402 CTGTGCCTCCATTTTGGAAAGGG - Intergenic
1162880098 19:13652353-13652375 CTGGATCTCCAGCTTGGAGATGG - Intergenic
1162950702 19:14070708-14070730 CTGGGCCTCCAGCTTGGAGATGG - Intergenic
1163377153 19:16940214-16940236 CTGGGTCTCTATCTTGCAGAGGG + Intronic
1164847622 19:31448184-31448206 CAGTGGCTCCATATTGGACAAGG + Intergenic
1164880559 19:31729187-31729209 CTGGGTCTCCAGCTTGCAGAGGG + Intergenic
1165190439 19:34058553-34058575 CAGGTTGTGCATTTTGGGGAGGG - Intergenic
1165271587 19:34712197-34712219 GAGGGTCTCCAGTTTGCAGCAGG - Intergenic
1166092650 19:40520161-40520183 CGGGGTGTACATTTCGGAGAGGG + Intronic
1166647746 19:44544721-44544743 CAGGTTCTTCATTTTGCAAATGG - Intergenic
1166963803 19:46515577-46515599 CTGGGTCTCCAGTATGGAGAAGG + Intronic
1168208535 19:54871106-54871128 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
925540111 2:4957553-4957575 CAGTATCTCCATTTTACAGATGG - Intergenic
925729972 2:6912772-6912794 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
926044402 2:9699068-9699090 CAGTGTCCCCATTTTAAAGAGGG + Intergenic
926714191 2:15911024-15911046 CAGTCGCTCCAGTTTGGAGAAGG + Intergenic
926911885 2:17859164-17859186 CAGGGCCTCCCTTTTTGTGAAGG + Intergenic
927114629 2:19888265-19888287 CAGGGTCCACATCTTGAAGAGGG + Intergenic
927606252 2:24490086-24490108 CAGGTTCCCCAGTTGGGAGAAGG + Intergenic
928101349 2:28439382-28439404 CATGGTTCCCAATTTGGAGATGG - Intergenic
930324443 2:49897696-49897718 CTGGGTCTCCAGATTGCAGAGGG - Intergenic
930339954 2:50099742-50099764 CAGGGTATCTATTTTGTAAATGG + Intronic
930605074 2:53485091-53485113 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
930862749 2:56092007-56092029 TATGGTCTCCACTTTGCAGATGG - Intergenic
931103118 2:59024952-59024974 CATGGTTTCCTTCTTGGAGAAGG - Intergenic
932011694 2:67984240-67984262 CAGGGTCTCCATGGTGCAGTAGG + Intergenic
932267125 2:70377442-70377464 CAAGGTCTCCAGCTTGGAGGTGG - Intergenic
932634078 2:73372602-73372624 CAGGGTCTCCAACATGGAGGTGG + Intergenic
932818981 2:74883436-74883458 CAGGCTGCCCATTGTGGAGAGGG + Intronic
932943776 2:76202950-76202972 CAGGGTCTCCAGCTTAGAGATGG - Intergenic
933310484 2:80654542-80654564 CCGGGTCTCCAGCTTGCAGATGG + Intergenic
934556736 2:95290545-95290567 CAGCTTCTCCATTTATGAGATGG + Exonic
935328051 2:101955795-101955817 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
935712556 2:105912222-105912244 CTGGGTCTCCAGTATGCAGATGG + Intergenic
935863577 2:107360783-107360805 CAAAGTCTCCATTTTCCAGAGGG + Intergenic
936494256 2:113004452-113004474 CAGGGTCTCCAGCTTGCAGGTGG - Intergenic
936646023 2:114374120-114374142 TAGGGTCTCCAGCTTGCAGATGG - Intergenic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
938730809 2:134145539-134145561 CAGGTTCTCTTTTTTTGAGACGG - Intronic
939823684 2:146988067-146988089 CAGGTCATCCTTTTTGGAGAAGG - Intergenic
939948395 2:148438690-148438712 CAGGATCTCCAGCTTGCAGATGG - Intronic
940556896 2:155240254-155240276 CAGGTTATGCATTTTGGGGAAGG - Intergenic
942745701 2:179229445-179229467 CCAGGTCTCCAGTTTGCAGATGG + Intronic
943261219 2:185665964-185665986 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
943618806 2:190124123-190124145 CAGGGTCTCCAGATTGCAGATGG + Intronic
944235401 2:197437420-197437442 CAGGGCCTCTAGTTTGCAGATGG + Intergenic
944424244 2:199563047-199563069 CAGGGTCTCTTGTTTGCAGATGG - Intergenic
945479194 2:210324545-210324567 CGCTGTCTCCATTTTGAAGATGG + Intergenic
945931821 2:215862979-215863001 CTGGCTCTCCAGTTTGCAGATGG - Intergenic
946565693 2:220962184-220962206 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
946930616 2:224666787-224666809 CTGGGTCTCCAATTTACAGATGG - Intergenic
946999799 2:225440919-225440941 CAGTGTCTCCATTCTAGACATGG - Intronic
948325236 2:237113273-237113295 CAGGATTTACATTTTGGACATGG - Intergenic
1168813212 20:719807-719829 CAGGGTCTCCACCTGGGCGACGG + Intergenic
1169402384 20:5294106-5294128 CAGGGACTGCATGTTGGAGGAGG + Intergenic
1170010512 20:11717453-11717475 CAGGGTCTCCAACTTGCTGATGG + Intergenic
1170428129 20:16255899-16255921 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1170674854 20:18469482-18469504 CTGGGTCTCCAGCTTGCAGAGGG + Intronic
1170871173 20:20208106-20208128 CATCGTCTCCATTTTGCAGTGGG + Intronic
1172452868 20:35040570-35040592 CAGGTTCTCCAGCTTGCAGACGG + Intronic
1172875170 20:38159787-38159809 AAAGGACTCCATTTTGCAGATGG - Intronic
1172876876 20:38169771-38169793 CAGCGTGTCCACTTTGCAGATGG + Intergenic
1173248000 20:41349459-41349481 TAGGGTTTCCATTTGGGGGATGG - Intronic
1173324665 20:42021656-42021678 CTGGGTCTCCAGTTTGTAAATGG + Intergenic
1174836163 20:53857120-53857142 CATGTGCTCCATTTTAGAGATGG - Intergenic
1174991601 20:55516591-55516613 CAGATTCTGCATTTTGGAGTAGG - Intergenic
1175169118 20:57067601-57067623 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1175917822 20:62435222-62435244 CAGGGTCTCCTTTTGGGGGCAGG - Intergenic
1178133618 21:29601336-29601358 CAGGGTCTCTAGTTTGCAGATGG + Intronic
1178134313 21:29609774-29609796 CTGGGTCTCCAGTTTGCAAATGG + Intronic
1178194296 21:30325778-30325800 CTGGTTCTCCATCTTGCAGATGG - Intergenic
1178803711 21:35820562-35820584 CTGGGTCTCCAGCTTGCAGAAGG + Intronic
1179433222 21:41339902-41339924 CAAGGTCTCCAGCTTGCAGATGG - Intronic
1179457713 21:41510531-41510553 CTGGGTCTCCAGTCTGTAGATGG - Intronic
1179511029 21:41873742-41873764 CAGAGTTTCCATTTTTAAGATGG - Intronic
1180643134 22:17315588-17315610 AAGGGGATCCATTTTAGAGAGGG + Intergenic
1181385453 22:22542055-22542077 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1181893641 22:26087015-26087037 CACAGTCTCCATTTTATAGAAGG + Intergenic
1182279280 22:29208691-29208713 CAGGTTCTGCATTTTACAGAGGG - Intronic
1185058479 22:48593297-48593319 CAGCCCCTCCATTTTGCAGATGG + Intronic
1185201557 22:49509164-49509186 CAGGGTATCCAGCTTGCAGACGG - Intronic
949585362 3:5431668-5431690 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
950360528 3:12446364-12446386 CAGGGTCTGCTTGTTGGAGGAGG + Intergenic
950807650 3:15620906-15620928 CAGGGTCTCCAGCTTGCAGATGG - Intronic
951657858 3:25029161-25029183 CAAGTTCTGCATTTTAGAGAGGG + Intergenic
952431669 3:33229714-33229736 TTGAGTCTACATTTTGGAGATGG - Intergenic
952562050 3:34606022-34606044 CAGGATCTCCAGTTTGCAGATGG + Intergenic
953826597 3:46257786-46257808 CAGGGTCTCCAGCTTGTAGATGG - Intronic
954277365 3:49551406-49551428 CATGGCAGCCATTTTGGAGATGG - Intergenic
954485820 3:50850485-50850507 CTGAGTCTCCATTTTGGTTAGGG + Intronic
955051591 3:55416037-55416059 CAGACTCTCCTTTGTGGAGATGG - Intergenic
956562410 3:70594576-70594598 AAGAGTTTTCATTTTGGAGAGGG - Intergenic
956645698 3:71453605-71453627 CAGGCTCTCCAGGTTGGGGAGGG - Intronic
958414903 3:93862213-93862235 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
958564999 3:95798081-95798103 CTGGGTTTCCATTTTGGTTAGGG - Intergenic
959017736 3:101154831-101154853 CAGGGTCTCCAGCTGGCAGATGG - Intergenic
960392555 3:117096382-117096404 CAGGGATTTCATTTTGGAAATGG - Intronic
960617790 3:119612258-119612280 CAGGGTCTGCTTTTTGTAGGGGG + Intronic
960680681 3:120244205-120244227 CAGAGGCCCCATTTTGGAGCTGG + Exonic
960969828 3:123131413-123131435 CAGGGTCTTTTTTTTTGAGATGG - Intronic
962362967 3:134756873-134756895 CCTGGTCTCCCTTTTGGAGCTGG - Intronic
962455119 3:135558050-135558072 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
965638317 3:170807189-170807211 TAGTGTCTCCATTTTTGAAATGG - Intronic
966394687 3:179490513-179490535 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
966485045 3:180459477-180459499 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
966497295 3:180595715-180595737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
966859785 3:184224255-184224277 CAGGGTCTCCAGCTTGCAGAGGG - Intronic
967384760 3:188900427-188900449 CTGGGTCTCCATTTTTTACAGGG - Intergenic
967523312 3:190461993-190462015 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
967813269 3:193778621-193778643 CAGCGTGTCCATCTTGCAGAGGG + Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
969469579 4:7379599-7379621 ATGGGTGTCCATTTTGCAGATGG + Intronic
969664374 4:8548624-8548646 CTGGGTCTCCAGGTTGCAGACGG + Intergenic
969861123 4:10036015-10036037 CAGGGTCTCCAGCTTGCAGATGG + Intronic
970249579 4:14100076-14100098 CTGGGTCTCCAGCTTGTAGAAGG + Intergenic
970701108 4:18739718-18739740 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
970955766 4:21809406-21809428 CAGGTTCTCCAGCTTGCAGATGG + Intronic
972222155 4:36968186-36968208 CTGGGTCTCCAGTTTCCAGATGG - Intergenic
972827911 4:42782808-42782830 GAGTGTATTCATTTTGGAGATGG + Intergenic
973048472 4:45566491-45566513 CAAAGTCTCCTTTATGGAGATGG - Intergenic
974625082 4:64415956-64415978 CAGGGTCTCCAGCTCGCAGATGG - Intergenic
975742078 4:77439120-77439142 CAGGGTCTCCACCTTGCAGATGG + Intergenic
975764119 4:77649394-77649416 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
976194232 4:82517736-82517758 CAGGGTCTCCATCTTGCAGATGG + Intronic
976431869 4:84971816-84971838 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
976598799 4:86918908-86918930 CAGGGTCTCCAGCTTGCAGATGG - Intronic
977985021 4:103373035-103373057 CAGGGTCTCCAGCTTGCAAATGG - Intergenic
978495906 4:109358769-109358791 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
978579003 4:110213994-110214016 CTGGGTCTCCAGCTTGTAGATGG - Intergenic
979022005 4:115513748-115513770 CTGGCTCTCCAGTTTGCAGATGG + Intergenic
979027129 4:115591991-115592013 CAGGGTCTCCAGCTTGTAGATGG - Intergenic
980116812 4:128687175-128687197 CATGGTCCCCATTTTGTAGATGG + Intergenic
980153622 4:129079389-129079411 CAATGTCTCCCTTTTGGAAAGGG - Intronic
980828897 4:138105726-138105748 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
981362888 4:143867266-143867288 GAGTGTCTCCATCTTGGATAGGG - Intergenic
981567146 4:146113670-146113692 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
981730918 4:147897595-147897617 AAGGGTCTTTATTTTTGAGAAGG - Intronic
981916963 4:150044864-150044886 CAGGCTCTCCTTCATGGAGATGG + Intergenic
981953977 4:150447551-150447573 CAGGGTCTCCAGCCTGCAGATGG + Intronic
982055647 4:151546372-151546394 CAAGGTCTCCAGCTTGCAGATGG + Intronic
982402792 4:154986397-154986419 CAGGGTCTCCAGCTTGCTGATGG + Intergenic
982898146 4:160960637-160960659 CAGAGTCTCCAGCTTGGTGATGG + Intergenic
984448584 4:179869918-179869940 CTGGCTCACCCTTTTGGAGAGGG + Intergenic
984833993 4:184002101-184002123 CAGGATCTCCATTTGGGGGTGGG - Intronic
986571563 5:9170989-9171011 AAGGGGCTCCATATGGGAGAGGG + Intronic
987128114 5:14834239-14834261 CATTGTCTCCATTTTACAGATGG - Intronic
988024809 5:25671287-25671309 CAGGCTCTCCAATTTGCAGATGG + Intergenic
988582709 5:32482120-32482142 CAGGGTCCCCAGCTTGCAGATGG + Intergenic
988783808 5:34547546-34547568 AAAGTTCTCCATTGTGGAGAGGG + Intergenic
989352817 5:40506293-40506315 CTGGGTCTCCAATTTGCAGATGG + Intergenic
989699295 5:44242897-44242919 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
989990465 5:50757970-50757992 CAGGGACTCCATTGTGCACAGGG + Intronic
990282968 5:54271175-54271197 CATGGTCTCCAGCTTGCAGATGG + Intronic
991108997 5:62876346-62876368 CTGGGTCTCCAGCTTGCAGACGG + Intergenic
991369432 5:65902905-65902927 CACAGTCTCCAGTTTGCAGATGG + Intergenic
992468993 5:77036274-77036296 CAGGGTCTGTATTTTGTGGATGG + Intronic
992970927 5:82056999-82057021 AAGGATATCCATTTTGTAGATGG - Intronic
993469380 5:88288327-88288349 CTGGTTCTCCAGTTTGCAGACGG - Intergenic
994033674 5:95174231-95174253 CATGGTCTTCATTTTGGGGAAGG - Intronic
994440456 5:99796626-99796648 CAGTGTCTCCAGCTTGCAGATGG + Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995518322 5:112976249-112976271 GAGGGTATCCATTTTGGAGGTGG - Intergenic
996115210 5:119610473-119610495 TAGACTCTGCATTTTGGAGAAGG - Intronic
996438747 5:123465213-123465235 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
997709958 5:135996031-135996053 CAGGTACTCCATCATGGAGAAGG - Intergenic
997768754 5:136532352-136532374 CAGGGTCTCCAGCTTATAGATGG + Intergenic
998925092 5:147114503-147114525 CTGGGTCTCCACCTTGCAGATGG - Intergenic
999146273 5:149397739-149397761 CAGGGTCTCCAGCTTGTAGACGG - Intronic
999218258 5:149954202-149954224 CCCTGTCTCCATTTTGGGGAAGG + Intergenic
999877399 5:155823213-155823235 CTGGGTCTCCAGCTTGGAGAAGG - Intergenic
1000098652 5:157993483-157993505 CTGGGCCTCCAGTTTGCAGATGG + Intergenic
1000423324 5:161062145-161062167 CAGGGTTTTCAGCTTGGAGATGG - Intergenic
1004512880 6:16297007-16297029 CAAGGGCTGCACTTTGGAGACGG + Intergenic
1004691948 6:17999728-17999750 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1004835961 6:19531794-19531816 CAGGGTTTCCAGCTTGTAGATGG + Intergenic
1005418995 6:25629879-25629901 CAGGGTGCACTTTTTGGAGAAGG + Intergenic
1005506203 6:26470866-26470888 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1005643524 6:27819294-27819316 TAGGGTCTCCTTTTAGGGGAAGG + Intergenic
1006698591 6:35953209-35953231 CATTGTCTCCATGTTGGGGATGG + Intronic
1007460533 6:42015203-42015225 AAGGGTGTCCATTCTGGAGCTGG - Intronic
1007484287 6:42170154-42170176 CTGGTTCTCCATCTTGCAGATGG - Intronic
1008006033 6:46410240-46410262 CAGGTTCTCCAATTTGCAGAAGG + Intronic
1008036326 6:46749180-46749202 CAGAGTCTCCATTGTGTAGGTGG - Intronic
1010643022 6:78354099-78354121 CAATGTCTCCCTTTTGGAAAGGG - Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1010870486 6:81031288-81031310 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1011649914 6:89496089-89496111 CGGAGTCTTCATTTTGTAGATGG - Intronic
1012846468 6:104395671-104395693 CTGGGTCTCCAGTTTACAGACGG + Intergenic
1013093116 6:106919348-106919370 CAGTGTCTCCATTTTACAGAGGG + Intergenic
1013126887 6:107192670-107192692 CCGGGTCTCCCGCTTGGAGAAGG - Intronic
1014399313 6:120967345-120967367 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1015280891 6:131433081-131433103 CAGGGTGTCCATTCTAAAGATGG - Intergenic
1015498527 6:133906519-133906541 CAGGGTCTGGATATTGAAGAGGG + Intergenic
1015519820 6:134118918-134118940 CAGAGTCTCCAGATTGCAGATGG - Intergenic
1015908731 6:138145427-138145449 CTGGGCCTGCTTTTTGGAGAAGG - Intergenic
1016158971 6:140852357-140852379 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
1017870905 6:158485834-158485856 CAGTGTCTCCTTTTTGGAATGGG + Intronic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1018225101 6:161621285-161621307 CAGGGTCTTCAGCTTGTAGATGG - Intronic
1019456702 7:1131416-1131438 CAGGCTCTGCCTTTTGGACAGGG - Intronic
1019975944 7:4581679-4581701 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1020009597 7:4800768-4800790 CAGGATCACCATTATGGAGAGGG - Intronic
1020499922 7:8904734-8904756 CTGGGTCTTCAGTTTGCAGATGG + Intergenic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1021432892 7:20581822-20581844 CAAGGTCTGCATTTTTTAGAGGG + Intergenic
1021818050 7:24467391-24467413 CAGGGTGCCCATTTTAGAGATGG + Intergenic
1021988184 7:26117430-26117452 GAGGGTGTCCTTTTTGGGGATGG + Intergenic
1022316400 7:29249151-29249173 CAGAGTCTCCAGCTTGCAGATGG - Intronic
1024207721 7:47178072-47178094 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1024217587 7:47260749-47260771 CTGGGACTCCATTTTTGAAAAGG - Intergenic
1024788156 7:52931916-52931938 CAGGGTCTGCTTTTGGGAGGAGG - Intergenic
1026391311 7:69905420-69905442 CAGGGTCTCCATCTTGCAGATGG - Intronic
1027830219 7:83167330-83167352 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027879983 7:83822344-83822366 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1028122183 7:87068801-87068823 CTGGGTCTCTAGTTTGCAGAAGG - Intergenic
1029355442 7:100048429-100048451 CAGGGTTCCCATTATGCAGATGG - Intergenic
1029862060 7:103583253-103583275 CAGGGTCTCCAACTTGCAGATGG + Intronic
1030265290 7:107614837-107614859 TAGGGTCTCTATTTTTGAGACGG - Intronic
1030550232 7:110949108-110949130 CAGGGTCTCCAGCTTGCAGGTGG + Intronic
1033086333 7:138345348-138345370 CAGTGACTCCATTTTGAATAAGG + Intergenic
1034501920 7:151456291-151456313 CAGTTTCTCCCTTTTGGAAAGGG - Intergenic
1034523586 7:151639788-151639810 CAGGGACTCCAGCTTGGAGATGG + Intronic
1037545901 8:19922001-19922023 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1038086315 8:24200929-24200951 CAGGGTCTCATTTTAGGATATGG - Intergenic
1038179744 8:25215095-25215117 CCTGGACTCCATTTTGGAGAGGG + Intronic
1038259391 8:25979840-25979862 CAGGGTCTCTATTTTGTGGCCGG - Intronic
1038393708 8:27230950-27230972 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1039526742 8:38223740-38223762 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1039575523 8:38620689-38620711 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1040623200 8:49113006-49113028 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1042024418 8:64407721-64407743 CTGGGACTCCAGTTTGCAGATGG - Intergenic
1042219363 8:66458387-66458409 CAGGGGCTCCATTTCCCAGAGGG + Intronic
1042492510 8:69416226-69416248 CAGGGTCTCCAGCTTACAGATGG - Intergenic
1042701823 8:71623954-71623976 CAGTATCTCCATTTTGCAAATGG + Intergenic
1043195554 8:77287729-77287751 CAGGGTCTCCTTTCTGCTGAGGG + Intergenic
1043676251 8:82958314-82958336 CTGGTTCTCCAGTTTGAAGATGG + Intergenic
1043910096 8:85854263-85854285 CACGGTCTCCAGTTTGCAGATGG - Intergenic
1043974910 8:86573662-86573684 CAGGGACTCCAGTTTGTAGATGG - Intronic
1044556040 8:93563157-93563179 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1044888213 8:96803057-96803079 CTGGGTCTCCATCTGGTAGATGG - Intronic
1045256429 8:100527865-100527887 CATGGTCTCCAGTTTCGAGTGGG + Exonic
1045438222 8:102185721-102185743 GAGGGGCACCAATTTGGAGAAGG - Intergenic
1045727758 8:105195631-105195653 CAGGGTATTCTTTTTGGAGCTGG + Intronic
1046025179 8:108713784-108713806 CAGGGTCTCCAGCTTGCAGATGG - Intronic
1046035810 8:108840141-108840163 CTGGGTCTCCAGCTTGGAGATGG - Intergenic
1047038325 8:120964702-120964724 CAGGGTCTCTAACTTGCAGATGG - Intergenic
1048202307 8:132384832-132384854 CAGTGTTTCCATTTTACAGATGG - Intronic
1048327962 8:133453237-133453259 GAGGATCTGCATTTTGGGGAGGG + Intergenic
1049101595 8:140583275-140583297 CAGGGTCTCCAGCTTGTAAATGG + Intronic
1049617266 8:143581111-143581133 CCGGGCCTCCAGCTTGGAGATGG + Exonic
1049777204 8:144412251-144412273 CAGGGTCTCCATATCAAAGAGGG + Intronic
1049917647 9:334126-334148 TAGGGTTTGGATTTTGGAGATGG + Intronic
1051024761 9:12595176-12595198 CTGGGTCTCCAATATGCAGATGG - Intergenic
1051333956 9:16049704-16049726 CCGGGTCTCCAGCTTGCAGATGG + Intronic
1051562166 9:18454099-18454121 TAGGGTCTCCAGCTTAGAGATGG - Intergenic
1051668096 9:19484228-19484250 CAGGGTCTTCTTTCTGTAGAAGG + Intergenic
1051717248 9:19998165-19998187 CATTTTCTCCATTTTAGAGATGG + Intergenic
1051832306 9:21293402-21293424 CAGGGTCTCCAGCTTACAGATGG + Intergenic
1052255914 9:26456327-26456349 CAGGGTCCTCATTTGTGAGATGG + Intergenic
1053109466 9:35445140-35445162 GAGTGTCTCCAATTTAGAGATGG - Intergenic
1056009918 9:82317173-82317195 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056525656 9:87440723-87440745 CAGGGTCTGCAGCTTGCAGATGG - Intergenic
1056819359 9:89826557-89826579 CAGTGTCTCCATCTTGGTGATGG + Intergenic
1056872217 9:90292414-90292436 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056951396 9:91043294-91043316 AAGGGGCTCCATATGGGAGAGGG + Intergenic
1056964180 9:91152334-91152356 TTGGGTCTCCAGTTTGCAGATGG - Intergenic
1057319433 9:93998910-93998932 CTGGGTCTCCATCTTGCAGAGGG - Intergenic
1057381608 9:94572262-94572284 AAGAGTCCCCATTTTGGATAAGG - Intronic
1057498659 9:95579672-95579694 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057586058 9:96329959-96329981 CAGGGTCTCCAACTTGCAGATGG - Intronic
1058252134 9:102712407-102712429 CTGGGTCTCCTTTTTGGTGGTGG - Intergenic
1058340200 9:103886100-103886122 CAGGGTCTCCAGCTTGCAGATGG + Intergenic
1059661604 9:116407237-116407259 CAGGATCTCAATTTGGAAGAAGG + Intergenic
1059955192 9:119508600-119508622 CACTGTGTCCATTTTAGAGAAGG + Intronic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1060529240 9:124338766-124338788 CAGTATCTCCATTTTCCAGATGG - Intronic
1062038199 9:134392105-134392127 CAGAGCCTCCATTTTGCAGAGGG + Intronic
1062388616 9:136325153-136325175 CAGGGTCTCCCTTCTGGATGTGG + Intergenic
1062559969 9:137137111-137137133 CAGGTTGTCCATGATGGAGATGG - Intergenic
1185644507 X:1607769-1607791 GAGGGTCTCTCTTTTAGAGATGG - Intergenic
1186491584 X:9977755-9977777 CAAGGTCTCCAGCTTGCAGACGG - Intergenic
1186573426 X:10739837-10739859 GAGAGTCTACATTTTGGAGAAGG - Intronic
1186942171 X:14521565-14521587 CAGGGTGTCCAGCTTGCAGATGG + Intergenic
1187060169 X:15779107-15779129 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1187197194 X:17099033-17099055 CAGAGTTGCCATTTTGGAGATGG - Intronic
1189567791 X:42261332-42261354 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1189665788 X:43353366-43353388 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1189728211 X:43990189-43990211 CAGGGTCTGCAGCTTGCAGACGG + Intergenic
1189728386 X:43992735-43992757 CAGGGTCTGCAGCTTGCAGACGG - Intergenic
1190507097 X:51137083-51137105 CAGGGTCTCCAGCCTGCAGATGG - Intergenic
1190689007 X:52898045-52898067 CAGGGTCTCATGTTTAGAGAGGG + Exonic
1190696976 X:52957747-52957769 CAGGGTCTCATGTTTAGAGAGGG - Intronic
1191011156 X:55760926-55760948 CACTGTCTCCATTTTGAAGATGG + Intergenic
1191628706 X:63298379-63298401 CAAAGTTGCCATTTTGGAGATGG - Intergenic
1191631597 X:63327669-63327691 CAGGGTCTCCAGCTTGCAAATGG + Intergenic
1192743928 X:73920001-73920023 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1193345596 X:80400030-80400052 CAGGATCTCCAGCTTGCAGAAGG - Intronic
1194116256 X:89902113-89902135 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1194793670 X:98183072-98183094 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
1195454924 X:105057625-105057647 CAGGATCTCTATTGTGGGGAAGG + Intronic
1196888411 X:120269223-120269245 CAGGGCCTCCATTCTGGACAAGG - Intronic
1196894656 X:120323010-120323032 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1198058404 X:133018788-133018810 CTGGGCCTCCAGTTTGCAGATGG - Intergenic
1199004556 X:142680119-142680141 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1199436074 X:147814267-147814289 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1199572316 X:149279275-149279297 CTGGGTCTCCAGCTTGTAGATGG + Intergenic
1199846642 X:151696294-151696316 CAGGCGCTACATTTTGGGGAGGG + Intronic
1200469056 Y:3559238-3559260 CTGGTTCTCCAGTTTGCAGATGG + Intergenic