ID: 1121106478

View in Genome Browser
Species Human (GRCh38)
Location 14:91283292-91283314
Sequence CTTCCAGAGCCATGAGCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121106478_1121106490 21 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106490 14:91283336-91283358 GCGGCCTGGGTGCCGGGCGATGG 0: 1
1: 0
2: 0
3: 28
4: 249
1121106478_1121106488 14 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106488 14:91283329-91283351 CTTTGGTGCGGCCTGGGTGCCGG 0: 1
1: 0
2: 2
3: 19
4: 171
1121106478_1121106482 -3 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106482 14:91283312-91283334 AAGGGCCTGTGACTCACCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 152
1121106478_1121106491 22 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106491 14:91283337-91283359 CGGCCTGGGTGCCGGGCGATGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1121106478_1121106486 8 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106486 14:91283323-91283345 ACTCACCTTTGGTGCGGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1121106478_1121106484 2 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106484 14:91283317-91283339 CCTGTGACTCACCTTTGGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 157
1121106478_1121106492 23 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106492 14:91283338-91283360 GGCCTGGGTGCCGGGCGATGGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1121106478_1121106485 7 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121106478_1121106489 15 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106489 14:91283330-91283352 TTTGGTGCGGCCTGGGTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 195
1121106478_1121106495 27 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106495 14:91283342-91283364 TGGGTGCCGGGCGATGGGGGTGG 0: 1
1: 0
2: 1
3: 90
4: 764
1121106478_1121106493 24 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106493 14:91283339-91283361 GCCTGGGTGCCGGGCGATGGGGG 0: 1
1: 0
2: 1
3: 21
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121106478 Original CRISPR CTTCCAGAGCCATGAGCGTC GGG (reversed) Intronic
900861648 1:5237443-5237465 AGTCCAGAGCCATGAGGGCCAGG - Intergenic
901623908 1:10612631-10612653 CATCCACAGCCATGTGCTTCAGG + Intronic
902434917 1:16392271-16392293 CTTCCAGAGCCTTGGCTGTCAGG - Intronic
902715783 1:18271775-18271797 CTTCCACAGCCCTGAGGGGCTGG - Intronic
914327522 1:146634907-146634929 CTTCCAGAACCATGAGTGGGAGG + Intergenic
915128319 1:153680538-153680560 CTTCCAGGGCCAGGAGCATGAGG - Exonic
922654434 1:227368816-227368838 CTTCTAGAGCCATGTGGGCCAGG + Intergenic
922718931 1:227890557-227890579 CTCCCACAGCCATCAGTGTCTGG - Intergenic
1062802763 10:392322-392344 CACCCACAGCCATGAGCGACTGG - Intronic
1067746455 10:48940082-48940104 CCTCCAGAGCCATGAGCATGTGG - Intronic
1067777618 10:49174851-49174873 CTTCCAGAAGCCTTAGCGTCAGG - Intronic
1071890381 10:89999971-89999993 CTACCAAGGCCATGAGCGTTTGG - Intergenic
1076191203 10:128484592-128484614 CTTCCAGAACCATGAGGATGGGG + Intergenic
1082230089 11:49753268-49753290 CTCCCTGATCCATGAGCTTCAGG - Intergenic
1082805669 11:57448359-57448381 CCTGCAGAACCATGAGCCTCAGG - Intergenic
1084438734 11:69158564-69158586 CAACCAGAGCCAAGTGCGTCTGG - Intergenic
1086619964 11:88875680-88875702 CTCCCTGATCCATGAGCTTCAGG + Intronic
1089104985 11:115995292-115995314 CTGCCAGAGCCATGAGGGGAGGG - Intergenic
1090843926 11:130515473-130515495 GCTCCAGAGCCATGAGTTTCTGG - Intergenic
1091633411 12:2179228-2179250 CTGCCACAGCCATGAGTGCCTGG - Intronic
1101850037 12:108394382-108394404 ATCCCAGAGCCATGAGCTCCGGG - Intergenic
1101948401 12:109155258-109155280 CTTCCACAACCATCAGCTTCTGG - Intronic
1102170991 12:110842410-110842432 CTTCCAGAACCAGGTGCTTCAGG - Intergenic
1103917296 12:124382470-124382492 CCTCCAGAGTCTTCAGCGTCAGG + Intronic
1104035059 12:125092184-125092206 GCTGCAGAGCCTTGAGCGTCAGG + Intronic
1106486901 13:30180267-30180289 CTTCAAGAGCCATCTGCTTCAGG + Intergenic
1106504593 13:30360271-30360293 CTTCCAGAGTCTTGAGCATTTGG + Intergenic
1113847991 13:113403408-113403430 CCTTCAGACCAATGAGCGTCAGG - Intergenic
1117072586 14:52069552-52069574 CCTCCAGAGCCAGGAGCGCCCGG - Intergenic
1118067389 14:62206886-62206908 CTTCCAGATACATGAGGGTAGGG + Intergenic
1121106478 14:91283292-91283314 CTTCCAGAGCCATGAGCGTCGGG - Intronic
1121314458 14:92952877-92952899 ATTGCAGAACCATGAGCCTCAGG + Intronic
1121953941 14:98197340-98197362 CTTCCAGAGCCTGCAGTGTCAGG + Intergenic
1122500635 14:102196688-102196710 CTCCCAGAGCCCTGAGATTCTGG - Intronic
1125899333 15:43330462-43330484 CCCCCGGAGCCGTGAGCGTCGGG - Exonic
1126974843 15:54164626-54164648 TTTCTAGAGCCATCAGCCTCTGG + Intronic
1128376007 15:67076541-67076563 ATTTCAGAGCCATGAGTTTCTGG - Intronic
1129719099 15:77868158-77868180 CTGCAAGAGCCATGAGCACCAGG + Intergenic
1129879188 15:78995967-78995989 CTCCCACAGCCAGGAGCGCCAGG - Intronic
1131525870 15:93152175-93152197 CTTTCAGTGCTATGAGTGTCTGG + Intergenic
1131680101 15:94712470-94712492 CTTCCATAGCCACCTGCGTCCGG + Intergenic
1134536388 16:15029989-15030011 CTTCCAGATCCATGACTGTGAGG - Exonic
1134744133 16:16574291-16574313 TTCCCATAGCCATGAGGGTCAGG - Intergenic
1138448574 16:57079457-57079479 CCTCCAGAGCCACCAGGGTCTGG - Intronic
1138449341 16:57084048-57084070 CTTCCAAAGCCATGTTCCTCTGG - Intergenic
1138574930 16:57901489-57901511 CTCCCACAGCCCTGAGCGTGAGG + Intronic
1139859681 16:70010796-70010818 CTTCCAGATCCATGACTGTGAGG + Intergenic
1140006039 16:71076033-71076055 CTTCCAGAACCATGAGTGGGAGG - Intronic
1140742333 16:77952566-77952588 CCTGCAGAGCCATGAGCCCCTGG + Intronic
1140815010 16:78613279-78613301 CTTTCAGAAACATGAGCGTATGG + Intronic
1141434881 16:83994377-83994399 GTTCCATAGCCATGAGCTTGTGG - Exonic
1142548012 17:718996-719018 CTTCCAGATCCTTCACCGTCCGG - Intronic
1143503958 17:7353719-7353741 CTTCAGGAGCTATGAGAGTCGGG + Exonic
1146889029 17:36493019-36493041 CTTCCTTAGCCTTGAGCATCAGG + Intronic
1153757893 18:8302067-8302089 CTTCCAGGACCATCAGCTTCAGG - Intronic
1155168939 18:23252853-23252875 CTCCCAAAGCCATGAGCAACGGG - Intronic
1158454194 18:57592169-57592191 CATCAAGAGCCATGACAGTCAGG + Intergenic
1160441169 18:78893969-78893991 CTTTGAGAGCCCTGAACGTCAGG + Intergenic
1165913480 19:39244097-39244119 CCTCCAGAACCTTCAGCGTCAGG + Exonic
1165917478 19:39269526-39269548 CCTCCAGAACCTTCAGCGTCAGG - Exonic
1166850140 19:45756010-45756032 CTTCCTGAGCCAGGAGCGCAGGG - Exonic
1167299892 19:48672301-48672323 CTTCCAGGGCCAGCAGCCTCTGG + Intronic
1167612678 19:50514941-50514963 CTTCCAGAGCCAGGAGCCCCCGG + Intergenic
1168097203 19:54122663-54122685 CTCCCAGAGGCCTGAGGGTCTGG + Intronic
1168373533 19:55856402-55856424 CTTCCAGTGTCATGAGAGTGAGG + Intronic
925595299 2:5549933-5549955 CTTCAAGAGCCAAGATCCTCAGG - Intergenic
948557224 2:238821706-238821728 CTCCCAGAGCCCTGAACTTCAGG - Intergenic
1169029164 20:2394861-2394883 CTTCCAGAGCCCTGGGTGTCTGG - Intronic
1173479499 20:43388068-43388090 CTTCCAAAGCCATGAGCCACTGG - Intergenic
1174689474 20:52489615-52489637 CTTCCATAACCATGGGCTTCTGG - Intergenic
1175271298 20:57735950-57735972 TTTCCTGAGCCATGAGCAGCTGG - Intergenic
1175509811 20:59516298-59516320 CTTCCTGTGCCCTGAGCATCAGG - Intergenic
1176342729 21:5713650-5713672 CTACCAGAGCCACCAGGGTCAGG + Intergenic
1176474983 21:7145801-7145823 CTACCAGAGCCACCAGGGTCAGG + Intergenic
1176502098 21:7610806-7610828 CTACCAGAGCCACCAGGGTCAGG - Intergenic
1176537050 21:8111719-8111741 CTACCAGAGCCACCAGGGTCAGG + Intergenic
1179875816 21:44266841-44266863 CAGCCAGGGCCATGAGGGTCAGG + Intergenic
1180564182 22:16649118-16649140 CCTTCAGTTCCATGAGCGTCTGG + Intergenic
1183085695 22:35485570-35485592 CTTCCAAAGGCATCAGCCTCTGG + Intergenic
1183295867 22:37029265-37029287 CTTCCTGAGCCAGGAGGGGCTGG + Exonic
1184923376 22:47621249-47621271 CTTCCAGAGCTCTGTGCGTGAGG + Intergenic
955420913 3:58736602-58736624 CTTCCAAAGCCATGGGAGTGAGG - Intronic
957974622 3:87427375-87427397 TTTCCAGTGCCAGGAGCATCAGG + Intergenic
960254037 3:115491250-115491272 CTCCCAGAGCCAGGAGCCACAGG + Intergenic
962252826 3:133848199-133848221 CTTCCAGAGGCGTGGGCGCCTGG - Intronic
963882771 3:150546685-150546707 TTTCCGGAGCCATCAGCCTCGGG - Exonic
969410397 4:7024415-7024437 TTTTGAGAGCCAGGAGCGTCTGG + Intronic
991370543 5:65915014-65915036 CTTTGTGAGCCATGAGCTTCAGG + Intergenic
991389975 5:66132359-66132381 TTTCTAGAGCCAAGAGCGGCAGG - Intergenic
1001000927 5:168006308-168006330 CTTCCAGAGTCATGTGGTTCAGG - Intronic
1001030901 5:168262087-168262109 CTTCCAGAGCCATGAAGGCCTGG - Exonic
1001941904 5:175746329-175746351 CTGACATAGCCATGAGCTTCAGG + Intergenic
1003915696 6:10784549-10784571 CTTCCAGAGCCAGTACCCTCAGG - Exonic
1017872815 6:158501671-158501693 CTTCCAGTGACAGGAGCATCTGG + Exonic
1019227739 6:170528780-170528802 CTTTCAGAGCCTTGAACTTCAGG + Intergenic
1019890579 7:3942892-3942914 CTCCCTGAGCCATGAGACTCAGG - Intronic
1022178770 7:27898115-27898137 CTTTCAGAGCCATGGGTGTGTGG - Intronic
1024210612 7:47200285-47200307 CTAGCAGAGCCATGAGGGTGGGG - Intergenic
1028379157 7:90178694-90178716 TTTCCAGAGTCATGAGCTTGTGG + Intronic
1034421826 7:150994722-150994744 CTCCCAGAGCCACCAGCGGCAGG - Intronic
1034981523 7:155481278-155481300 CCTACAGACCCATGAGCGTAGGG + Intronic
1034982788 7:155489499-155489521 CTTCCAGAGTCAGGAGCATAGGG + Intronic
1038526786 8:28281281-28281303 CATCCAGAGCCAGAAGTGTCTGG + Intergenic
1039307564 8:36279191-36279213 CACCCAGAGGCATGAGGGTCAGG + Intergenic
1039520131 8:38163639-38163661 CTTCAAGAGCCAACAGCCTCTGG + Exonic
1049197358 8:141323073-141323095 GTTCCAGGGCCATGAGGGGCTGG + Intergenic
1049611835 8:143559466-143559488 TTTCCAGAACCATGAGCTTGAGG - Exonic
1050914075 9:11108844-11108866 CTTCAAGAACCATGGGCGTGGGG + Intergenic
1055407166 9:75987255-75987277 CTTCCAGAGCAGTCAGCCTCAGG - Intronic
1056869128 9:90260553-90260575 ATACCATAGCCATGAGAGTCAGG - Intergenic
1062361684 9:136191268-136191290 CTTGGAGAGCGATGAGCGTGTGG + Intergenic
1186023227 X:5280459-5280481 TTTCCAGGGCCATGAAAGTCAGG + Intergenic
1195829328 X:109038492-109038514 CTTTCAGAGTCATGAGCCTCAGG - Intergenic
1198580180 X:138055103-138055125 CTTCCAGAACCATGAGGGTAGGG + Intergenic