ID: 1121106479

View in Genome Browser
Species Human (GRCh38)
Location 14:91283293-91283315
Sequence CCTTCCAGAGCCATGAGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121106479_1121106485 6 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121106479_1121106484 1 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106484 14:91283317-91283339 CCTGTGACTCACCTTTGGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 157
1121106479_1121106486 7 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106486 14:91283323-91283345 ACTCACCTTTGGTGCGGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1121106479_1121106491 21 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106491 14:91283337-91283359 CGGCCTGGGTGCCGGGCGATGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1121106479_1121106488 13 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106488 14:91283329-91283351 CTTTGGTGCGGCCTGGGTGCCGG 0: 1
1: 0
2: 2
3: 19
4: 171
1121106479_1121106495 26 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106495 14:91283342-91283364 TGGGTGCCGGGCGATGGGGGTGG 0: 1
1: 0
2: 1
3: 90
4: 764
1121106479_1121106493 23 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106493 14:91283339-91283361 GCCTGGGTGCCGGGCGATGGGGG 0: 1
1: 0
2: 1
3: 21
4: 247
1121106479_1121106490 20 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106490 14:91283336-91283358 GCGGCCTGGGTGCCGGGCGATGG 0: 1
1: 0
2: 0
3: 28
4: 249
1121106479_1121106492 22 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106492 14:91283338-91283360 GGCCTGGGTGCCGGGCGATGGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1121106479_1121106489 14 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106489 14:91283330-91283352 TTTGGTGCGGCCTGGGTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 195
1121106479_1121106482 -4 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106482 14:91283312-91283334 AAGGGCCTGTGACTCACCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121106479 Original CRISPR CCTTCCAGAGCCATGAGCGT CGG (reversed) Intronic
900806783 1:4772750-4772772 CCTTCCAGACCCCTGGACGTGGG + Intronic
900828356 1:4945091-4945113 CCTCCCAGAGCCATGAAGGGAGG + Intergenic
904892884 1:33792574-33792596 CCTTCCAAAGCCTTGAGGGGAGG + Intronic
905373170 1:37497938-37497960 CCTTCCAGATCCCTGAGACTTGG - Intronic
906580172 1:46929682-46929704 CATTCCAGAGCCACGAGCCCTGG + Exonic
906603551 1:47149208-47149230 CATTCCAGAGCCACGAGCCCTGG - Exonic
908766392 1:67558526-67558548 CCTTCCAGAGTTATCAGAGTTGG + Intergenic
911091937 1:94024147-94024169 CCTGCCAGAGCCCTGAACGAGGG - Intronic
911213569 1:95167648-95167670 CATTCCAGAGCCAGGAGCCTTGG - Intronic
911817238 1:102368675-102368697 CCCTGCAGAGCCATGGGAGTGGG + Intergenic
912712681 1:111960981-111961003 CCTGCCAGAGCCATGAGGAGAGG + Intronic
915294148 1:154908310-154908332 CATTCCAGAGCCATGAGCCCTGG - Intergenic
919048180 1:192480408-192480430 CCTTCCCAAGCCATGAATGTGGG - Intergenic
921678932 1:218008643-218008665 CATTCCAGAGCCATGAGCCCTGG + Intergenic
922725581 1:227921581-227921603 CCTGCCAGTGCCAGGTGCGTTGG - Exonic
923083254 1:230680456-230680478 CCTGGCAGAGCCAAGAGCATGGG - Intronic
1062940089 10:1414434-1414456 CATTCCAGAGCCACGAGCCCTGG - Intronic
1071337954 10:84617071-84617093 CCTAGCAAAGCCATGAGGGTAGG + Intergenic
1074102779 10:110366509-110366531 CCTTCTAGAGCCACCAGCCTTGG - Intergenic
1076191202 10:128484591-128484613 GCTTCCAGAACCATGAGGATGGG + Intergenic
1080317937 11:30970957-30970979 CCTTCCAGAGGCCTGAGGTTGGG + Intronic
1081277222 11:41164897-41164919 CATTCCAGAGCCACGAGCCCTGG - Intronic
1082812097 11:57484593-57484615 CCTTCCAGGGCCAGGAGGGCAGG - Exonic
1084904524 11:72335433-72335455 CCTGGGAGAGCCATGAGCTTGGG - Intronic
1089104986 11:115995293-115995315 ACTGCCAGAGCCATGAGGGGAGG - Intergenic
1089556283 11:119317322-119317344 CCTTCCCAAGCCAGGAGCCTGGG - Intronic
1090610695 11:128467856-128467878 CTTTCCAGAGCCATGCGGGCGGG + Intronic
1092607570 12:10136929-10136951 CATTCGAGAGCCATGAGCCCTGG - Intergenic
1095859928 12:46905492-46905514 CATTCCAGAGCCATGAGCCCTGG + Intergenic
1095925429 12:47574889-47574911 CCTTCTAGGGCCATGAGGGAAGG + Intergenic
1097921133 12:65075231-65075253 CATTCCAGTGCCATAAGAGTGGG - Intronic
1099734983 12:86555579-86555601 CATTCCAGAGCCACGAGCCCTGG - Intronic
1101850038 12:108394383-108394405 CATCCCAGAGCCATGAGCTCCGG - Intergenic
1102431828 12:112889910-112889932 CCATCCAGAGCCATGAAAGTGGG - Intronic
1102728682 12:115089047-115089069 CCTCCCAGAGGAATGAGCTTTGG + Intergenic
1103547123 12:121710338-121710360 CATTCCAGAGCCACGAGCCCTGG + Intergenic
1104041508 12:125134113-125134135 CCTTCCAGAGGCATGGGGGTGGG + Intronic
1104563828 12:129862374-129862396 CCTTCAGGAGCCAAGAGCGAAGG + Intronic
1107671523 13:42751111-42751133 CCTTCCATGACCATGAGAGTAGG + Intergenic
1109909786 13:68893919-68893941 CATTCCAGAACCATGAGCCCTGG + Intergenic
1112307026 13:98284097-98284119 CCATCCTGGGCCATGGGCGTTGG - Intronic
1116054302 14:39843969-39843991 CACTCCAGAGCCATGAGCCCTGG - Intergenic
1118029944 14:61809879-61809901 ACCTCCACAGCCATGAGTGTGGG - Intergenic
1118067388 14:62206885-62206907 CCTTCCAGATACATGAGGGTAGG + Intergenic
1119266292 14:73264831-73264853 CCTCCCAGAGCCCTGAGCAGGGG - Intronic
1121106479 14:91283293-91283315 CCTTCCAGAGCCATGAGCGTCGG - Intronic
1121445749 14:93977794-93977816 CCTTCCAGACCCATGTGCTATGG + Intergenic
1129829970 15:78662175-78662197 CCTGCCAGAGCCAGCAGGGTGGG + Intronic
1129834303 15:78692321-78692343 CCCTGCAGAGCCATTAGGGTGGG + Intronic
1133220470 16:4317230-4317252 CCCTCCAGAGCCAAGATCCTGGG - Intronic
1136476860 16:30518833-30518855 ACTGCCAGAGCCATCAGCCTGGG + Intronic
1136543122 16:30939843-30939865 CCTTTCAGAGTCATGAGGGCAGG + Intronic
1137546169 16:49405177-49405199 CCTCCCAGGGCCATCAGCCTGGG - Intergenic
1141800254 16:86303216-86303238 TCTTCCAGAGCCCTGAGGATGGG - Intergenic
1144811074 17:17999281-17999303 CCTTCTAGAGCCAAGAGCAGTGG + Intronic
1147403461 17:40194539-40194561 CCTTCCAGAGGCCTGAGTGGGGG - Exonic
1147450180 17:40499578-40499600 CCTACCGGAGCCACGGGCGTTGG - Intronic
1151814013 17:76462196-76462218 CCAGCCAGAGCCAGGAGAGTGGG + Intronic
1152580565 17:81163931-81163953 ACTGCCAGAGCCACAAGCGTGGG + Intronic
1155797984 18:30064608-30064630 CCTACCAAAGCCATGGGGGTAGG - Intergenic
1156039723 18:32806910-32806932 CATTCCAGAGGCAACAGCGTGGG - Intergenic
1159760526 18:72420142-72420164 CATTCCAGAGCCATGAGCCCTGG + Intergenic
1159892557 18:73966301-73966323 CCTTCCAGAGCCACCTGCATTGG - Intergenic
1161630037 19:5349333-5349355 CCTTCCAGTGCCATCAGTGTGGG + Intergenic
1165396886 19:35569358-35569380 CCCTCCAGATCCATGAGGGCAGG + Intergenic
1165602312 19:37065181-37065203 CATTCCAGAGCCATGAGCCCTGG + Intronic
1165764052 19:38339281-38339303 CATTCCAGAGCCATGAGCCCTGG + Intronic
1166346195 19:42167618-42167640 GCTTCCAGAGCCAGGAGGGAGGG + Intronic
1166850141 19:45756011-45756033 TCTTCCTGAGCCAGGAGCGCAGG - Exonic
925487864 2:4356014-4356036 ACATCCAGAGGCATGTGCGTCGG - Intergenic
925991969 2:9261229-9261251 ACTTCCAGAGCCAGAAGCGCTGG - Intronic
926264808 2:11306065-11306087 GATTCGAGAGCCATGAGAGTTGG + Intronic
927387428 2:22551086-22551108 TATTCCAGAGCCATGAGCCCTGG - Intergenic
927868386 2:26607730-26607752 TCTACCAGAGCCAGGAGTGTTGG - Intronic
931235871 2:60412297-60412319 CCTGCAAGAGCCAGGAGCTTGGG - Intergenic
931665326 2:64606403-64606425 CCTTCCAGAGCCCTCAGCCCAGG + Intergenic
932217456 2:69976137-69976159 CCTTCCAGGGCCATGCACCTGGG - Intergenic
933019752 2:77175437-77175459 CATTCCAGAGCCACGAGCCCTGG - Intronic
934158467 2:89225532-89225554 CATTCCAGAGCCATGAACCCTGG + Intergenic
934208804 2:89956895-89956917 CATTCCAGAGCCATGAACCCTGG - Intergenic
936144703 2:109972788-109972810 CGTTCCAGAGCCACGAGCCCTGG + Intergenic
936181388 2:110270751-110270773 CGTTCCAGAGCCACGAGCCCTGG + Intergenic
936199984 2:110398681-110398703 CGTTCCAGAGCCACGAGCCCTGG - Intergenic
936809828 2:116384513-116384535 CCTGCCAGAGGCAAGAGGGTAGG + Intergenic
937089772 2:119198421-119198443 CCTCCCAGAGCCAAGTGCGACGG + Intergenic
937234178 2:120420331-120420353 GCTTCCAGAGCCAGCAGCCTGGG + Intergenic
945514551 2:210746910-210746932 CATTCCAGAGCCACGAGCCCTGG - Intergenic
947642880 2:231716713-231716735 CAGGCCAGACCCATGAGCGTAGG - Intergenic
1169217064 20:3800161-3800183 CCTTCCACTGCCTTGAGCCTTGG + Intronic
1171152733 20:22842157-22842179 CTTTCCAGAGCCATCAGGGGTGG - Intergenic
1175247450 20:57590422-57590444 CCTTCCAGAGCCAGAGGGGTGGG + Intergenic
1177322839 21:19544635-19544657 CATTCCAGAGCCACGAGCCCTGG - Intergenic
1179768102 21:43589205-43589227 CCTTCCAGAGCAAAAAGGGTAGG - Intronic
1182137372 22:27918908-27918930 CCTTCCCGAGCCATGCGCTCGGG + Intronic
1183184119 22:36282137-36282159 CCGCCCAGAGCCATGGGAGTGGG + Exonic
1184045932 22:41972107-41972129 CCTTGCAGAGCCAGGCTCGTTGG + Intergenic
1185275422 22:49948480-49948502 CCGTCAAGAGCCATGAGGGCCGG - Intergenic
950777624 3:15364259-15364281 CATTCCAGAGCCACGAGCCCTGG - Intergenic
950832386 3:15887626-15887648 CCTTCTAGAGACATGGGAGTGGG - Intergenic
952789803 3:37190812-37190834 CCTTCCAGAGCAATCAGCTGTGG + Intergenic
961015949 3:123468465-123468487 CCTACTAGAGCAATGAGTGTGGG + Intergenic
961829472 3:129616080-129616102 CCCTTCAGAGCCATCAGCCTGGG - Intergenic
963055526 3:141183207-141183229 TCTCCCAGAGCCATGAGTGGTGG + Intergenic
964312390 3:155408660-155408682 CCTCCCAAAGTCATGAGAGTGGG - Intronic
967564057 3:190953050-190953072 CATTCCAGAGCCATGAGACCTGG + Intergenic
968229870 3:196999187-196999209 CCTTCCAGAGCGCTGAGCACAGG + Intronic
968977286 4:3828550-3828572 CCTTCCAAAGCCAGGATCCTGGG - Intergenic
969633441 4:8351655-8351677 CCTTCCAGAGTCCTAAGCATAGG - Intergenic
970136409 4:12929442-12929464 CCACCCAGAGTCATGAGTGTGGG - Intergenic
971716183 4:30179803-30179825 TCTTCCAGAGCCTTGATCTTGGG + Intergenic
972358698 4:38306124-38306146 CCTTCCAAAGGCTTGAGTGTTGG - Intergenic
984355012 4:178646970-178646992 CATTCCAGAGCCATGAAGCTTGG + Intergenic
984547984 4:181129765-181129787 CATTCCAGAGCCAGGAGCCTGGG + Intergenic
987684763 5:21182855-21182877 CATTCCAGAGCCATGAGCCCTGG + Intergenic
988250290 5:28748704-28748726 CATTCCAGAGCCACGAGCCCTGG + Intergenic
990374760 5:55158452-55158474 TCTTACTGAGCCATGAGAGTAGG + Intronic
993161509 5:84297868-84297890 CATTCCAGAGCCACGAGCCCTGG + Intronic
994150487 5:96441921-96441943 CCTGCAAGAGCCATGATTGTAGG + Intergenic
999717499 5:154373160-154373182 CCTTCCAAACCCATCAGTGTAGG + Intronic
1009941537 6:70294789-70294811 CCTTCCTTAGCCATGAGGGAGGG - Intronic
1011887013 6:92109277-92109299 CCTTGCAGGCCCATGAACGTGGG + Intergenic
1011959143 6:93065307-93065329 CCTACCAGATTCATGAGGGTTGG + Intergenic
1017861830 6:158405632-158405654 CATTCCAGAGCCACGAGCCCTGG + Intronic
1019610844 7:1935947-1935969 CCCCCCAGAACCAGGAGCGTGGG + Intronic
1019798703 7:3071970-3071992 CCGTCCACAGCTATGAGGGTTGG - Intergenic
1024210613 7:47200286-47200308 TCTAGCAGAGCCATGAGGGTGGG - Intergenic
1028760100 7:94486414-94486436 CTTTCCATAGTCATGACCGTTGG + Intergenic
1028985197 7:97004005-97004027 CCTTCCAGAGGCTTGAGATTGGG - Intergenic
1029307249 7:99629425-99629447 CTTTCCAGTGCCCTGAGTGTGGG + Exonic
1031146882 7:118006547-118006569 CCTTCCAAAGCCAGGAGCAGGGG + Intergenic
1034981521 7:155481277-155481299 ACCTACAGACCCATGAGCGTAGG + Intronic
1034982787 7:155489498-155489520 TCTTCCAGAGTCAGGAGCATAGG + Intronic
1038129819 8:24717495-24717517 CATTCCAGAGCCACGAGCCCTGG - Intergenic
1038679340 8:29652528-29652550 CCTTGCAGAGCGGTGAGGGTGGG - Intergenic
1039275577 8:35931740-35931762 GATTCCAGAGCCATGAGCCCTGG + Intergenic
1040384042 8:46901344-46901366 CCCTCAAGAGTCATTAGCGTAGG + Intergenic
1042768643 8:72354786-72354808 CTTTTTAGAGCCATGAGTGTTGG + Intergenic
1043399870 8:79873506-79873528 ACTTCCAGCGCCAAGAGCGCAGG - Intergenic
1044230989 8:89777358-89777380 CTTTCCAGAGCCATGAGGAAGGG - Intronic
1048336606 8:133507377-133507399 CCTACCATCGCCATGGGCGTGGG - Intronic
1049379732 8:142305963-142305985 CCTTGGAGAGCCCTGAGCGCCGG - Intronic
1049620095 8:143594275-143594297 CCTTCCAGAGCCAGGACCCCAGG - Intronic
1050052355 9:1616416-1616438 CTTTCCTGAGCCTTGAGCCTTGG - Intergenic
1050914074 9:11108843-11108865 TCTTCAAGAACCATGGGCGTGGG + Intergenic
1054712622 9:68526310-68526332 CCATCCTGAGCCAAGAGCCTGGG - Intronic
1056797167 9:89666564-89666586 CCTCCCACAGCCAGCAGCGTGGG - Intergenic
1057351268 9:94300676-94300698 CCTTCCTGTGCCTTGAGTGTGGG + Exonic
1058119976 9:101127630-101127652 CATTCCAGAGCCACGAGCCCTGG + Intronic
1061852714 9:133425321-133425343 CCTTCCTGAGCCATGAGCTGAGG + Intronic
1186423158 X:9443007-9443029 CCTTTCACAGCCCTGAGCCTTGG - Intergenic
1189224250 X:39399132-39399154 CCCTCCAGTGCCATGAGAATTGG + Intergenic
1192960510 X:76125989-76126011 AATTCATGAGCCATGAGCGTTGG - Intergenic
1196239011 X:113318277-113318299 TGTTCCAGACCCATGAGCATGGG + Intergenic
1198580179 X:138055102-138055124 ACTTCCAGAACCATGAGGGTAGG + Intergenic
1200258430 X:154598552-154598574 CATTCCAGAGCCACGAGCCCTGG + Intergenic
1200377890 X:155803589-155803611 CATTCCAGAGCCACGAGCCCTGG + Intergenic