ID: 1121106485

View in Genome Browser
Species Human (GRCh38)
Location 14:91283322-91283344
Sequence GACTCACCTTTGGTGCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121106479_1121106485 6 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121106478_1121106485 7 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121106485 Original CRISPR GACTCACCTTTGGTGCGGCC TGG Exonic