ID: 1121106485

View in Genome Browser
Species Human (GRCh38)
Location 14:91283322-91283344
Sequence GACTCACCTTTGGTGCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121106478_1121106485 7 Left 1121106478 14:91283292-91283314 CCCGACGCTCATGGCTCTGGAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121106479_1121106485 6 Left 1121106479 14:91283293-91283315 CCGACGCTCATGGCTCTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121106485 Original CRISPR GACTCACCTTTGGTGCGGCC TGG Exonic
900653712 1:3744706-3744728 GGCTCACCTTTGGTGTGTCCAGG - Intergenic
903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG + Intronic
918305297 1:183240462-183240484 GACTCCCCTTTGCTGGGGCTAGG - Intronic
920553599 1:206886417-206886439 CACTCACCTTTTGTGCAGCCTGG - Intergenic
922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG + Intronic
924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG + Intronic
1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG + Intronic
1074874698 10:117604643-117604665 GACTAGCCTTTGGTGCCTCCGGG + Intergenic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1080829389 11:35877208-35877230 GCCTCAACTTTGCTGTGGCCAGG + Intergenic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1096839908 12:54373839-54373861 GACTCACCTTGGGTGGGGGTGGG + Intronic
1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG + Exonic
1103546336 12:121704284-121704306 GACTCACCCATGTTGAGGCCAGG - Intergenic
1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG + Intergenic
1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG + Exonic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG + Intergenic
1132050212 15:98601512-98601534 GACTCTGCCTTGGTGGGGCCGGG - Intergenic
1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG + Intronic
1142125076 16:88406143-88406165 GTCCCACCTTTGGCGAGGCCGGG - Intergenic
1143315337 17:6027739-6027761 GAGCCACCTTTGCTGCTGCCAGG - Intronic
1146967691 17:37046838-37046860 GTCTCACCTTCTGTGCGGCTGGG + Intronic
1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG + Exonic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1166903047 19:46081125-46081147 CCCTGACCTTTGGTGTGGCCTGG - Intergenic
1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG + Intergenic
927587237 2:24318851-24318873 CGCTCACCTTCTGTGCGGCCAGG - Intronic
937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG + Intergenic
948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG + Intronic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG + Exonic
954145418 3:48632038-48632060 GCCCCACCTGTGGGGCGGCCAGG + Exonic
960269110 3:115655155-115655177 GACTAAACTTTAGTGAGGCCAGG + Intronic
962454868 3:135555779-135555801 GACTCATCAATGGTGCTGCCAGG - Intergenic
967871292 3:194231983-194232005 GACTCATCTGTGTTGCAGCCGGG - Intergenic
999676381 5:154007370-154007392 TACTCACATGTGGTGTGGCCTGG - Intronic
1019610798 7:1935806-1935828 GGCTCATCTGTGGTGGGGCCTGG - Intronic
1021340237 7:19455750-19455772 GACTCTCCTTGGGTGGGGCTTGG + Intergenic
1021360705 7:19708846-19708868 GATGTGCCTTTGGTGCGGCCCGG + Exonic
1025557486 7:62327346-62327368 GAATCAGCTTTGATGCAGCCAGG + Intergenic
1028188584 7:87819262-87819284 GACTAACCTTTGGTGTACCCTGG - Intronic
1030192762 7:106825835-106825857 GATCCACCTTTGATGTGGCCAGG + Intergenic
1032590233 7:133185331-133185353 GACTCACCTTGGGTTGGGTCAGG - Intergenic
1036686317 8:10913990-10914012 GACTCTCCTTTGGTCAGGTCCGG + Intronic
1037663123 8:20944021-20944043 GAATCCCCTTGGGTGAGGCCAGG - Intergenic
1040959182 8:53012993-53013015 GACTAACCTTTGGCACAGCCAGG + Intergenic
1048713058 8:137233523-137233545 GTCTCAGCTTTGGTGCTACCTGG - Intergenic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1053143884 9:35699025-35699047 GACTGACCTTGGGTTTGGCCCGG + Exonic
1056081265 9:83096422-83096444 GACCCACCTTTGCTGGGGTCTGG + Intergenic
1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG + Intronic
1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG + Exonic
1061779959 9:132989642-132989664 GACACTCCATTGGGGCGGCCTGG - Intronic
1190318292 X:49164990-49165012 GCCTCACCTTAGGTGGGGGCCGG + Exonic
1193504052 X:82318168-82318190 CACTCACCTTTGGTGAGGGAGGG + Intergenic
1195438521 X:104874042-104874064 GACTGATCTTTGATGCTGCCAGG + Intronic
1200132560 X:153859055-153859077 GACTTCCCTTTGGTGCGACAAGG + Intergenic