ID: 1121107115

View in Genome Browser
Species Human (GRCh38)
Location 14:91288285-91288307
Sequence TTTCCCTAAGGGCTGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121107115_1121107125 23 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107125 14:91288331-91288353 GTGGGACACAAGGCCAGATCAGG 0: 1
1: 0
2: 0
3: 12
4: 169
1121107115_1121107124 13 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107124 14:91288321-91288343 CCTGTGGCTGGTGGGACACAAGG 0: 1
1: 0
2: 2
3: 35
4: 508
1121107115_1121107121 4 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107121 14:91288312-91288334 ACAGTGTGTCCTGTGGCTGGTGG 0: 1
1: 1
2: 0
3: 28
4: 309
1121107115_1121107120 1 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107120 14:91288309-91288331 GGCACAGTGTGTCCTGTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 223
1121107115_1121107122 5 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107122 14:91288313-91288335 CAGTGTGTCCTGTGGCTGGTGGG 0: 1
1: 0
2: 2
3: 35
4: 261
1121107115_1121107119 -3 Left 1121107115 14:91288285-91288307 CCAAAGGACAGCCCTTAGGGAAA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1121107119 14:91288305-91288327 AAAAGGCACAGTGTGTCCTGTGG 0: 1
1: 0
2: 2
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121107115 Original CRISPR TTTCCCTAAGGGCTGTCCTT TGG (reversed) Intronic
901903854 1:12391214-12391236 TTTCCTTAACTGCTGTCCTTCGG + Intronic
903694334 1:25196112-25196134 CTTCCCTGAGGCCTGTCCTCTGG - Intergenic
904243834 1:29171347-29171369 TTTCCTTTAGTCCTGTCCTTTGG - Intronic
906559382 1:46744840-46744862 TGTCCTTGGGGGCTGTCCTTGGG + Intergenic
906673852 1:47679029-47679051 TTCCTCTCAGAGCTGTCCTTGGG + Intergenic
906678134 1:47708139-47708161 ACTCCCAAAGGGCTGTCATTTGG + Intergenic
906984471 1:50668348-50668370 TATCTCTCAGGGCTGTTCTTTGG - Intronic
907417259 1:54323145-54323167 CTTGCTTAAGGGCTGTCCATTGG - Intronic
908087720 1:60654129-60654151 TGTCCCTAAAGGCGGCCCTTAGG - Intergenic
909823854 1:80100242-80100264 TTTCCCTTTGAGCTGTCTTTGGG + Intergenic
910390095 1:86733055-86733077 TTTTCCTTAGTGCTCTCCTTAGG + Intronic
910809323 1:91219897-91219919 TTCCACTATGGCCTGTCCTTGGG - Intergenic
911922837 1:103788820-103788842 TTTCCCTAAGGGCTTTAGATTGG - Intergenic
915701126 1:157797721-157797743 TGTACTTAATGGCTGTCCTTGGG - Intronic
915964464 1:160294347-160294369 TTCCCAGAAGGGCTGACCTTAGG + Intronic
916187288 1:162145645-162145667 TTTCCCTTTGGACAGTCCTTTGG + Intronic
918672678 1:187239500-187239522 TTTCCATAACAGCTGTTCTTTGG - Intergenic
920990478 1:210933914-210933936 TTTCCCCAATGTATGTCCTTGGG - Intronic
921978115 1:221225597-221225619 TTTCCATAATGGCTGTCCAGAGG + Intergenic
922134944 1:222815273-222815295 AGTCCCTAAAGGCTGCCCTTAGG - Intergenic
922579554 1:226686782-226686804 TTTTCCTAAGGCTTGTCCTGGGG + Intronic
923271307 1:232357610-232357632 TGTCCCCAAGTTCTGTCCTTGGG - Intergenic
924466838 1:244305800-244305822 TTACCTGAAGGACTGTCCTTAGG - Intergenic
1063116896 10:3078157-3078179 ATTTCCTTAGGGCTGTCCGTGGG - Intronic
1067431488 10:46248820-46248842 TTTCCCTGACTGCTGTCCTCTGG - Intergenic
1070524201 10:77281243-77281265 GCTTCCTAAGGGCAGTCCTTTGG - Intronic
1071627616 10:87188691-87188713 TTTCCCTTGGGGCAGGCCTTGGG - Intronic
1071900076 10:90111044-90111066 TTTCCCAAAGTCCTTTCCTTTGG + Intergenic
1072649046 10:97279327-97279349 ATACCCTAAGGTCTGCCCTTAGG + Intronic
1072733514 10:97864111-97864133 CTTCCCTCAGGGCTGCCCTGTGG + Intronic
1078795629 11:14589673-14589695 CTTACCTAAGTGCTGTCCTTTGG - Intronic
1079091230 11:17481741-17481763 TTCCCCAAAGGTCTGTTCTTTGG - Intergenic
1080823469 11:35828443-35828465 TTACTCTAATGGTTGTCCTTTGG - Intergenic
1080826462 11:35853024-35853046 ATTCTCCAAGGGCTCTCCTTGGG + Intergenic
1083096436 11:60255734-60255756 TTTCTCTCAGAGCTGTTCTTTGG + Intergenic
1084381604 11:68816449-68816471 TCTCCCCAGGGGCTGTGCTTGGG - Intronic
1085524055 11:77154244-77154266 TTTGCCAAAGGGATGTTCTTTGG + Intronic
1086800480 11:91168701-91168723 TTTCCCTAAGTGCCCTCTTTTGG - Intergenic
1089137290 11:116259880-116259902 TCTCCCACATGGCTGTCCTTAGG - Intergenic
1090603184 11:128393683-128393705 TTTCCATATGGGCTATACTTTGG - Intergenic
1090928806 11:131277228-131277250 TTTCTGTAAGCACTGTCCTTGGG + Intergenic
1091638795 12:2218439-2218461 TTTCCCTAAAGGCAGTGCATAGG + Intronic
1092446262 12:8560237-8560259 TTTTACTATGGCCTGTCCTTGGG + Intergenic
1092551089 12:9500911-9500933 TTTCCCTGAGGGCTTTTCATTGG + Intergenic
1094520727 12:31185468-31185490 TTTCCCTGAGGGCTTTTCATTGG - Intergenic
1100765589 12:97862230-97862252 TTTCACTGCGGGCTGTGCTTAGG - Intergenic
1102283098 12:111633984-111634006 TATACCCAAGGGCTGGCCTTGGG - Intergenic
1103901807 12:124307319-124307341 TTTCCTAGAGAGCTGTCCTTTGG + Intronic
1105322334 13:19339518-19339540 TTTCTCTATAGGCTGTCCTGTGG - Intergenic
1110452677 13:75654631-75654653 TTTCCCTGTGGCCTGTCATTAGG + Intronic
1110816131 13:79861799-79861821 TTGCCCCAAAGGCTGTACTTGGG - Intergenic
1111358960 13:87148391-87148413 TTTCCTTCAGAGCTGTCCTTCGG - Intergenic
1114560861 14:23589502-23589524 AGTCCCTAAGGCCTGTCCTTGGG - Intergenic
1115347260 14:32356257-32356279 TTTGCCTAAGTCCTCTCCTTAGG + Intronic
1115518736 14:34211845-34211867 TCTCCCTTGGGGATGTCCTTTGG - Intronic
1117968369 14:61228691-61228713 TTTCCCGAACTGCTTTCCTTAGG - Intronic
1121107115 14:91288285-91288307 TTTCCCTAAGGGCTGTCCTTTGG - Intronic
1121582309 14:95040109-95040131 TTTGCCCAAGGGCAGCCCTTCGG - Intergenic
1126359026 15:47826574-47826596 TTTCCCTAAGGGTTTATCTTTGG - Intergenic
1129073101 15:72968171-72968193 ATTCCCTTAGGGCTGGCATTTGG - Intergenic
1129825353 15:78631230-78631252 TTTTCTTTAGGGCTGCCCTTTGG - Intronic
1132054979 15:98644124-98644146 TCTGCCTAAGGTCTTTCCTTAGG - Intergenic
1132506039 16:309597-309619 TTTCCCCAAGGGCTGTGCAGGGG + Intronic
1133197712 16:4183242-4183264 ATTCGCTAAGGGCTGCCCTTCGG + Intergenic
1133450653 16:5901184-5901206 ATTCCCTAAGGGCTGTATGTGGG + Intergenic
1135111351 16:19692944-19692966 CTGCCCGAAGGGCTGGCCTTAGG + Intronic
1135113309 16:19707377-19707399 TTTCTCATAGGGCTGTCTTTAGG - Intronic
1135910347 16:26554980-26555002 TTTCAATTAAGGCTGTCCTTTGG - Intergenic
1137806157 16:51307478-51307500 TTTATCTAAGGGCTTTCTTTGGG - Intergenic
1138121045 16:54401321-54401343 TTACTCAAAGGGCTGTCATTGGG + Intergenic
1140728660 16:77836514-77836536 TTTCCCTAACTGCTGACCCTGGG + Intronic
1147820464 17:43238493-43238515 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1147822576 17:43250385-43250407 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1147825093 17:43265180-43265202 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1147828213 17:43282700-43282722 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1147829323 17:43288864-43288886 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1147830413 17:43294999-43295021 TTTCTCTAAAGGCTGTCTTCAGG - Intergenic
1149541673 17:57472354-57472376 TTTCCCTAAGGGCTCTTCTGGGG + Intronic
1150954806 17:69845679-69845701 TTGCCTTTAGGGCTGTCTTTGGG + Intergenic
1153641622 18:7162634-7162656 CTACCCTAAGGGCTGTCATGGGG - Intergenic
1155094985 18:22546993-22547015 TTTTCCTAAGGCCTTTCCTATGG + Intergenic
1156138829 18:34079945-34079967 TTAGCCTAAGGGCTGTTCATTGG + Intronic
1157131137 18:45008451-45008473 CTTCCCTAAGGGCAGACCCTGGG - Intronic
1157428119 18:47601492-47601514 TTTGCCTATGCTCTGTCCTTTGG + Intergenic
1157542272 18:48519736-48519758 TTTCCCTAAGGTCTGGCTCTGGG - Intergenic
1158957492 18:62554132-62554154 TTTCCCAAATGGCTGGCCTGTGG + Intronic
1159003184 18:62991285-62991307 TTGCCCTGGGGGCTGTCCTCAGG + Intergenic
1159427748 18:68311206-68311228 TGTCCCTAATGACTGTCCGTAGG - Intergenic
1160826718 19:1083582-1083604 TCTCCCTTGGGGCTGGCCTTGGG + Intronic
1163429739 19:17260079-17260101 TCTCCCCAAGGCCTGTTCTTGGG + Intronic
1163799244 19:19354990-19355012 TTTGCCTGAGGGCTGGCCATGGG + Intronic
1167916783 19:52746556-52746578 TTTAACTATGGCCTGTCCTTGGG + Intergenic
1168454414 19:56495213-56495235 CTTACCTAAGTCCTGTCCTTTGG + Intergenic
925122466 2:1430099-1430121 TTACAGTAAGGGCTGTCCTGAGG - Intronic
926574079 2:14561188-14561210 TTTCCTTAAGGTCTGTCTTCAGG + Intergenic
926961424 2:18362361-18362383 TTCTCCTAAGGGCAGTCCCTGGG + Intergenic
927211630 2:20642449-20642471 TTTCCCTGAGGGCTGTTTTCAGG - Intronic
929854299 2:45623010-45623032 TTTCCCTACGGGCTGTTCTACGG + Intergenic
929868020 2:45734825-45734847 TTTCCATGAGGGCTGCCCTCAGG - Intronic
931230482 2:60370618-60370640 TTTCTCAAAGTGCTGTGCTTGGG - Intergenic
933267951 2:80202446-80202468 TTCCCCTATTGGCTGTCATTTGG + Intronic
934912497 2:98272384-98272406 TTTCCCTGAGTGCTCTCCCTGGG + Intronic
937816068 2:126251898-126251920 TCTCCCTAAAGGCTGTGCTTGGG + Intergenic
939595033 2:144112490-144112512 TTTTTCTAGGGGCTGTTCTTTGG - Intronic
940240774 2:151560897-151560919 TTTCCCTAAAGGCTTTTCTATGG - Intronic
941036890 2:160578674-160578696 CTTCCCTAGGGGCTTCCCTTAGG + Intergenic
941168428 2:162108572-162108594 TTTCCCAAAGGGCTGTCCTCTGG + Intergenic
941978834 2:171433730-171433752 TTTCCCGGAGGCTTGTCCTTGGG - Intronic
942155378 2:173122229-173122251 TTTCCTTAAAAGCTGTTCTTTGG + Intronic
942990395 2:182193451-182193473 TGTCTCCAAAGGCTGTCCTTAGG - Intronic
943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG + Intronic
943664388 2:190593560-190593582 TTTCCCAATGGTCTGTGCTTAGG + Intergenic
945293495 2:208147789-208147811 TTTCCCTCACTGCTGTCTTTAGG + Intergenic
945316995 2:208380062-208380084 TTGACCTCATGGCTGTCCTTAGG - Intronic
946192394 2:218014362-218014384 ATTCCCAAGGGGCTGTCCCTCGG + Intergenic
947220337 2:227785685-227785707 TTTCCCTCAGTGCTTTCCTATGG - Intergenic
948122851 2:235543819-235543841 TGGCCCTAGGGGCTGTACTTTGG + Intronic
948744344 2:240075445-240075467 ATTCCCTAAGGGCCTTTCTTTGG + Intergenic
1170161761 20:13320386-13320408 TGTCTCTAAGTTCTGTCCTTTGG - Intergenic
1170261542 20:14414040-14414062 TGTCCCTAAGGGATGTCATCTGG + Intronic
1172024033 20:31935834-31935856 TTGCCCTCAGTGCTGCCCTTAGG + Intronic
1172603877 20:36201608-36201630 TTTCTCTAAGGAGTATCCTTAGG + Intronic
1173095822 20:40027262-40027284 TCCCCCTAAGGTCTGTCATTTGG - Intergenic
1174903464 20:54524950-54524972 TTCTCCAAAGGGCTGTCCTCTGG - Intronic
1174970369 20:55268240-55268262 TTCCCCTAAAGGCTGGCTTTGGG - Intergenic
1177909192 21:27009589-27009611 TTTCCCTTAGGGATCTCATTTGG - Intergenic
1183717260 22:39540685-39540707 TGTCCCTCAGGGCTGGGCTTTGG + Intergenic
1184737274 22:46406648-46406670 TTTCTAGATGGGCTGTCCTTAGG + Intronic
951170608 3:19537541-19537563 TTTCCAGAAGGGCTGTGCATTGG + Intergenic
951483172 3:23183307-23183329 ATGCCATAAGGGCTGTCCTTTGG + Intergenic
951692748 3:25414073-25414095 TTTCCCTAAGCCCTGTCTCTAGG + Intronic
952637447 3:35549104-35549126 TTTGCCTAAATGCTATCCTTAGG - Intergenic
952794059 3:37223393-37223415 TTTGGCTAAGGGCTGTTCTCTGG + Intergenic
953907355 3:46874963-46874985 TCTCCCTCAGAGCTGCCCTTGGG + Intronic
956575673 3:70750172-70750194 TTTAGATAAGTGCTGTCCTTGGG + Intergenic
957764385 3:84603041-84603063 TTTCCCTATTAGTTGTCCTTTGG + Intergenic
957984475 3:87555927-87555949 TTTCCCAAATGGCTATCCTAGGG - Intergenic
959733137 3:109627235-109627257 TTTCCCTAATGACTGATCTTTGG - Intergenic
960536812 3:118824180-118824202 TATCCCCAAGTGCTGTCCCTAGG - Intergenic
961477950 3:127160227-127160249 CTTCACTCAGGGCTGTCCTGAGG + Intergenic
962236228 3:133709875-133709897 TTTCCCTGAGATCTGCCCTTTGG - Intergenic
963361788 3:144282877-144282899 TTCCCCTAAGGCCTGTCTTCTGG - Intergenic
965953853 3:174344337-174344359 TTTTCCTATAGGATGTCCTTTGG - Intergenic
969644048 4:8416213-8416235 ATTCCCTGAGGCCTGTCCTGGGG + Intronic
976218015 4:82732788-82732810 TTTCCCTGAGCTCTGTCCCTGGG - Intronic
976445520 4:85126562-85126584 TTCCACTATGGCCTGTCCTTGGG + Intergenic
976945479 4:90761715-90761737 CTTCCCTAAAGGCAGTGCTTTGG + Intronic
977753077 4:100632886-100632908 TTTCCTTCATTGCTGTCCTTCGG + Intronic
978108205 4:104930478-104930500 AGTCCCTCAGGGCTTTCCTTGGG - Intergenic
978228889 4:106374074-106374096 TTTTCCTATGGTGTGTCCTTAGG - Intergenic
982388379 4:154837382-154837404 TTCTCCTATGGCCTGTCCTTGGG + Intergenic
983215631 4:164999825-164999847 TTCAACTATGGGCTGTCCTTGGG - Intergenic
985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG + Intergenic
988249235 5:28733535-28733557 TTTTCCAAAGAGCTTTCCTTAGG + Intergenic
990796923 5:59554018-59554040 TTTTCCTTAGGGCTGCCCTGAGG - Intronic
997368291 5:133339687-133339709 TTTACCAAGGGGCTGTCCTATGG - Intronic
1001093540 5:168759226-168759248 TTTCCCTAAGAGCAATGCTTTGG - Intronic
1004154451 6:13155197-13155219 TTACCGTAAGTGCTGCCCTTAGG + Intronic
1006163799 6:32053025-32053047 CTTCCCTGGGGGATGTCCTTGGG + Intronic
1006423232 6:33948510-33948532 TGTCCCTTAGGGCTGGCCTCAGG - Intergenic
1007380428 6:41486979-41487001 TTTTCCTAAGGCCTGTGATTTGG - Intergenic
1008382848 6:50853462-50853484 TTTTCCTAATGGATGTCATTTGG + Intergenic
1010211263 6:73364167-73364189 TTTCCCTAACGTCTGTATTTTGG + Exonic
1010281201 6:74025617-74025639 TTTTCCTAGGCCCTGTCCTTTGG + Intergenic
1013748580 6:113374612-113374634 GTTCCCAAAGTGCTTTCCTTGGG - Intergenic
1017218736 6:151941033-151941055 TTAACCTAAGTGCTGTTCTTTGG + Intronic
1018718918 6:166557290-166557312 CTTCCCTGCGGGCTGTTCTTGGG - Intronic
1019756408 7:2773760-2773782 TTTCCCTCAGGGCTGTCCAGGGG - Intronic
1021465197 7:20934937-20934959 TTTCCCAAAGCACTCTCCTTGGG - Intergenic
1024374028 7:48618011-48618033 TTTCTCTGAGGGCTGTGCCTGGG - Intronic
1026854365 7:73743245-73743267 TTTCCCGTGGGGCTGTCCCTGGG + Intergenic
1028142333 7:87288019-87288041 TTCCCCTAGGTGCTGTCCCTGGG + Intergenic
1028398339 7:90397054-90397076 TCCCCTTAAGGGCTGTCCATTGG - Intronic
1030831139 7:114223104-114223126 TTTCCCTGGGGCCTTTCCTTAGG + Intronic
1032083907 7:128873745-128873767 TTTCTCTAAGGGCTGTCGGGAGG - Intronic
1034572038 7:151964071-151964093 TTTCCCTGAGGCCTGTCTTCAGG + Intronic
1035767526 8:2119259-2119281 TGTCTCTAAAGGCTGTCCTTTGG - Intronic
1037226249 8:16594825-16594847 GTTCCCCAAGGGATGTCCCTGGG + Intergenic
1041621123 8:59970627-59970649 CTTACCTAAGTCCTGTCCTTTGG + Intergenic
1042361001 8:67883108-67883130 TTTTTTTAAGGGCTGTCTTTTGG - Intergenic
1045845322 8:106628193-106628215 TTTCCCAAAGAGCTGACATTAGG + Intronic
1046796066 8:118373529-118373551 TTTCCCAAAGCTCTGTCTTTTGG - Intronic
1048376032 8:133822957-133822979 TTTCCCTAAGCTCTGGGCTTTGG + Intergenic
1049271120 8:141696844-141696866 TTTCCCCAAGGGCTCCCGTTAGG + Intergenic
1049625314 8:143617272-143617294 CTCCCCTAAGGGCTGGCCCTGGG - Intronic
1050344713 9:4675045-4675067 CTTCCACAAGGGCTGCCCTTGGG + Intergenic
1051603282 9:18895577-18895599 TCTCACTCAAGGCTGTCCTTGGG - Intronic
1052629945 9:31024725-31024747 TTTCTCTCAGGGATGTCCTGAGG + Intergenic
1053380674 9:37647540-37647562 TTACCCTAACAGCTGTCATTTGG - Intronic
1053904627 9:42827909-42827931 TTTCCCGAAGGTGTGTTCTTGGG + Intergenic
1054530356 9:66177605-66177627 TTTCCCGAAGGTGTGTTCTTGGG - Intergenic
1058303787 9:103410331-103410353 TTTCACTTAACGCTGTCCTTAGG - Intergenic
1062445169 9:136590618-136590640 TTCCACTAAGGGGTGTCCTCGGG - Intergenic
1188407188 X:29826222-29826244 TTTCTATAAAAGCTGTCCTTTGG + Intronic
1191634446 X:63360735-63360757 TTTTACTATGGCCTGTCCTTGGG + Intergenic
1191984778 X:66968368-66968390 ATTCCCTAATGGCTTCCCTTGGG - Intergenic
1193159696 X:78214679-78214701 TTTTACTATGGCCTGTCCTTGGG + Intergenic
1197433297 X:126393501-126393523 TTTCCCTATGGGCTGATTTTGGG + Intergenic
1197670147 X:129267875-129267897 TTTCCCCAATGTATGTCCTTGGG - Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198255172 X:134918071-134918093 TTTCCCCAAGGTATGTTCTTGGG + Intergenic
1199980632 X:152918616-152918638 TTTCCCTTAGTGCTCCCCTTGGG + Intronic