ID: 1121107219

View in Genome Browser
Species Human (GRCh38)
Location 14:91289040-91289062
Sequence TGTCCTGAAGGGTCCCGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121107219_1121107227 5 Left 1121107219 14:91289040-91289062 CCGGTGCGGGACCCTTCAGGACA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1121107227 14:91289068-91289090 TTCCTCACCCGACCACGGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1121107219_1121107223 0 Left 1121107219 14:91289040-91289062 CCGGTGCGGGACCCTTCAGGACA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1121107223 14:91289063-91289085 CCCCCTTCCTCACCCGACCACGG 0: 1
1: 0
2: 0
3: 19
4: 306
1121107219_1121107229 9 Left 1121107219 14:91289040-91289062 CCGGTGCGGGACCCTTCAGGACA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1121107229 14:91289072-91289094 TCACCCGACCACGGCCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121107219 Original CRISPR TGTCCTGAAGGGTCCCGCAC CGG (reversed) Intronic