ID: 1121108607

View in Genome Browser
Species Human (GRCh38)
Location 14:91296771-91296793
Sequence CTGGTGAGGCAGGTCTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121108607_1121108617 19 Left 1121108607 14:91296771-91296793 CCCTGCCAGACCTGCCTCACCAG 0: 1
1: 0
2: 3
3: 46
4: 329
Right 1121108617 14:91296813-91296835 TGTTAAGATCTCATCTGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 130
1121108607_1121108612 -6 Left 1121108607 14:91296771-91296793 CCCTGCCAGACCTGCCTCACCAG 0: 1
1: 0
2: 3
3: 46
4: 329
Right 1121108612 14:91296788-91296810 CACCAGCCTTCCATGTGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 237
1121108607_1121108618 20 Left 1121108607 14:91296771-91296793 CCCTGCCAGACCTGCCTCACCAG 0: 1
1: 0
2: 3
3: 46
4: 329
Right 1121108618 14:91296814-91296836 GTTAAGATCTCATCTGGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 170
1121108607_1121108616 14 Left 1121108607 14:91296771-91296793 CCCTGCCAGACCTGCCTCACCAG 0: 1
1: 0
2: 3
3: 46
4: 329
Right 1121108616 14:91296808-91296830 AGGTCTGTTAAGATCTCATCTGG 0: 1
1: 0
2: 3
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121108607 Original CRISPR CTGGTGAGGCAGGTCTGGCA GGG (reversed) Intronic
900175091 1:1288035-1288057 CAGGTGAGGCTGGGCTGGCAGGG + Exonic
900175103 1:1288068-1288090 CAGGTGAGGCTGGGCTGGCCAGG + Intronic
900386111 1:2411861-2411883 CTGGTGAGGCAGGCAGGGCCTGG + Intronic
900604311 1:3517002-3517024 CAGGTGAGGCAGGCCGGGCCTGG - Intronic
900708547 1:4095882-4095904 CTGAGGAGGCAGGTGTGGAAAGG - Intergenic
902728412 1:18352419-18352441 CAGGTTGGGCAGGTCTGGAATGG + Intronic
903332809 1:22604863-22604885 CTTGACAGGCAGGTCTGTCATGG + Intergenic
903378301 1:22880066-22880088 CTGCAGAGGAAGGACTGGCAGGG + Intronic
903475979 1:23619491-23619513 CTGGTGGCGCAGCTCTGGCGGGG + Intronic
904959428 1:34320251-34320273 CTGGCTAGGCAGTTCTGGCCTGG + Intergenic
906311294 1:44756434-44756456 GTGCTGAGGCAGGGCTGGCCAGG + Intronic
906718838 1:47990934-47990956 GTGGTGAGGCAGGTCTCTGAAGG - Intronic
907238794 1:53069417-53069439 ATGGTGAGCCAGCACTGGCAGGG - Intronic
908114271 1:60925601-60925623 CAGGCGCAGCAGGTCTGGCAGGG - Intronic
910744776 1:90561600-90561622 ATAGTGAGGCGGGTCTGCCAGGG - Intergenic
912261081 1:108112033-108112055 CAGGGGAGGCAGGTCTGGGTGGG - Intergenic
915360690 1:155284769-155284791 CAGGAGAGGGAGGTGTGGCATGG + Intronic
915549831 1:156625493-156625515 CTGGGAAGGCAGGTCTGGAGAGG - Exonic
915589247 1:156861230-156861252 CTGGTCAGGCAGGACGAGCACGG + Intronic
916627452 1:166573467-166573489 CTGATGATGCTGGGCTGGCAGGG + Intergenic
917840914 1:178976770-178976792 CTGGTGGGGGAGGGCTGACATGG - Intergenic
918439719 1:184555086-184555108 CTGGAGTGGCAGCTCTGTCAGGG + Intronic
918451665 1:184664709-184664731 TTGGCGAGGGAGGCCTGGCAGGG + Intergenic
920219257 1:204384363-204384385 CAGGTAAAGCAGGTGTGGCAGGG + Intergenic
922027033 1:221759939-221759961 CGGGTGAGGCAGGGATGGGATGG - Intergenic
923286495 1:232501415-232501437 CTTGTTAGGCTGGTCAGGCAGGG + Intronic
1062832669 10:616581-616603 CTGGTGAGGAAGCCCTGGCTGGG - Intronic
1064862062 10:19837184-19837206 CTGGTGAGGAATGTCTTGCTGGG - Intronic
1065636602 10:27741872-27741894 CTGGCCTGGCAGGCCTGGCAGGG + Intronic
1067078257 10:43200134-43200156 CTGGGCAGACAGGGCTGGCAGGG + Intronic
1067414136 10:46091188-46091210 AAGGTGAGGCAGGGCTTGCAGGG + Intergenic
1067519599 10:46987390-46987412 CTGCTGAGGCAGGAGTGCCATGG - Exonic
1067642648 10:48064449-48064471 CTGCTGAGGCAGGAGTGCCATGG + Intergenic
1068090755 10:52429813-52429835 CTGATTCAGCAGGTCTGGCATGG + Intergenic
1069445007 10:68464859-68464881 CTGGTAAGGCAGGCCAGCCATGG + Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1069822491 10:71236347-71236369 TAGGTGAGGCAGGGCGGGCATGG - Intronic
1069945548 10:71983045-71983067 CTGGTGAGGCTTGTTTGGCCAGG + Intronic
1070824091 10:79380844-79380866 CTGGGGTGGCAGGGCTGGCCTGG + Intergenic
1071507749 10:86242930-86242952 TTGGTGAGGCAGGTGGGGCTGGG - Intronic
1073124002 10:101138854-101138876 CTGTGGCTGCAGGTCTGGCAAGG - Intergenic
1074916362 10:117959835-117959857 CTGGTGATGCAGGTCAGGGAAGG + Intergenic
1075161634 10:120029573-120029595 CTGTTGAGGCAGGGCAGGCAAGG - Intergenic
1075715164 10:124551486-124551508 CTGGTGAGGGAAGTGTGGGAGGG - Intronic
1075877994 10:125823503-125823525 CTGGTCCGGAAGGTCAGGCAAGG + Intergenic
1076160441 10:128240230-128240252 CTTGTCAGGCAGGTCTGCGAGGG + Intergenic
1076382695 10:130036262-130036284 CTCGTCAGACAGGCCTGGCATGG - Intergenic
1076424535 10:130358219-130358241 CTGGTGAGGCTGTTCTGTCTGGG + Intergenic
1076564562 10:131389309-131389331 CAGGAGAGGCAGGCCAGGCAAGG - Intergenic
1076722409 10:132398509-132398531 AAGGTGGTGCAGGTCTGGCAGGG - Intronic
1076885439 10:133260054-133260076 TGGGGGAGGCAGGTATGGCAAGG + Intergenic
1076888271 10:133272361-133272383 CTGGGGAGGGAGGGCGGGCAGGG - Intronic
1076984060 11:222827-222849 GAGGTGAGGAGGGTCTGGCAGGG - Intronic
1078248634 11:9599179-9599201 CTCATGAGGCAGGCCAGGCACGG + Intergenic
1078891163 11:15560301-15560323 CCGGAGAGGCAGGGCTGACAAGG - Intergenic
1079329886 11:19524520-19524542 CAGGGCAGGCACGTCTGGCATGG + Intronic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1083487194 11:62990707-62990729 CTGTTGAGGCAGGTTGGGCCTGG + Intronic
1083696341 11:64445304-64445326 CTGGCTAGGCAGGTCTGCCAGGG - Intergenic
1084485884 11:69447989-69448011 CTTGTCAGGCACGGCTGGCATGG - Intergenic
1084561108 11:69905925-69905947 CTGCAGAGCCAGGGCTGGCATGG - Intergenic
1084941958 11:72617725-72617747 CTGGAGAGGCAGGGCTGGCTGGG + Intronic
1085315901 11:75544831-75544853 TTGGTGGGGCAGGCCTGGGAGGG - Intergenic
1086573818 11:88315177-88315199 CTGGTAAGGCAGGCCAGGTAGGG + Intronic
1088647277 11:111927119-111927141 CTGGTGAGGCGGATCCGGAACGG + Intergenic
1088696940 11:112374982-112375004 ATGGTGATGCAGGTCGTGCACGG + Intergenic
1089583130 11:119493953-119493975 CTGGAGAGGTAGGTGTGGCCAGG - Intergenic
1089617385 11:119702546-119702568 CTGGTGAGGTAGGACTAGAAGGG - Intronic
1090392112 11:126395489-126395511 CTGGTGAGGCTGGTGTGGGTTGG + Intronic
1090558115 11:127898664-127898686 CTGATGGGGGAGCTCTGGCATGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091834663 12:3577082-3577104 CTGGTGAGGCAAGGCTGCCTTGG + Intronic
1091917968 12:4282787-4282809 CTTGTGGGGCAGGGCTGCCATGG - Intronic
1097187221 12:57202332-57202354 ATGGTCAGGCTGGCCTGGCAGGG - Intronic
1098339996 12:69441810-69441832 ATGCTAAGGCAGGTCTGTCACGG - Intergenic
1104760786 12:131296621-131296643 CTGGAGGAGCAGGTCAGGCAGGG + Intergenic
1104818987 12:131664171-131664193 CTGGAGGAGCAGGTCAGGCAGGG - Intergenic
1104844190 12:131838651-131838673 CAGGACAGGGAGGTCTGGCAGGG - Exonic
1105418378 13:20232254-20232276 CTGGGCAGGCAGGTCGGGCTCGG + Exonic
1106483041 13:30150914-30150936 CTGGTGAGGCAGGACAGGCTGGG - Intergenic
1107988626 13:45797646-45797668 CTGATACAGCAGGTCTGGCATGG + Intronic
1108000912 13:45904920-45904942 CAGGAGAGGCTGGTCTGGGAGGG - Intergenic
1108466037 13:50715975-50715997 CTGCTGAGGCAGGTCTGGGCTGG + Intronic
1110087134 13:71394387-71394409 CTGGGGCAGCTGGTCTGGCAGGG - Intergenic
1112049807 13:95634099-95634121 CTGGTGTGGCTGGAGTGGCAGGG - Intronic
1112407753 13:99136126-99136148 CTGGGAAGGGAGGCCTGGCAGGG + Intergenic
1113887649 13:113669370-113669392 CTGGGCAGGCGGGGCTGGCAGGG + Intronic
1113890511 13:113732837-113732859 CAAGAGAGGCGGGTCTGGCAGGG + Intronic
1113910676 13:113839837-113839859 CTGGTCAGGCAGGTCTGATTGGG + Exonic
1113933514 13:113981233-113981255 CTCATGAGGCAGGTGTGGCGAGG - Intronic
1114470514 14:22957844-22957866 CTTGGGTGGCAGGTCTGGGAAGG - Intronic
1115522855 14:34250886-34250908 CTGATGGTGCAGGTCTGGGAGGG - Intronic
1117941264 14:60968238-60968260 GTGGTGAGGCAGCTCTGACATGG - Exonic
1118336331 14:64856290-64856312 CTGGTGAGGGAGGTTTGGGAAGG - Intronic
1119727188 14:76928662-76928684 GAGGAGAGCCAGGTCTGGCATGG + Intergenic
1119888374 14:78163741-78163763 CTGGTTTGGCAGGTCTGCCGGGG + Intergenic
1120443277 14:84564191-84564213 CTGGTGTGGCAGTTGTGGCTCGG + Intergenic
1120501912 14:85308046-85308068 CTGGAGAAGCACTTCTGGCAAGG + Intergenic
1121108607 14:91296771-91296793 CTGGTGAGGCAGGTCTGGCAGGG - Intronic
1121515009 14:94543708-94543730 ATGGTGAGGCTAGCCTGGCATGG + Intergenic
1121562896 14:94887632-94887654 CTGGTGGTGCTGGTCAGGCAGGG + Intergenic
1121969618 14:98344293-98344315 CTGCTGCAGCAGGTCTGGCTGGG - Intergenic
1122142000 14:99668151-99668173 GTGGTGAGGCGGGGCTGGCTGGG + Intronic
1122781373 14:104145269-104145291 CTGGAGAGGCAGCTATGGCCAGG - Intronic
1122886653 14:104713307-104713329 CTGGTGAGGCTGGGCCGGCTGGG + Exonic
1122899105 14:104774791-104774813 CTGGTGAGACAGGCCTGCCCTGG - Intronic
1123107120 14:105846869-105846891 CTGTAGAGGGAGGCCTGGCAGGG - Intergenic
1123424183 15:20155867-20155889 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1123533403 15:21162396-21162418 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1124421800 15:29529372-29529394 TTGGTGAGGCAGGTTAAGCATGG + Intronic
1126800853 15:52295514-52295536 CAGGTGTGGCAGGTGTGGCCCGG + Intronic
1127636251 15:60872928-60872950 CTGGTGAGGAAGATATGGAAGGG - Intronic
1128580263 15:68805085-68805107 ATGGTGAGGCAGGACTCACAGGG - Intronic
1128700218 15:69798531-69798553 CTGGGATGGCAGGCCTGGCAGGG + Intergenic
1128784527 15:70385169-70385191 CTGGTGTGGGCGGTCTGGCCTGG - Intergenic
1129160552 15:73745284-73745306 GTGAGGAGGCAGGCCTGGCAGGG - Intronic
1129413404 15:75361898-75361920 ATGGTGAGGCAGTTTTTGCAGGG - Exonic
1129595875 15:76963761-76963783 CTGGGAAGGCAGGTCAGGCGGGG + Intergenic
1129700469 15:77765122-77765144 CTGGGAAAGCAGGCCTGGCATGG + Intronic
1130963318 15:88679441-88679463 CTGGTCTTGCAGGTCGGGCATGG + Intergenic
1131117120 15:89802448-89802470 CTGGTGAGACAGGCCTGGACTGG + Intronic
1131670065 15:94610399-94610421 CTGATGCAGCAGGTCTGGGATGG - Intergenic
1132244009 15:100280559-100280581 CTGGTGAGGGAGGGCGGGCCAGG - Intronic
1132977928 16:2719818-2719840 CTGGTGTGCCAGCTCTGGCCAGG - Intronic
1135628023 16:24013146-24013168 CTGGTCAGGGAGGTCAGGAAGGG - Intronic
1136103339 16:28011244-28011266 GTCATGAGGCAGGACTGGCAAGG - Intronic
1136381238 16:29896912-29896934 CTGGGGAGGCAGGGCTGGGTGGG + Exonic
1136860686 16:33700019-33700041 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1136989391 16:35142869-35142891 CTGGTGAGGCAGGGAGGGCATGG - Intergenic
1138693815 16:58792755-58792777 CTCCTGGGGCAGGGCTGGCATGG - Intergenic
1139465509 16:67151808-67151830 CAGGTCAGACAGGGCTGGCAAGG + Intergenic
1139494505 16:67306548-67306570 ATGGAGAGGCAGGACGGGCACGG - Intronic
1140355447 16:74301922-74301944 ATGGTTAGGAAGGTCTGGTAAGG + Intronic
1141285413 16:82667395-82667417 CTGGTGAGGCAGGCTTCTCAGGG - Intronic
1142153467 16:88522788-88522810 CTGGTCAGGCAGGTGTGTCCAGG - Intronic
1203122185 16_KI270728v1_random:1548202-1548224 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1143024785 17:3935172-3935194 CTGGTGAGCAAGGGCTGGCCAGG - Exonic
1143054756 17:4154607-4154629 CTGCTGAGGCAGGTGTGGGAAGG - Intronic
1143479605 17:7220722-7220744 CTGGTCAGGCCAGGCTGGCAGGG - Intronic
1144872056 17:18377774-18377796 CTGGTCAGCTAAGTCTGGCAAGG - Exonic
1145057926 17:19715272-19715294 CTGGAGAGGCCTGTCTTGCAGGG - Intronic
1146625232 17:34430325-34430347 CAGGAAAGGCAGGTCTGGAAAGG + Intergenic
1147540181 17:41350724-41350746 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1147542196 17:41369707-41369729 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1147545409 17:41397496-41397518 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1147745383 17:42691537-42691559 CTGGAGAGTCAGCTCTGGGAGGG - Intronic
1148090991 17:45022324-45022346 CTGGAGAGGGAGCTCTGGCGAGG + Intergenic
1148104184 17:45110617-45110639 CTGCAGAGCCAGGTCTGGCCAGG - Exonic
1148478819 17:47946636-47946658 CAGGTGATGGAGTTCTGGCAAGG + Exonic
1151692193 17:75693546-75693568 GTGGGGCGGCAGGCCTGGCATGG - Intronic
1151813556 17:76459549-76459571 CTGGTGGGGCAGCTCTGGACAGG - Intronic
1151828648 17:76537385-76537407 CTGGTGAGGTAGGTGTCGCCCGG - Exonic
1151959265 17:77396922-77396944 CTGATGTGGCAGCTCTGGAATGG + Intronic
1152785442 17:82245648-82245670 CCCGTGAGGCAGGAGTGGCAAGG - Intronic
1156268861 18:35512999-35513021 TTGGTGACCCAGGTCAGGCAAGG - Intergenic
1157598648 18:48879158-48879180 CAGGTGAGGCAGGGGTGGCGGGG - Intergenic
1157617355 18:48995107-48995129 CTGGGAAGGCAGGTCTTGCAGGG - Intergenic
1160527754 18:79547485-79547507 CTCGGGAGGCAGAGCTGGCAGGG + Intergenic
1160836427 19:1126846-1126868 CTGGTGAGGGAGGCATGGCTGGG - Intronic
1161034705 19:2078120-2078142 TTGGTGAGTCAGAGCTGGCAGGG - Exonic
1165006737 19:32813491-32813513 TTAGTGAGGCAGGTGTGGAAAGG - Intronic
1166076097 19:40414680-40414702 CTGGTGAGTCAGGGCAGGCTGGG - Intergenic
1166138389 19:40791441-40791463 CCGGTAAGGCTGGGCTGGCAGGG - Intronic
1166253711 19:41587688-41587710 CAGGTGAGGCAGGGCTGGAGGGG - Intronic
1166359705 19:42247996-42248018 CTGGAGGGGCAGGGCAGGCAGGG + Exonic
1166410311 19:42552307-42552329 CAGGTGAGGCAGGGCTGGAGGGG + Intronic
1166719982 19:44991134-44991156 CTGGTCTGGCAGGCCGGGCAGGG - Intronic
1167168232 19:47813782-47813804 CTGCTGAGGCTGGCCTGGCCTGG + Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1168476183 19:56677093-56677115 TTGGTGAGGCAAGTCTCCCATGG + Intergenic
1168517270 19:57018198-57018220 CAGGTGAGTCAGGACTGGGAAGG - Intergenic
925267266 2:2574818-2574840 GAGATGATGCAGGTCTGGCATGG + Intergenic
925350494 2:3197886-3197908 CTGGTGAGGCGGGCCTGGCCAGG + Intronic
925675367 2:6356349-6356371 CTGACACGGCAGGTCTGGCAGGG - Intergenic
925803365 2:7624659-7624681 CTGATGAGGCAGTGCTGGGAAGG - Intergenic
928064913 2:28153703-28153725 CTGATTTGGTAGGTCTGGCATGG - Intronic
930685344 2:54301884-54301906 CTGAGGAGGCAGATCAGGCAGGG + Intronic
931784624 2:65608083-65608105 CTGGTGATGCAGGTGGGGCAGGG - Intergenic
933659851 2:84918617-84918639 GTGGTGGGCCAGGCCTGGCATGG - Intergenic
933703794 2:85274772-85274794 CTGGGGAGACAGGTCTGGTTCGG - Intronic
933976309 2:87514822-87514844 CTGGGGCTGCAGGTCTGGAAGGG + Intergenic
934459066 2:94201172-94201194 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936019116 2:108981317-108981339 CTGGTGGGGTTGGACTGGCATGG - Intronic
936040277 2:109144726-109144748 CTGGTGATGCATGCCTGGCAGGG + Intronic
936317513 2:111435984-111436006 CTGGGGCTGCAGGTCTGGAAGGG - Intergenic
936992700 2:118383036-118383058 CTCATGAGGCAGGGCTGGGAGGG + Intergenic
937004794 2:118501445-118501467 GTGGTGAGGCAGGTGGGGCTGGG + Intergenic
937129140 2:119494272-119494294 CTGGTGGGGCAGGGCTGGAGTGG - Intronic
938638436 2:133253837-133253859 CTGGTGGGACATGTCTGGCATGG - Intronic
940748441 2:157597156-157597178 CTGGTGAGGGAGGACTGCCGCGG - Intronic
941403354 2:165059115-165059137 CTGCTGAGGCAGGATTGGAATGG + Intergenic
941830368 2:169951742-169951764 CTAGTGGGGCAGGTGTGGTAAGG + Intronic
942252845 2:174062384-174062406 CAGGTGAGCCAGCTCTGGCCTGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944573754 2:201071498-201071520 CTGGCGAGGGTGGTCTGGAAAGG - Intronic
944636174 2:201678214-201678236 GTGGTGAGGAGGGTCTGGCAGGG - Intronic
945562153 2:211352277-211352299 TTGTTGAGCCAGCTCTGGCAAGG + Intergenic
946094696 2:217263434-217263456 CTGTTCATGCAGGTCTGGAAGGG - Intergenic
946187272 2:217988185-217988207 CTGGTTTGGCAGCTCTGGCTGGG - Intronic
947144347 2:227051055-227051077 CTGGTGAGAAAGGTCAGCCAGGG - Exonic
948084212 2:235232832-235232854 GTGGAGAGGCAGGTCTGCCGAGG + Intergenic
948356116 2:237378700-237378722 CTGCTGAGGCAAAGCTGGCAGGG + Exonic
948764466 2:240212400-240212422 CTGGCCAGGCAGGTGTGGCTTGG - Intergenic
948862818 2:240761084-240761106 CTGGGGGGCCAGGTCAGGCAGGG + Intronic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169990107 20:11493137-11493159 TTGGTGAGGAATGTCTGGGAGGG + Intergenic
1170267097 20:14479029-14479051 CTGGTGAGGGAGGTGTGGAGGGG - Intronic
1171567389 20:26208288-26208310 CTCGTGAGGCAGGTCTTGGTGGG - Intergenic
1173193409 20:40894239-40894261 CCTGAGAGGCAGGTATGGCAGGG + Intergenic
1173247144 20:41344718-41344740 CTGGAGAGACCGGTCTGGCTGGG + Intronic
1173255720 20:41393192-41393214 CTGGGGAGGAAGGTCAGGCCAGG - Intergenic
1173825828 20:46047167-46047189 CTGGCCAGGCCTGTCTGGCAGGG + Intronic
1174449348 20:50609976-50609998 CAGGTGAGGCAGGGGTGGTAGGG - Intronic
1174449378 20:50610057-50610079 CAGGTGAGGCAGGGGTGGCAGGG - Intronic
1174449414 20:50610156-50610178 CAGGTGAGACAGGGTTGGCAGGG - Intronic
1174449426 20:50610201-50610223 CAGGTGAGACAGGGTTGGCAGGG - Intronic
1174739450 20:52997974-52997996 CTGATGAAGCAGGTCTGGGGTGG - Intronic
1175843693 20:62047972-62047994 CTGGGGAGCTAGGTCTGGGATGG - Intronic
1176300759 21:5097878-5097900 CTGGGGATGCTGGTCTGGGACGG + Intergenic
1179265131 21:39796341-39796363 CTGGTGACATAGGCCTGGCAGGG - Intronic
1179473947 21:41631620-41631642 GAGCTGAGGCAGGTCTGGCATGG + Intergenic
1179574769 21:42301182-42301204 CTGGGGCGGTAGCTCTGGCAGGG + Intergenic
1179856275 21:44164075-44164097 CTGGGGATGCTGGTCTGGGACGG - Intergenic
1179877212 21:44275182-44275204 CAGGTGGGGCAGGTGGGGCAGGG - Intergenic
1179877245 21:44275296-44275318 CAGGTGGGGCAGGTGGGGCAGGG - Intergenic
1180635220 22:17258451-17258473 CTGGGGAGGCAGGCATGGGAGGG - Intergenic
1181357150 22:22305297-22305319 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1181475988 22:23168192-23168214 CAGGTGAGCCAGGCTTGGCATGG + Intergenic
1181625806 22:24121373-24121395 CAGGTGACACAGGTCTGGGAGGG + Intronic
1182501596 22:30752042-30752064 CGGCTGAGGAAGGGCTGGCAGGG - Intronic
1183087957 22:35498870-35498892 CTGGAGAGGCAGGTCAGAGAGGG - Intergenic
1183474574 22:38028966-38028988 CTGGTGAGCCAGGCCTGGAGTGG + Intronic
1184094639 22:42309956-42309978 CTGGAGAGACAGGGCTGGAAGGG - Intronic
1184391213 22:44204673-44204695 CTGGTGGGGCTGGTGTGGCCAGG + Intronic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
949743595 3:7263871-7263893 CTGGTGGGGAAGGTAAGGCAAGG + Intronic
949961373 3:9315058-9315080 CTGGTCAGGCTGGTCTGGTAGGG + Intronic
950764136 3:15260748-15260770 CTGGAGAGGCAGGGTGGGCATGG + Intronic
950864231 3:16175884-16175906 CTTGTTTGGCAGGTCTGGGATGG - Intronic
951839088 3:27014392-27014414 CTGATGTGGTATGTCTGGCATGG + Intergenic
951926380 3:27913143-27913165 CTGATTCAGCAGGTCTGGCATGG + Intergenic
953061238 3:39430105-39430127 CTGGTGGGGCTGGCCTGGGAGGG + Intergenic
953877175 3:46673072-46673094 CTGATGAGGCAGCTGAGGCACGG + Intronic
954290161 3:49645465-49645487 GTGGGGAGGCAGAGCTGGCAGGG - Intronic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954454830 3:50592175-50592197 AAGGTGAGGCAGGTCTGGGAGGG + Intergenic
954893746 3:53957460-53957482 TTGGTGATGCTGGTCGGGCATGG - Intergenic
954961253 3:54566948-54566970 CTGGTGAGGAAGGCATGGAAGGG - Intronic
955063281 3:55513049-55513071 CAGGTGAGGGAGGACTGGCCAGG - Intronic
956766110 3:72485909-72485931 CTGGGGAGGAAGGGCTGGCCTGG + Intergenic
959572413 3:107899190-107899212 CTGGTAAGGCAGAGCTGGCAGGG - Intergenic
965935754 3:174108727-174108749 TGAGTGATGCAGGTCTGGCAAGG + Intronic
966438343 3:179915275-179915297 CTTGTGAGGCAGTGCTGGGATGG + Intronic
966443377 3:179973284-179973306 CTGGTCAGCAAGTTCTGGCAAGG - Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
967931082 3:194690644-194690666 CTGGTGTGGAAGGGCTGGGATGG - Intergenic
968375717 4:39517-39539 CTTGTAAGGCAGGCCTGGCCTGG + Intergenic
968573488 4:1354349-1354371 CTGGTGAGGCTGGGCTGGAGGGG + Intronic
968817811 4:2830809-2830831 CTGGAGGGGCAGGTTTCGCATGG + Intronic
969643424 4:8412679-8412701 CGGGTGAGGAAAGACTGGCAGGG + Intronic
971197691 4:24485242-24485264 CTTGTGAGCCAGGGCTGGCGGGG + Intergenic
971958663 4:33456111-33456133 CTGGTAAGGCAGTTCTGGCCGGG - Intergenic
974896358 4:67944366-67944388 CTGATTAAGCAGGTCTGGGATGG + Intronic
975661837 4:76696401-76696423 CTACTGAGCCAGGTCTGGCTGGG + Intronic
975861324 4:78680143-78680165 CTGGAGTGGTAGGTGTGGCAAGG + Intergenic
977365011 4:96056640-96056662 ATGCTGTGGCAGGGCTGGCATGG + Intergenic
977615670 4:99085526-99085548 CTGATTCAGCAGGTCTGGCATGG + Intronic
982392888 4:154884861-154884883 CTGCAGAGGCAGGGCTCGCATGG - Intergenic
984157581 4:176210501-176210523 ATGGTGAGGAAGGTTTGGCTGGG + Intergenic
984943052 4:184951049-184951071 GGGGAGAGGCAGGACTGGCACGG + Intergenic
985663162 5:1167419-1167441 CTGGGCAGGCAGGGCTGGCCAGG - Intergenic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
986161593 5:5234420-5234442 GTGGTGAGGCAGGGTGGGCAGGG - Intronic
986591630 5:9376419-9376441 CTTGGGATGCAGTTCTGGCATGG + Intronic
988348795 5:30073656-30073678 CTTGTAAGGCAGGTCTTGTAAGG - Intergenic
991086036 5:62649053-62649075 CTAGTGAGGAAGGGCTGGAAAGG + Intergenic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
991651456 5:68859277-68859299 CTGGAGAGGAAGGGCTGACATGG - Intergenic
992854518 5:80846712-80846734 CTGGTGAGCCAGGCATGGGAGGG + Intronic
994212372 5:97101096-97101118 CAGGTGAGGCAGGTGAGGCAAGG + Intronic
995180709 5:109227915-109227937 CTGGTGGGGCAGGACTGGTGGGG + Intergenic
997199219 5:131999656-131999678 CTGTGGGAGCAGGTCTGGCAGGG + Intronic
997661970 5:135596033-135596055 TAAGTGAGGCAGTTCTGGCAAGG - Intergenic
997840235 5:137233026-137233048 ATGGTGATGCAGGTCTAGAAAGG - Intronic
999095982 5:148978652-148978674 CAGGTTAGGCAGGTCAGTCAGGG - Intronic
999143438 5:149377750-149377772 CAGGTGAGGCATGGCAGGCATGG + Intronic
999240994 5:150127303-150127325 GGGGAGAGGCAGGTCTGGCGGGG - Intronic
1001073818 5:168608949-168608971 CTGGGTAGGCAGGACAGGCAGGG + Intergenic
1001240908 5:170069218-170069240 CAGGTGAGGCAGCGCTGGCCAGG + Exonic
1002102814 5:176865710-176865732 GTGGTCAGACAGGTATGGCAGGG + Intronic
1002106372 5:176881260-176881282 CTGGGGAGGGAGGTGTGGCCAGG - Intronic
1002187270 5:177460185-177460207 CCTGTGGGGCAGCTCTGGCATGG - Intronic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003966255 6:11255433-11255455 CTGGTGAGGGAGGTTGGCCAGGG + Intronic
1004208539 6:13615040-13615062 ATGGCGAGACAGGGCTGGCACGG - Intronic
1005636231 6:27756074-27756096 CTGGCAGGGCAGATCTGGCAGGG + Intergenic
1006388808 6:33746890-33746912 CTGGTGCGGGAGGTCTGCCCGGG + Exonic
1006988764 6:38194862-38194884 CAGGGGAGGCAGGGCTGGCAGGG + Intronic
1007259482 6:40553557-40553579 CTGGTGGGGAAGGTCTAGGAGGG + Intronic
1010191235 6:73199199-73199221 CTGGTGAGGCAGAGCTGGGTAGG - Intergenic
1011025823 6:82868167-82868189 CTGCTGAGACAGGTCTGCCCTGG + Intergenic
1012559818 6:100566792-100566814 CTAGGGAGGCAGGGATGGCATGG - Intronic
1016710503 6:147165794-147165816 CTGGTCAGGGAGCTCAGGCAGGG - Intergenic
1017842512 6:158232790-158232812 CTGGGGAGACTGGTCCGGCAGGG - Intronic
1017953783 6:159161097-159161119 CTGGTTGGGTAGGTCTGGCTTGG - Intergenic
1018684609 6:166294262-166294284 CTGGTGCAGCAGGGCTGGCAGGG + Intergenic
1019015743 6:168878557-168878579 CTGGGGAGGCAGCTCTGACCTGG - Intergenic
1021434837 7:20602356-20602378 CTGGTGGGGCAGAGCTGGCTGGG - Intergenic
1022965525 7:35467972-35467994 CTGGGAAGGGAGGTCTGGGAAGG + Intergenic
1023852515 7:44158304-44158326 CTGGTCAGGCAGGGCTGCCAGGG + Intronic
1024153941 7:46601089-46601111 CTGATGATGGAGGTCAGGCAAGG - Intergenic
1024535830 7:50431632-50431654 CTGGTGAGGCTCGTTTGACATGG - Intergenic
1024551068 7:50562623-50562645 CTGGTCAGGGAGGACTGGCCAGG + Intronic
1028909856 7:96195683-96195705 GGTGTGTGGCAGGTCTGGCAGGG - Intronic
1029425306 7:100490693-100490715 CAGGCGGGGAAGGTCTGGCAGGG - Exonic
1029458043 7:100680786-100680808 GGGGTGAGGCAGCTCAGGCAGGG + Exonic
1033448080 7:141439294-141439316 CTGAGGAGGCAGCTCTGGCATGG - Intronic
1033685899 7:143641196-143641218 CTGGTGAGGCTGGTCATGAAGGG + Intronic
1033689844 7:143726119-143726141 CTGGTGAGGCTGGTCATGAAGGG - Intronic
1033698714 7:143816425-143816447 CTGGTGAGGCTGGTCATGAAGGG - Intergenic
1034245709 7:149642894-149642916 CTGGTGCGGTAGCTCTGGCATGG - Intergenic
1034447190 7:151119775-151119797 CTAGTGGGGCAGCCCTGGCAAGG + Intronic
1035402054 7:158572421-158572443 CTGGTGGGTCAGGGCTGTCAGGG - Intronic
1037588442 8:20294344-20294366 CTGGTGGGGCAGGTGTGGGCAGG - Intronic
1037650981 8:20838350-20838372 CTGCTGGGGCAGGTCTTGCCCGG - Intergenic
1037945246 8:22985705-22985727 CTCATCAGGCAGGTCTGGCTGGG - Intronic
1038354094 8:26810579-26810601 CTAGTGAGGCAGCTCTGGCATGG + Intronic
1039408132 8:37330012-37330034 CTGGAGAGTCAGGCCTGGCAGGG + Intergenic
1039773825 8:40716264-40716286 CTGATGCAGCAGGTCTGGCGAGG - Intronic
1040790990 8:51230685-51230707 CTGGTGAGGGAGGGCTGCGAGGG - Intergenic
1043426122 8:80150325-80150347 CTGCAGAGGCAGGGCTGTCATGG + Intronic
1044605444 8:94043571-94043593 CTGGGGAGAAAGGTCTGGGAAGG - Intergenic
1049007303 8:139863618-139863640 CTGCTGAGCCATGCCTGGCAAGG - Intronic
1049442145 8:142614421-142614443 CCGGGGAGGCAGGTCCGGCTCGG + Exonic
1049527520 8:143135609-143135631 CTGGTGAGTCAGGTGTGCAAAGG - Intergenic
1049580483 8:143408491-143408513 CTGGTGACCCAGGCCTGGCTGGG + Intergenic
1049619017 8:143589449-143589471 CTGGTGGGCCAGGTCGGGGACGG + Exonic
1049740899 8:144240395-144240417 CTGGTGAGCCAACTGTGGCATGG + Intronic
1050845056 9:10205693-10205715 CTGATGAAGCAGGCCGGGCATGG - Intronic
1051744334 9:20280466-20280488 CTGGTAAGGGAGGTCTGGGCTGG + Intergenic
1052816548 9:33106602-33106624 CTGGTGAGGGAGGGCTGGCATGG - Intronic
1053353270 9:37427171-37427193 CTGGTGGGTGAGGGCTGGCAGGG + Intronic
1053689559 9:40576961-40576983 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054274471 9:63054096-63054118 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054300805 9:63377900-63377922 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054400353 9:64710833-64710855 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054433944 9:65195091-65195113 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054496443 9:65826579-65826601 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1055627626 9:78190663-78190685 CTGGGGAGGCAGGTATGGGTGGG + Intergenic
1056395775 9:86180008-86180030 CCGGTGAGGCAGATCTCCCATGG - Intergenic
1056616074 9:88167129-88167151 CTGGAGAGGGAGGCCTGGCGTGG + Intergenic
1057050496 9:91919970-91919992 CTGGTGGGGCAGGTGTGGGATGG - Intronic
1057882379 9:98802277-98802299 CTGGTTAAGCAGGTCTGGTGTGG - Intergenic
1057979908 9:99650356-99650378 CTGGTGGGGAAGGTAAGGCAAGG - Intergenic
1059668525 9:116472169-116472191 TTGGAGAGGCAGGACTTGCAAGG - Intronic
1060560196 9:124536327-124536349 CTGGAGAGGCGGGTCTGGTGAGG + Intronic
1061812578 9:133171027-133171049 CAGGTGTGGCAGGTGTGGGAGGG + Intergenic
1062008839 9:134256263-134256285 CTGGAGAGGCCTGTCAGGCAGGG + Intergenic
1062308636 9:135923639-135923661 CTGGGGACGGAGGTCTGGCGTGG + Intergenic
1062439269 9:136562403-136562425 CTGAGGCGGCAGGTCTGGGATGG + Intergenic
1062535659 9:137020108-137020130 CTGGAGAGTCTGCTCTGGCAGGG - Intronic
1203573510 Un_KI270744v1:154633-154655 CTTGTAAGGCAGGCCTGGCCTGG - Intergenic
1186043596 X:5508841-5508863 CTGATGAGGCAGCTCTGGGCTGG - Intergenic
1186873451 X:13794381-13794403 CTGTTCAGGCAGGTCTGGAAAGG + Intronic
1187284219 X:17887295-17887317 CTGCTGACGCTGCTCTGGCAAGG - Intergenic
1187940035 X:24372361-24372383 CTGGTGAGACAGGTTTTGGAAGG + Intergenic
1189755213 X:44264401-44264423 CTGGTGGGGCAGGCCCTGCAGGG - Intronic
1190795985 X:53742820-53742842 CTGGTGAATAAGGCCTGGCATGG + Intergenic
1193251107 X:79291427-79291449 CTGGTGAGGAATGTCTGCCAGGG - Intergenic
1194109947 X:89821267-89821289 CTGGTGAGGCAGTTGTGAAAGGG - Intergenic
1195308357 X:103607833-103607855 ATGGTGAGGTGGGTCAGGCAAGG + Intronic
1196159006 X:112462125-112462147 CTGCTGAGTCAGGTATGGGAGGG - Intergenic
1196825150 X:119734981-119735003 CTGGTGAGGAAGTCCTGCCAAGG - Intergenic
1198880817 X:141279082-141279104 CTGGAGATGCAGGTCTGGATCGG + Intergenic
1200054227 X:153450386-153450408 CAGGTGAAGCAGGTCTGGAGAGG - Intronic
1200089711 X:153628765-153628787 CTGGTGAGGCAGGCCTGCTGGGG - Intergenic
1200462612 Y:3476005-3476027 CTGGTGAGGCAGTTGTGAAATGG - Intergenic
1201063585 Y:10069280-10069302 CTGGTGATGCAGGTCAGCCTGGG - Intergenic