ID: 1121108775

View in Genome Browser
Species Human (GRCh38)
Location 14:91297803-91297825
Sequence CAGATACCAAAGCTGTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121108775 Original CRISPR CAGATACCAAAGCTGTAGCA TGG (reversed) Intronic
902241040 1:15089440-15089462 AAGGCACCAAAGCTGTAGCCAGG + Intronic
902742179 1:18446268-18446290 CAGATAAGAAAACTGAAGCAGGG - Intergenic
904472989 1:30747379-30747401 CACACACCAAAACTGTCGCAGGG + Intronic
906178107 1:43793469-43793491 AAGATATCAAAGCTGTTGTAAGG - Intronic
906610054 1:47195186-47195208 CATATACTGAAACTGTAGCAGGG + Intergenic
907468247 1:54653830-54653852 CTGATACCATAGCTGGAGCCAGG - Exonic
908433601 1:64082812-64082834 CAGATATCAAGTCTGTATCATGG + Intronic
910167135 1:84339504-84339526 CAGAGAACAAAGCTGTGGCCCGG - Intronic
911339710 1:96621681-96621703 CAGATGGCAAAGCAGAAGCAAGG - Intergenic
912213849 1:107584678-107584700 CAAAGTCCAAAGCTGTAACAAGG + Intronic
912454836 1:109790528-109790550 CAGATAGCAAAGCTGTGGATTGG + Intergenic
912523840 1:110266218-110266240 CAGATCCCAACACTGTTGCATGG + Intronic
917363226 1:174200141-174200163 AATGTACCAATGCTGTAGCAAGG + Intronic
920207827 1:204306018-204306040 CACATTCCAAAGCTGCAGCCAGG - Intronic
920861721 1:209714085-209714107 CAGATGCCAAGGCTATGGCAGGG + Intronic
922855994 1:228775074-228775096 CAGATATCACATCTGTAGCTGGG - Intergenic
923053020 1:230402006-230402028 CAGATACCAAAGCTGCTGCCAGG + Intronic
923061662 1:230481127-230481149 GAGAGACCAAAGCTGGAGGATGG - Intergenic
923124084 1:231020522-231020544 CAGATCCTAACGCAGTAGCAGGG - Intronic
1064226959 10:13494962-13494984 ACGATTCCAAAGCTGTAGGATGG - Intronic
1065451203 10:25859392-25859414 CTGATACCAAAGCTAGAGAAAGG + Intergenic
1071200245 10:83213951-83213973 CAGATACCAAAGCAGCACCAAGG - Intergenic
1072027667 10:91477220-91477242 CAGATGCCAAGTGTGTAGCAAGG + Intronic
1073478349 10:103769097-103769119 CAAATATCCAAGCTATAGCATGG + Intronic
1074026779 10:109644154-109644176 AAGATAGCAAAGCTTTAGGAGGG - Intergenic
1077271238 11:1682807-1682829 CAGATACACACACTGTAGCACGG + Intergenic
1078412970 11:11142796-11142818 CAAATACCAAAACTACAGCAGGG - Intergenic
1081806292 11:45892615-45892637 CAGCTCCCAAAGCAGTAGCATGG - Intronic
1082099493 11:48160598-48160620 CAGATACCAATGCTGCTTCATGG - Intronic
1083282149 11:61633689-61633711 CAGCTCCCAAATCTGTAACATGG - Intergenic
1083903414 11:65654830-65654852 CTGATACCATGGCTGGAGCAGGG + Exonic
1089182665 11:116593757-116593779 CTGAGCCCAAGGCTGTAGCAAGG + Intergenic
1089300841 11:117497798-117497820 CAAATCCCACAGCTGTGGCAGGG + Intronic
1091708107 12:2713944-2713966 CCAATACCAATGCTATAGCAGGG - Intergenic
1091907582 12:4201360-4201382 CAGAACCCAAAGCAATAGCAGGG + Intergenic
1093540262 12:20274329-20274351 AAGATTCCACAGCTGTAACATGG - Intergenic
1096431373 12:51546312-51546334 CTGATTCCAGAGCTGAAGCAGGG - Intergenic
1097982378 12:65747498-65747520 CAGACAGCAATGCTGCAGCAGGG + Intergenic
1098475052 12:70891051-70891073 CAGCTACCAAAGCCACAGCATGG + Intronic
1101539860 12:105654971-105654993 CAGACACCAAAACTGTTGGATGG + Intergenic
1102015382 12:109644797-109644819 CAGTTTCCCAATCTGTAGCATGG - Intergenic
1104780567 12:131417364-131417386 CAGTTTCCACAGCTGTAGAATGG - Intergenic
1112361732 13:98724892-98724914 CAGATAACCAAACTGTAGCATGG - Intronic
1112520132 13:100088036-100088058 GAGAAACTGAAGCTGTAGCAGGG - Intergenic
1114453276 14:22839857-22839879 AAGAAAGCAAAGCTGGAGCAGGG + Intronic
1118102255 14:62619914-62619936 CAGAAGCCCAAGCTGTATCAGGG + Intergenic
1120319239 14:82937754-82937776 CACATACCAAAAGTGTAACATGG - Intergenic
1121108775 14:91297803-91297825 CAGATACCAAAGCTGTAGCATGG - Intronic
1122525288 14:102378200-102378222 TAGATACAAAAGCTGTATCTTGG - Intronic
1123903042 15:24895277-24895299 CAGAAACCAAATGTGTAGGAAGG - Intronic
1127198247 15:56614015-56614037 CAGAGACCCCAGCTGTACCATGG - Intergenic
1128386979 15:67156729-67156751 CCTAAACCAAATCTGTAGCAAGG - Intronic
1131883284 15:96881517-96881539 CAGATGCCCAGGCTGGAGCAAGG - Intergenic
1132443007 15:101886816-101886838 CAGACACCACAGGTATAGCAAGG - Intergenic
1133644107 16:7746979-7747001 TGGAAACCAAATCTGTAGCAAGG - Intergenic
1137268913 16:46889986-46890008 CAGATTCCAAGGCAGAAGCAGGG - Intronic
1137519078 16:49176441-49176463 AAGAGAGCAAAGCTGTGGCACGG + Intergenic
1138820806 16:60256956-60256978 CACATACCAAGTTTGTAGCAAGG - Intergenic
1141292192 16:82728858-82728880 CAGTTGACAAAGCAGTAGCAGGG - Intronic
1141675932 16:85517336-85517358 CAGATGAGAAAGCTGTGGCACGG - Intergenic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1148758873 17:49988949-49988971 CAGATAGAAAATCAGTAGCATGG - Intergenic
1148902952 17:50892408-50892430 CAGCTACCGAAGCTGAAGCCTGG + Intergenic
1155913439 18:31532199-31532221 CAGATACCAAATCTGTTGGCTGG - Intronic
1158618186 18:59006673-59006695 CTGAAACCAAGGCAGTAGCAAGG - Intergenic
1159156112 18:64585164-64585186 CAGACCCCAAAAATGTAGCAAGG + Intergenic
1161462293 19:4405173-4405195 CAGGTACCATAGGTGCAGCATGG + Intronic
1164427143 19:28151636-28151658 AAGACACCAAAGTTGTAGCTAGG - Intergenic
1166338115 19:42121453-42121475 CACAGAGCAAAGCTGTAGCAGGG + Intronic
1167009601 19:46798352-46798374 CTGAAACCAAAGCGTTAGCAGGG + Intergenic
926992049 2:18690462-18690484 CTGATTCCAAAGCTGTAGAAGGG - Intergenic
932299609 2:70656889-70656911 CAGACACCAAAGCAGCAGGAGGG + Exonic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
933151779 2:78923507-78923529 CAAATACCAAAGCTGATGGATGG + Intergenic
935300886 2:101693133-101693155 CAGAAAGCAAAGCTGAGGCAGGG - Intergenic
935801601 2:106702328-106702350 CTGATTCCATACCTGTAGCAGGG + Intergenic
936951895 2:117985973-117985995 CATATTCCAAAAGTGTAGCATGG + Exonic
937487452 2:122330283-122330305 TAGAGACCAAAGCTGTCCCAAGG + Intergenic
938631715 2:133174721-133174743 TTGATTCCAAAGCTGGAGCAGGG - Intronic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
943263947 2:185701373-185701395 CAGATACAAAAGCTATTGCAGGG + Intergenic
946633207 2:221694610-221694632 CAGATGCAAAAACTGAAGCAAGG + Intergenic
946879266 2:224161057-224161079 CAGATACCAAAGATGTGCCAAGG - Intergenic
947308466 2:228774031-228774053 CAGATATCAGACCTGTATCATGG + Intergenic
1170848319 20:19981137-19981159 AAGAAACCAAAGGCGTAGCAAGG + Intronic
1173269691 20:41521732-41521754 CTGATTCCAAAGCTAAAGCAGGG + Intronic
1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG + Exonic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1175808164 20:61842686-61842708 CAGATTCCAGAGCTGTAGTTAGG - Intronic
1178604274 21:34021734-34021756 GAGATACAAAAGGTGTAGTAGGG - Intergenic
1182395740 22:30034492-30034514 AAAATACAAAAGCTGTAGCTAGG + Intergenic
949575759 3:5337938-5337960 CAGATATGAAAACTGTAGCTCGG - Intergenic
950854680 3:16093981-16094003 CAAATACCAAAACTGCAGAAAGG + Intergenic
952991095 3:38831536-38831558 CAGAGACCAAAGCTAGAGCAAGG - Intergenic
958028426 3:88076864-88076886 CAGATACCTAAGCTGCCACATGG + Intronic
958072496 3:88632299-88632321 AAGACACTGAAGCTGTAGCAGGG - Intergenic
958427872 3:94000253-94000275 CAGATACCATACATGTATCAGGG + Intronic
958485303 3:94698247-94698269 CAGTTGCCAAAGATGTGGCAGGG - Intergenic
959442813 3:106399523-106399545 CAGATAGCAAAGATGGAACAAGG - Intergenic
962359189 3:134723046-134723068 CAGACAACACAGCTTTAGCAGGG - Intronic
963797237 3:149642987-149643009 CAAATCCCAAATCTGTAACAAGG + Intronic
966638746 3:182164868-182164890 CAGATACCAAAGAAGGAGCTGGG - Intergenic
967341210 3:188400307-188400329 CAAATAGCAAAGCTGAAGCTGGG - Intronic
967801874 3:193670856-193670878 TAGATTCCATAGCTGGAGCAGGG + Intronic
968904701 4:3445865-3445887 CAGTTTCCAAATCTGTAGAATGG - Intronic
970708522 4:18834166-18834188 CAGATATCCATACTGTAGCATGG + Intergenic
974746147 4:66079598-66079620 TAGATACCTAACGTGTAGCATGG + Intergenic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
978600833 4:110425958-110425980 CAGATGACAAAGCTGAGGCACGG + Intronic
978651661 4:111012910-111012932 CAGCCACCATAGCTGTAACATGG - Intergenic
981276128 4:142900361-142900383 CACATTCATAAGCTGTAGCAGGG + Intergenic
982754638 4:159203711-159203733 CAGAAAGCAAAGCTGTAGGTTGG + Intronic
983067055 4:163223277-163223299 CAGATAAAAAAGCTGCAGGAAGG + Intergenic
983994198 4:174161024-174161046 CAGATACTAAAGCCGTTGGAGGG + Intergenic
986503781 5:8429118-8429140 CTGATATCAAAGTTCTAGCAGGG + Intergenic
986577376 5:9226305-9226327 CACACACCATAGCAGTAGCATGG - Intronic
988943563 5:36170982-36171004 CAGATTCAAATGCTGTACCATGG - Intronic
990877541 5:60502607-60502629 CAGATTGAAAACCTGTAGCAGGG - Intronic
991815857 5:70509803-70509825 CAGACACGGGAGCTGTAGCAGGG - Intergenic
992704802 5:79380303-79380325 CCGAGACCTAAGCTGCAGCAAGG + Intronic
994413717 5:99441643-99441665 CAGACAACAAAGATGTAGCCAGG - Intergenic
995841443 5:116446840-116446862 CAGAAACCAGAGCTTTGGCAGGG - Exonic
996406190 5:123106545-123106567 CAAATTCCAAAACTGTAACAGGG + Intronic
996494433 5:124137637-124137659 CTGTTAACAAAACTGTAGCATGG - Intergenic
998892226 5:146758314-146758336 CAGATCACAAAGCTGTTTCATGG - Intronic
998919497 5:147052286-147052308 CAAATACCAAGGCTGTTGTATGG - Intronic
999667906 5:153933068-153933090 CAAATTCAAAAGCTGTAACATGG + Intergenic
999762318 5:154712274-154712296 CAGTTTCCACATCTGTAGCATGG - Intergenic
1001449043 5:171810051-171810073 CAGACAGCAAAGCTGGAGGAAGG + Intergenic
1001967051 5:175917685-175917707 CAGAGGCCAGAGCTGTATCATGG - Intergenic
1002249884 5:177921527-177921549 CAGAGGCCAGAGCTGTATCATGG + Intergenic
1004218939 6:13728830-13728852 CTGATTCCAGGGCTGTAGCATGG - Intergenic
1008816183 6:55569582-55569604 CAGTTACCAAATCTGTAAAATGG + Intronic
1012557796 6:100536829-100536851 CCGATTCCAAAGCTGGGGCAGGG + Intronic
1012727787 6:102838504-102838526 CAGACATCAAAGGTGTAGGAAGG - Intergenic
1013417011 6:109934243-109934265 GAGCTACCATAGCTGTGGCAGGG - Intergenic
1016008467 6:139113506-139113528 CAGAATCCAAAGCTCTACCAAGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1017858260 6:158370744-158370766 CAGATACCCAAGTTTAAGCAGGG + Intronic
1018422554 6:163652126-163652148 CACAGACCAGAGCTGAAGCAGGG + Intergenic
1025296136 7:57776407-57776429 CTGTTACCAAAGCTGTGGCTCGG - Intergenic
1028974952 7:96902454-96902476 TAGATACCAAAGCCTTTGCATGG + Intergenic
1032777546 7:135129231-135129253 CAGATACCCATGATGTAGCCAGG - Intronic
1032933659 7:136703635-136703657 CAGATACCTAATCTGTAAAATGG - Intergenic
1036559839 8:9891974-9891996 CAGATGCCAAATCTGAAGCCAGG - Intergenic
1039000379 8:32973219-32973241 CAGAAAGCAAAGGTGAAGCAAGG - Intergenic
1039464947 8:37778322-37778344 CAGATACCAAATCAATAGCTAGG + Exonic
1045248395 8:100463081-100463103 CAGAAACCAAATCTCTGGCAAGG + Intergenic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1052156900 9:25203442-25203464 AAGATACCAAAAATGTAGAAGGG - Intergenic
1054729084 9:68682516-68682538 CTGACACCAAACCTGTAGCTGGG + Intergenic
1055077126 9:72227842-72227864 GAGAGACCGAAGCTGTAGCTTGG - Intronic
1055566535 9:77574765-77574787 CAGATAGCATAGCTGCAGCATGG - Intronic
1055707769 9:79025935-79025957 CAGTTACCAACCCTGCAGCATGG - Intergenic
1056482113 9:87016216-87016238 CTTAGACCAAAGCAGTAGCAGGG + Intergenic
1057444456 9:95104018-95104040 GAGAGACCCAAGCTGTAGGAGGG + Intronic
1059454701 9:114392500-114392522 CAGATTCCACATCTGTAACATGG + Intronic
1062125615 9:134860092-134860114 TAGATACCAAAGTTGAGGCATGG + Intergenic
1062315217 9:135963845-135963867 CAGATACCAGATCTGCAGCCAGG - Intergenic
1185848709 X:3465049-3465071 GAGGTACCAAAGCTGGAGGAAGG - Intergenic
1187450305 X:19390208-19390230 CAGTCACCAAAGCTGTAGGGTGG - Intronic
1188753583 X:33933440-33933462 CTGATACCAAGGCTGGAGGAGGG - Intergenic
1189096393 X:38144659-38144681 AAGATACTAAAGCTATAGGAAGG - Intronic
1189717514 X:43881613-43881635 CAGAGAGCAAAGCTGCAGCTTGG + Intronic
1191813391 X:65216566-65216588 CAGAGACCAATGCCGTACCAGGG - Intergenic
1195780976 X:108463672-108463694 CAGGTAACAAAGGTGTAACATGG + Intronic
1197747058 X:129938707-129938729 CAGAAACCCAAGAGGTAGCATGG - Intergenic
1198181190 X:134210861-134210883 CAGATACCAAGGATGCAGAAAGG + Intergenic
1200814933 Y:7521781-7521803 GAGGTACCAAAGCTGGAGGAAGG + Intergenic
1201056445 Y:9997165-9997187 CAGTTACCAACTGTGTAGCATGG - Intergenic
1201474578 Y:14366603-14366625 CAGAATCCAGAGCTGTAGAAGGG + Intergenic
1202104236 Y:21345678-21345700 CAGTTACCAACTGTGTAGCATGG + Intergenic