ID: 1121109255

View in Genome Browser
Species Human (GRCh38)
Location 14:91301377-91301399
Sequence AGGTTTTGGCAGGTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121109255_1121109260 12 Left 1121109255 14:91301377-91301399 CCAGACTCCACCTGCCAAAACCT 0: 1
1: 0
2: 1
3: 13
4: 314
Right 1121109260 14:91301412-91301434 TGCACATTAAGAATACAATAAGG 0: 1
1: 0
2: 2
3: 19
4: 350
1121109255_1121109261 13 Left 1121109255 14:91301377-91301399 CCAGACTCCACCTGCCAAAACCT 0: 1
1: 0
2: 1
3: 13
4: 314
Right 1121109261 14:91301413-91301435 GCACATTAAGAATACAATAAGGG 0: 1
1: 0
2: 1
3: 31
4: 332
1121109255_1121109263 23 Left 1121109255 14:91301377-91301399 CCAGACTCCACCTGCCAAAACCT 0: 1
1: 0
2: 1
3: 13
4: 314
Right 1121109263 14:91301423-91301445 AATACAATAAGGGGTCAGCACGG 0: 1
1: 0
2: 2
3: 8
4: 161
1121109255_1121109262 14 Left 1121109255 14:91301377-91301399 CCAGACTCCACCTGCCAAAACCT 0: 1
1: 0
2: 1
3: 13
4: 314
Right 1121109262 14:91301414-91301436 CACATTAAGAATACAATAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 345
1121109255_1121109264 26 Left 1121109255 14:91301377-91301399 CCAGACTCCACCTGCCAAAACCT 0: 1
1: 0
2: 1
3: 13
4: 314
Right 1121109264 14:91301426-91301448 ACAATAAGGGGTCAGCACGGTGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121109255 Original CRISPR AGGTTTTGGCAGGTGGAGTC TGG (reversed) Intronic
901615437 1:10535817-10535839 ACGTTTAGACAGGTGGAGGCAGG + Intronic
901671229 1:10857411-10857433 AGGTGGAGGCAGGTGGAGCCCGG - Intergenic
901797182 1:11686647-11686669 ACACTTTGGCAGGTGGAGGCGGG - Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
902379644 1:16046684-16046706 AGGTTTTGGCCAGTGGGGACTGG - Intronic
903674809 1:25056830-25056852 GGGGTTTGGCAGGAGGAGTGTGG - Intergenic
903893008 1:26582674-26582696 AGGTTTTGGGAGGCTGAGGCAGG - Intergenic
904004341 1:27355978-27356000 AGGCTTTGGCTGGTGAGGTCAGG + Intronic
904377178 1:30089147-30089169 GGGCTATGGCAGGTGGAGTTTGG + Intergenic
905251662 1:36652855-36652877 AGGTTTTGGAGGCTGGAGGCTGG + Intergenic
905693047 1:39956463-39956485 AGGTTGTGGCAGCTGGTGCCGGG + Intronic
905720853 1:40200158-40200180 ATGATTTAGCAAGTGGAGTCTGG - Intronic
906962165 1:50425439-50425461 AGGTGTTGGAAGGTGGGGTCTGG - Intergenic
907033627 1:51196798-51196820 AGCATTTAGGAGGTGGAGTCAGG + Intergenic
907695863 1:56728235-56728257 ACGTTTTGACAGGTGAAGACTGG - Intronic
908096813 1:60747846-60747868 GGGTTGTGGTAGGTGGAGTAAGG - Intergenic
908657230 1:66401144-66401166 GTGTTTTGGCAGGCTGAGTCAGG - Intergenic
911183031 1:94877692-94877714 AAGTTTTGGCAAGTGGATCCAGG + Intronic
913174818 1:116263712-116263734 AGGCTTTGGGAGGTCGAGTGTGG + Intergenic
913446021 1:118951657-118951679 AGGTTTTGCCACTTGGAATCAGG - Intronic
915416181 1:155744964-155744986 AGGTTTTGGGAGGCTGAGGCAGG - Intergenic
915915542 1:159938304-159938326 GGGCTTTGGCAGGCGGGGTCTGG - Intronic
916766309 1:167863802-167863824 AGGAATTGGCACTTGGAGTCCGG + Intronic
917831921 1:178899759-178899781 AAAATTTGGCAGGTGGAGTAAGG + Intronic
919690567 1:200524979-200525001 AGGTTGTGGCAGGTGGGGTGTGG - Intergenic
919818264 1:201455742-201455764 AGGGTTTGGCTGCTGGGGTCAGG + Intergenic
920398088 1:205660860-205660882 AGGTTTTGGTTGGGGGAGCCTGG - Intronic
920703616 1:208235996-208236018 AGTTTTAAGCAGCTGGAGTCAGG + Intronic
921022039 1:211244653-211244675 ACATTTTGGGAGGTGGAGGCGGG + Intergenic
924085486 1:240447151-240447173 TGGTTTTGGCTGCTGGACTCTGG + Intronic
924244788 1:242073637-242073659 AGGTCTTGGCAGGCTGAGGCGGG + Intergenic
924576191 1:245283098-245283120 AGGTGGTGGCAGGGGGAGCCAGG - Intronic
1063444720 10:6104098-6104120 AGGTTTAGGAAAGTGGGGTCAGG + Intronic
1065251341 10:23817841-23817863 ACATTTTGGCAGGTTGAGGCAGG + Intronic
1065488094 10:26254281-26254303 ATGTTTTGGGAGGTCGAGGCGGG - Intronic
1066127264 10:32353511-32353533 TGGTTTTGGTAGCAGGAGTCCGG + Intronic
1067466553 10:46503404-46503426 GGGTTGTGGCAGGAGAAGTCGGG - Intergenic
1067620635 10:47881201-47881223 GGGTTGTGGCAGGAGAAGTCGGG + Intergenic
1070280999 10:75048644-75048666 TGGGTTTGGGAGGTGGAGGCAGG - Intronic
1070307566 10:75248678-75248700 AGGTTTTGGCAGGCAGAGCGTGG - Intergenic
1070784522 10:79155287-79155309 AGGTGTTGGCTGGGGCAGTCGGG + Intronic
1071857302 10:89638726-89638748 AGGTATTGGAAAGTGGAGTAAGG - Intronic
1074965655 10:118488752-118488774 AGTTTTTGGCAGGAGGCCTCAGG + Intergenic
1076121402 10:127939788-127939810 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121415 10:127939848-127939870 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121427 10:127939908-127939930 AGATGTAGGCAGGTGGAGGCAGG + Intronic
1077463435 11:2722241-2722263 AGGTGTTGACAGGTGGAGAGAGG + Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1079240644 11:18720124-18720146 AGGTTCAGACAGGGGGAGTCTGG + Intronic
1079243193 11:18735252-18735274 AGGTTTTGGCAGGTGATTTGGGG + Intronic
1081457077 11:43234151-43234173 AGGGTTTGGAGGGTGGAGACAGG - Intergenic
1081905820 11:46669027-46669049 AGGGATGGACAGGTGGAGTCTGG + Intronic
1083396084 11:62393030-62393052 TGTCTTTGGCAGGTGGAGGCTGG - Exonic
1083998592 11:66284081-66284103 AGGTTGGGGCAGATGGAGACAGG - Exonic
1084319884 11:68367352-68367374 AGGTTCTAGCAGGTGGGGTCTGG + Intronic
1087560623 11:99785053-99785075 AGGCATAGGCAGGTGGAGGCAGG - Intronic
1088005197 11:104931204-104931226 AAGTTCTGGCAAGTGCAGTCAGG + Intergenic
1089576486 11:119447951-119447973 AGGTGGAGGCAGGTGGAGACAGG - Intergenic
1091445516 12:542514-542536 AGGTTGTGGGAGGTGGGGCCTGG - Intronic
1094396590 12:30013461-30013483 AGGTTTTGAAAGGTACAGTCAGG + Intergenic
1094823109 12:34242814-34242836 AGGTTTTGGCAGTGAGAGTTTGG + Intergenic
1095091569 12:38112261-38112283 AGGTTTTGGCAGTGAGAGTTTGG - Intergenic
1096404801 12:51335881-51335903 AGATTTTGGCAGATTGAGGCAGG - Intronic
1101293173 12:103392933-103392955 AGGTGGTGGCAGGTGGTATCAGG + Intronic
1101418230 12:104527213-104527235 AGGTGTTGGCAGGTCAGGTCTGG - Intronic
1101701362 12:107177426-107177448 AGGGTTTGGCAAGTGGACTTTGG - Intergenic
1103992724 12:124809992-124810014 AGGCATTGGCAGCTGGAGTTTGG + Intronic
1106152764 13:27122092-27122114 AGGCTAAGGCAGGTGGACTCAGG + Intronic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1111049506 13:82862220-82862242 GGGCTTTGGGAGGTGGAGACAGG - Intergenic
1111331583 13:86765397-86765419 AGGTTCTGGAAGGGGGAGTTCGG + Intergenic
1112365055 13:98749382-98749404 AGGTCTTGGCAGATAGAGGCAGG + Intronic
1114006487 14:18319328-18319350 GCATTTTGGCAGGTGGAGGCGGG - Intergenic
1117861234 14:60094644-60094666 AGGTATGGGCAGGAGGGGTCTGG - Intronic
1118090839 14:62475762-62475784 AGGTATTGGCAGCAGGAGTGGGG - Intergenic
1119699447 14:76743233-76743255 AGGGCTTGGCAGGTGGAGGAGGG - Intergenic
1120718837 14:87868808-87868830 AGCTTTTGGGAGGGGGAGGCTGG + Intronic
1121109255 14:91301377-91301399 AGGTTTTGGCAGGTGGAGTCTGG - Intronic
1123054949 14:105564890-105564912 AGGCTTTGGCACATGGGGTCAGG - Intergenic
1123079391 14:105684469-105684491 AGGCTTTGGCACATGGGGTCAGG - Intergenic
1123079913 14:105687035-105687057 AGGCTTTGGCACATGGGGTCAGG - Intergenic
1202834591 14_GL000009v2_random:68469-68491 GGGTGTTGGAAGGTGGAGACTGG + Intergenic
1123390418 15:19865975-19865997 GCATTTTGGCAGGTGGAGGCGGG - Intergenic
1125365123 15:38905344-38905366 AGATGCTGGCAGGTTGAGTCTGG + Intergenic
1127010812 15:54625416-54625438 AGTTTTTGGCATGAGGAGTTGGG + Intronic
1128136338 15:65266458-65266480 AGGAGTTTGCAGGTGGGGTCGGG - Intronic
1128593212 15:68921117-68921139 AGAATTTTTCAGGTGGAGTCTGG - Intronic
1130022338 15:80241919-80241941 GTGTTTTGGAAGGTGAAGTCAGG - Intergenic
1130207370 15:81889690-81889712 AGGTTTTGCAATTTGGAGTCAGG + Intergenic
1131096867 15:89661438-89661460 TGGTTTTGGCAGGTTGGGGCTGG + Intergenic
1132878381 16:2150165-2150187 AGGTGTTGGAAGGTCGAGGCAGG - Intronic
1133143636 16:3767263-3767285 AGGTTTCTGCAGGTGCAGTGAGG - Intronic
1133439170 16:5806302-5806324 AGGTGTTGGCATTTGGCGTCTGG + Intergenic
1135538327 16:23311656-23311678 AGGCTTTGGCAGGTTGGGTTAGG + Intronic
1136067855 16:27770813-27770835 AGGCTCTGGCTGGTGGAGCCAGG + Intronic
1137325620 16:47432404-47432426 TGTTCTTGGCAGGTGGAATCTGG + Intronic
1137445034 16:48526496-48526518 AGATTATGGGAGGTGGTGTCAGG - Intergenic
1137795434 16:51213750-51213772 AGGTTTGGGCAGCTGGAGTGTGG - Intergenic
1138603259 16:58070495-58070517 AGGGTGTGGCAGATGCAGTCAGG - Intergenic
1138779560 16:59766693-59766715 AGGTATTGGCTGGAGGAGTCTGG - Intergenic
1143082200 17:4389852-4389874 TTTTTTTTGCAGGTGGAGTCTGG + Intergenic
1143186264 17:5012353-5012375 TGATTTTGGCAGGTGGGGGCGGG + Intronic
1145185039 17:20786771-20786793 GGATTTTAGGAGGTGGAGTCGGG + Intergenic
1146106300 17:30040249-30040271 TGGTTTTGGAAGATGGAGGCTGG - Intronic
1146257161 17:31398361-31398383 AGGTTTTGCCAAATGGATTCAGG - Intronic
1146496353 17:33325874-33325896 AGGTTTTGGCCAGTGCAGTTGGG + Intronic
1146822746 17:35997894-35997916 AGGTGTGGGCAGATGGAGACAGG + Intronic
1147758125 17:42781497-42781519 AGATTGAGGCAGGTGGTGTCTGG + Intronic
1148697631 17:49570641-49570663 AGGGCGTGGCAGCTGGAGTCCGG - Intergenic
1149985534 17:61344210-61344232 TGATTTTGGCAGGTGAACTCAGG - Intronic
1150152141 17:62818769-62818791 AGGTTGTGAGAGTTGGAGTCAGG + Intergenic
1150218696 17:63484024-63484046 AGGGTGTGGCAGGAGGTGTCTGG + Intergenic
1151322414 17:73359886-73359908 ACATTTTGGGAGGTGGAGGCGGG - Intronic
1151751763 17:76043001-76043023 AGGTTTTGGGAGGCAGAGGCAGG + Intronic
1152486725 17:80599448-80599470 ATGTTTTGGAAGCTGGAGCCAGG + Intronic
1152707437 17:81851934-81851956 ATGTTTTGGCAGGCTGAGGCAGG + Intronic
1153764496 18:8362539-8362561 AGGCTCTGGCAGGTGGGGGCTGG - Intronic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1154120746 18:11650418-11650440 ATATTTTGGAAGGTGGAGGCGGG + Intergenic
1155603636 18:27577489-27577511 AGGTGGTGGAAGGTGGAGGCAGG + Intergenic
1157161976 18:45321858-45321880 AGGTTTTGGCATGTTCTGTCTGG + Intronic
1158569897 18:58589321-58589343 AGTTTTGGGCAGGAGGAGGCCGG + Intronic
1160241989 18:77131637-77131659 CCGTTTTGGAAGGTGGAGTGGGG - Intronic
1160599855 18:80004287-80004309 AGGCTTTGGGTGGTGGTGTCAGG - Intronic
1160906850 19:1455664-1455686 AGGTGTTGGTGGGTGGAGTCAGG + Intronic
1160922810 19:1528727-1528749 AGGTGTGGGCAGGTGGGGGCAGG - Intronic
1161766866 19:6213176-6213198 AGGTGGTGGCAGGTGGCTTCAGG + Intronic
1161874471 19:6897187-6897209 AGGTTTTTGCAGGATGAGTTAGG - Exonic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1162527788 19:11216703-11216725 AGAATTTGGAAGGTGGAGGCCGG - Intronic
1162723655 19:12676857-12676879 AGGTTTTGGAAGGAGGCTTCTGG - Intronic
1163929365 19:20374269-20374291 TGGTTTTGGAAGATGGAGGCTGG - Intergenic
1164131002 19:22361867-22361889 AGGAATTGGCACTTGGAGTCTGG - Intergenic
1164480366 19:28607068-28607090 AGGAACTGGCACGTGGAGTCCGG + Intergenic
1165285318 19:34837423-34837445 AGGTCTGGGCAGGAGGGGTCTGG + Intergenic
1166183734 19:41125688-41125710 AGGATTTGGCAAGTGGAATTAGG - Intronic
1168720440 19:58551792-58551814 GGGTTTGAGCAGGTGGGGTCAGG + Intronic
926226028 2:10967482-10967504 AGGTTTTTGGAGGTGGGGGCAGG + Intergenic
926349899 2:11984929-11984951 AGGTATCTGCAGCTGGAGTCTGG + Intergenic
927229848 2:20811312-20811334 AGTTTTTAGAAGGTTGAGTCCGG - Intronic
927712848 2:25336405-25336427 AGGATGTGGCAGGTGGAGAAGGG - Intronic
929326182 2:40614143-40614165 AGGTGCTGGCAGATGGTGTCTGG + Intergenic
930445064 2:51459969-51459991 AGGTTTTGGCATGGGGAAGCTGG - Intergenic
932203460 2:69854482-69854504 AGGTCTTGGGAGGGGGATTCTGG + Intronic
933663336 2:84945207-84945229 AGGTATTTGGAGGTGGAATCAGG - Intergenic
934770959 2:96907413-96907435 AGGCCTTGCCAGGTGGGGTCAGG - Intronic
935113098 2:100109870-100109892 AAGTTGTGGGAGGTGGAGTATGG - Intronic
935507945 2:103930989-103931011 GGATTTTGGGAGGTGGAGGCAGG - Intergenic
935670185 2:105548743-105548765 TGGTTTTGGAAGATGGAGGCTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936837417 2:116724731-116724753 AGGTTTGGGCAGGCCTAGTCAGG + Intergenic
937057204 2:118949075-118949097 TGGTTTTGGAAGATGGAGGCTGG + Intronic
937063133 2:118994963-118994985 CCGGTTGGGCAGGTGGAGTCAGG - Intergenic
938530074 2:132176145-132176167 GCATTTTGGCAGGTGGAGGCGGG + Intronic
938645993 2:133330640-133330662 AGGCTTTGGGAGGTTGAATCAGG + Intronic
938777180 2:134552272-134552294 AAGTTGTTGCAGGTGGAGTCTGG - Intronic
938812139 2:134863381-134863403 AGGTTTGGCCTGGTGGAGACAGG - Exonic
939725754 2:145719512-145719534 AGCTACTGGCAGGTGGTGTCTGG + Intergenic
941130067 2:161636961-161636983 TGGTTTTGGGAGGCGGAGGCAGG - Intronic
942656304 2:178217611-178217633 AGGTTTGAGGAGGTGGTGTCTGG + Intronic
945129684 2:206557174-206557196 ACACTTTGGCAGGTGGAGGCTGG - Intronic
946760827 2:222991463-222991485 AGATTTTGGGAGGCTGAGTCAGG - Intergenic
947637214 2:231686169-231686191 GGGTCTTGGAAGGGGGAGTCGGG + Intergenic
947928330 2:233940922-233940944 TGGTTTTTGCAGGTGTAGTCAGG + Intronic
948177366 2:235954677-235954699 AGGGGTTGGCAGGTAGAGGCGGG - Intronic
1168815325 20:732838-732860 GGGTTTAGGCAGATGTAGTCAGG + Intergenic
1171146579 20:22789433-22789455 CAGTTTTGGCAGGTGGCCTCTGG + Intergenic
1171884681 20:30643285-30643307 GGGTTTTGGAAGGTGGAGATTGG - Intergenic
1172151912 20:32796727-32796749 AGGCTTTAGCAGCTGGTGTCAGG + Intronic
1172351683 20:34247841-34247863 GCACTTTGGCAGGTGGAGTCAGG - Intronic
1172472449 20:35209978-35210000 ATGTTTTGGGAGGCTGAGTCTGG + Intergenic
1173187945 20:40855630-40855652 AGGACCTGGCTGGTGGAGTCTGG - Intergenic
1173208309 20:41011971-41011993 AGGTTTTGGGTGGTGGAGATGGG + Intergenic
1173886284 20:46462016-46462038 AGGTATGGGCAGGAGGGGTCTGG - Intergenic
1174272648 20:49380788-49380810 AAGTTCTTGCAGGTGGGGTCAGG - Intronic
1175213272 20:57375159-57375181 TGGTTTGGGCAGGGGGAGTTAGG + Intronic
1175378277 20:58544436-58544458 AGGCTTTGGCTGGTGCAGTGAGG + Intergenic
1175655801 20:60769441-60769463 AGAATTAGGCAGGTGCAGTCAGG - Intergenic
1176873748 21:14105281-14105303 AGGTTTTGGCAGTGAGAGTTTGG + Intergenic
1177658050 21:24045252-24045274 AGCTTTTGGCTTGTGGAGACAGG - Intergenic
1179510789 21:41871878-41871900 AGGTGTGCGCAGGTGGAGGCCGG - Intronic
1180160069 21:45995174-45995196 AGGGCTTGGCAGGCGGGGTCTGG + Intronic
1180430996 22:15250139-15250161 GCATTTTGGCAGGTGGAGGCGGG - Intergenic
1180513558 22:16118048-16118070 GCATTTTGGCAGGTGGAGGCAGG - Intergenic
1181017467 22:20079653-20079675 GAGTTTTGGGAGGTCGAGTCAGG - Intergenic
1181776011 22:25160702-25160724 AGGTGTGGCCAGGTGTAGTCAGG - Intronic
1181805532 22:25372469-25372491 AAGTTCTAGCAGGTGGGGTCTGG - Intronic
1183644672 22:39117642-39117664 AGGTTTTGGCAGGTTTGGTCCGG - Intergenic
1183816220 22:40303091-40303113 AGGTTGTGGGAGGTGGAGGTTGG - Intronic
1184092704 22:42300825-42300847 AGGTCTTGGCAGGGGGAGGAGGG - Intronic
1184766510 22:46575383-46575405 GAGCCTTGGCAGGTGGAGTCCGG + Intergenic
1185299123 22:50070358-50070380 GGGTTGTGGGAGGTGGAGGCTGG - Intronic
950126458 3:10512824-10512846 AGAGTTTGGGAGCTGGAGTCTGG + Intronic
950428729 3:12938803-12938825 AGGTTTGGGCAGGAGGTCTCAGG - Intronic
950980731 3:17301784-17301806 AGATTTAGGTAGGTGGAGCCAGG + Intronic
954082152 3:48218694-48218716 ATGTTTTGGCAAGTGAGGTCAGG - Intergenic
954770670 3:52965399-52965421 AGTTTTTGGAAGTTTGAGTCTGG - Intronic
956738874 3:72259487-72259509 AGGTGTTGGCAGGTGAAGTCGGG - Intergenic
957573838 3:81984391-81984413 AGGATTTGACAAGTGGAGTGTGG - Intergenic
957729985 3:84122023-84122045 AGATTTTGGGAGGTTGAGGCAGG + Intergenic
961778453 3:129306940-129306962 AGGTGTGGCCAGGTGGAGCCAGG + Intergenic
962856585 3:139351670-139351692 ATGTTGTGGCAGGTGGAGCTGGG + Intronic
966364236 3:179165501-179165523 AGGCTTTGGGAGGTGGAGGTGGG - Intronic
966742618 3:183248586-183248608 ACACTTTGGCAGGTGGAGGCAGG + Intronic
968881162 4:3300938-3300960 AGGTCTAGGCAGGTGCAGTGGGG - Intronic
969157993 4:5230105-5230127 AGGTTTTGGGAGGCTGAGGCAGG - Intronic
969274955 4:6128689-6128711 AGGACTTGGCAGGTGGAGCATGG - Intronic
972323549 4:37994101-37994123 AGGTCCTGGAAGGTGGAGGCAGG + Intronic
973292254 4:48482646-48482668 AGTTATTGGCAGGTGGAGAGAGG - Intergenic
973888000 4:55342163-55342185 TGGTTTTGGAAGATGGAGGCTGG - Intergenic
974281086 4:59794871-59794893 ACAATTTGGGAGGTGGAGTCAGG + Intergenic
975621396 4:76300191-76300213 AAGTTTTGAAGGGTGGAGTCAGG - Intronic
976339619 4:83932510-83932532 AGATTTTGGGAGCTGGTGTCTGG - Intergenic
979862147 4:125707384-125707406 AGAGTTTGGCAGGGGCAGTCAGG - Intergenic
982385787 4:154800610-154800632 AGGTTTTGGGGGGTGGAGGAGGG - Intronic
982756159 4:159221000-159221022 AGGTAATGGAAGGAGGAGTCTGG + Intronic
983411437 4:167403377-167403399 AGGTTTTGGCAGGGGGCTTTTGG - Intergenic
983554881 4:169051218-169051240 AGGGTTTCGCAGGTGGGGGCTGG - Intergenic
983689070 4:170446126-170446148 AGGTTCTGGCAGGGAGACTCAGG - Intergenic
984381839 4:179002975-179002997 GGGTTATGGCAGGTATAGTCAGG - Intergenic
984495643 4:180494002-180494024 AGGTTGAGGCAGGAGGAGCCTGG + Intergenic
1202765432 4_GL000008v2_random:145082-145104 GGGTGTTGGAAGGTGGAGACTGG - Intergenic
986261141 5:6147536-6147558 AGGTACTGGCAGCTGGTGTCTGG + Intergenic
986353343 5:6900931-6900953 TGGTTTTGGCAGCCGGAGTGAGG + Intergenic
987004024 5:13690593-13690615 AGTTTTTGGTAGGTGGATACCGG - Exonic
987130623 5:14856820-14856842 AGCTTCTGGCATGTGGAGCCAGG - Intronic
996986526 5:129573086-129573108 AGGGATTGGCAGGTGAAGTCTGG - Intronic
997662908 5:135603273-135603295 AGGGTTTGGGAGCTGGTGTCTGG - Intergenic
998868609 5:146530328-146530350 TGGCTTTGGCAAGTGGAGGCAGG + Intergenic
999253713 5:150197384-150197406 TGGTGATGGCAGGTGGACTCTGG + Intronic
1000943228 5:167388684-167388706 AGGTTTTGATAGGTTGTGTCAGG + Intronic
1001216789 5:169863940-169863962 AGGTGTTGGAAGGTGTAGTGTGG + Intronic
1001549045 5:172588685-172588707 AGGGTTTGGGATCTGGAGTCAGG - Intergenic
1001937985 5:175719746-175719768 TGGCCTTGGCAGGTGGAGTGGGG - Intergenic
1002098590 5:176846323-176846345 AGGTTGTAGGAGGTGGAGCCAGG + Intronic
1003232909 6:4270952-4270974 AGGTTTTGGCAAATGGTCTCAGG + Intergenic
1004135890 6:12966125-12966147 AGGTGATGGAAGGTTGAGTCTGG + Intronic
1004470050 6:15920958-15920980 AGGATTTGGAAAGAGGAGTCTGG - Intergenic
1008655156 6:53604518-53604540 ATGCTTTGGCAGGTTGAGGCAGG - Intronic
1010089104 6:71958682-71958704 AGGTAATGGGAGGTGAAGTCTGG + Intronic
1010259978 6:73804537-73804559 TGGTGTTGGCAGGTGGGGGCTGG + Intronic
1011449744 6:87480198-87480220 TGGTTTTGGAAGATGGAGGCTGG + Intronic
1011677138 6:89745598-89745620 TGCTTCTGGCAGGTCGAGTCAGG - Exonic
1013179496 6:107706315-107706337 AGATTTGGGCAGGGGGAGTCTGG - Intronic
1014571689 6:123016567-123016589 ACTTATTGGCAGATGGAGTCTGG - Intronic
1015563046 6:134537126-134537148 AGATTTTGGTAAGTGGAGTAGGG + Intergenic
1016797921 6:148137656-148137678 GGGTTTTGGCATGGGGAATCTGG + Intergenic
1016896006 6:149053902-149053924 AAGTATTGTCAGGTGGAGCCTGG + Intronic
1017084852 6:150704513-150704535 AGGCTGAGGCAGGTGGAGTAAGG + Intronic
1017734213 6:157346271-157346293 AGGCTCTGGCAGGTGCAGTGTGG - Intergenic
1018463988 6:164025854-164025876 AGGATTTGGTAGGCAGAGTCGGG - Intergenic
1019471211 7:1222251-1222273 AGCTTTTAGCACGTGGACTCTGG - Intergenic
1019930352 7:4218690-4218712 AGGGCTGGGCAGGTGGACTCAGG + Intronic
1020058217 7:5133269-5133291 AGGTTTTGGGAGGCTGAGGCAGG - Intergenic
1021146247 7:17092639-17092661 AGGTTAAGGCAGGTGGATCCTGG - Intergenic
1021802488 7:24321228-24321250 AGATTTTGGGAGGTCGAGGCGGG + Intergenic
1022156861 7:27669496-27669518 ACATTTTGGGAGGTGGAGGCGGG - Intergenic
1022189503 7:28003689-28003711 AAATTTTGGCAGGTGGAGGTGGG - Intronic
1022434889 7:30373685-30373707 ATGCTTTGGGAGGTGGAGGCGGG + Intronic
1022475427 7:30706741-30706763 AGGTGCTGGCAGGTGGTGTCTGG + Intronic
1022489852 7:30808211-30808233 AGGAATTGGCACTTGGAGTCCGG + Intronic
1023891331 7:44393979-44394001 AGGTTTTGGCAGCAGGAGCTTGG - Intronic
1023970565 7:44987649-44987671 AGGTTTTGCAATTTGGAGTCAGG - Intergenic
1024864351 7:53887585-53887607 AGGTTGGGGCAGGCTGAGTCAGG + Intergenic
1025721203 7:64016382-64016404 AGGTTTTGGGAGGCTGAGGCAGG - Intergenic
1025875354 7:65476320-65476342 AGGTTCTGGAAGGGGGAGTTCGG - Intergenic
1026088788 7:67283376-67283398 ACTTTTTGAGAGGTGGAGTCAGG - Intergenic
1026311585 7:69190450-69190472 GGACTTTGACAGGTGGAGTCTGG - Intergenic
1028016959 7:85727574-85727596 AGGCTTTGGTGGATGGAGTCAGG - Intergenic
1028803926 7:95002321-95002343 AGGCCTTGGGAGGAGGAGTCAGG + Intronic
1028835100 7:95366017-95366039 ATTTTTTGGCAGGGGGAGTGGGG + Intronic
1029485626 7:100838245-100838267 ATGCTTTGGAAGGTGGAGGCAGG - Intronic
1030080778 7:105775918-105775940 AGGCTCTGGGAGGGGGAGTCTGG + Intronic
1030610104 7:111679979-111680001 TGGTTTTGGCAGGTTTTGTCTGG + Intergenic
1032170352 7:129579117-129579139 AGGAATTGGCACTTGGAGTCTGG + Intergenic
1034568353 7:151933703-151933725 AGGCCGAGGCAGGTGGAGTCAGG - Intergenic
1035205630 7:157292276-157292298 AGGTTTGGGAAGGAGAAGTCTGG - Intergenic
1036642221 8:10591700-10591722 TGGGTTGGGCAGGTGGAGACAGG + Intergenic
1036953194 8:13160788-13160810 AGATTTAGGAAGGTGGAGCCGGG + Intronic
1037192023 8:16137744-16137766 AGATTTTGGGAGGTTGAGGCAGG + Intronic
1038269996 8:26067374-26067396 TGTTTGTGGCAGGTGGAGTATGG - Intergenic
1039256901 8:35729036-35729058 ATGTTTGGGCAGGAGGAGTGGGG + Intronic
1041396580 8:57397765-57397787 AGGTGGAGGCACGTGGAGTCAGG - Intergenic
1043339055 8:79215210-79215232 AGGTCTTGGGAGGTGGGGTGTGG + Intergenic
1045269198 8:100647811-100647833 AGGCATTGGCAGGGGGAGGCAGG - Intronic
1046779072 8:118195900-118195922 GGGTGTTGGCAGCTGGAGTTTGG + Intronic
1048438956 8:134445738-134445760 AGGCAGTGGCAGGTGGGGTCTGG - Intergenic
1048890572 8:138942881-138942903 TGGATTAGGCAGGTGGACTCTGG + Intergenic
1049425609 8:142536683-142536705 AGGTTCTCGCAGGCGGACTCTGG + Intronic
1050424518 9:5500024-5500046 AGGTATGGGCAGGAGGGGTCTGG + Intergenic
1050529171 9:6573212-6573234 AGGCTGAGGCAGGTGGAGGCAGG + Intronic
1050886371 9:10771666-10771688 AGGTTTTAGCAGGTGAAGGAAGG - Intergenic
1053459943 9:38260532-38260554 AAGTGTTTGCAGGTGGAGGCGGG + Intergenic
1053708681 9:40782604-40782626 GCATTTTGGCAGGTGGAGGCAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054418590 9:64903399-64903421 GCATTTTGGCAGGTGGAGGCAGG + Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054734425 9:68736029-68736051 AAATTTGGGCAGGTGGTGTCTGG + Intronic
1055294614 9:74821395-74821417 AGGTGTTTGCAGGGGGAGTGAGG - Intronic
1055512347 9:77007592-77007614 AGGCTGAGGCAGGCGGAGTCAGG + Intergenic
1057664567 9:97034807-97034829 AGGTTTTTGCTGCTGCAGTCTGG + Exonic
1057806051 9:98220730-98220752 AGGGTTTGCTAGGTGGAGTGGGG - Intronic
1058889518 9:109348971-109348993 GAGCTTTGGCAGGTGGAGGCAGG - Intergenic
1060679926 9:125553293-125553315 AGGATTTGGGAGGTAGAGGCAGG + Intronic
1061309416 9:129752590-129752612 AGGTTCTGGAGGGTGGAGTGTGG - Intronic
1061586188 9:131570383-131570405 ACATTTTGGGAGGTGGAGGCAGG - Intergenic
1061736010 9:132659630-132659652 AGGTTTTGCCATGCGGTGTCTGG - Intronic
1062165018 9:135103328-135103350 AGGTCTTGGCAGAAGCAGTCTGG + Intronic
1186123539 X:6387878-6387900 AGGTGGTGGAAGGTGGATTCAGG + Intergenic
1186281333 X:7996045-7996067 AGCCTTTGGGAGGTGGAGGCGGG - Intergenic
1189038929 X:37521252-37521274 AGGGTTTGGCAGGAGGAGGAGGG + Intronic
1189260164 X:39672886-39672908 AGCTGTTGGCAGAAGGAGTCAGG - Intergenic
1189349834 X:40267893-40267915 AGGTTGAGGCATCTGGAGTCGGG - Intergenic
1189585306 X:42454856-42454878 AGGATGTGGCAGGTGAAGCCTGG - Intergenic
1190248885 X:48707669-48707691 AGGTGGGGGCAGGTGGAGGCAGG - Exonic
1194141496 X:90215775-90215797 AGGTATGGGCAGGAGGGGTCTGG + Intergenic
1195802161 X:108724965-108724987 AGATTTTGGTAGGAGGAGTAGGG - Intronic
1196306258 X:114106747-114106769 AGGTTTTGCCTTTTGGAGTCAGG - Intergenic
1196731921 X:118949618-118949640 ACAGTTTGGCAGGTGGAGACAGG + Intergenic
1196792867 X:119480093-119480115 GAGTATGGGCAGGTGGAGTCTGG - Intergenic
1197355324 X:125432242-125432264 AGGTTTGAGGAGGTGGTGTCTGG + Intergenic
1198127980 X:133666073-133666095 TGGTTTTGGAAGCTGGAGTACGG - Intronic
1198910356 X:141606871-141606893 GGGATTGGACAGGTGGAGTCAGG + Intronic
1200487248 Y:3784879-3784901 AGGTATGGGCAGGAGGGGTCTGG + Intergenic
1201582521 Y:15525402-15525424 GCGTTTTGGGAGGTGGAGGCAGG - Intergenic
1201696433 Y:16832062-16832084 AGGAAGTGGCAGTTGGAGTCTGG + Intergenic