ID: 1121109493

View in Genome Browser
Species Human (GRCh38)
Location 14:91303101-91303123
Sequence CTTCCCTGGACCTCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121109493_1121109501 18 Left 1121109493 14:91303101-91303123 CCTGCAGGGGAGGTCCAGGGAAG 0: 1
1: 0
2: 1
3: 41
4: 352
Right 1121109501 14:91303142-91303164 CCTGACAGACTCCCCAGGCCTGG 0: 1
1: 1
2: 3
3: 32
4: 291
1121109493_1121109499 13 Left 1121109493 14:91303101-91303123 CCTGCAGGGGAGGTCCAGGGAAG 0: 1
1: 0
2: 1
3: 41
4: 352
Right 1121109499 14:91303137-91303159 CGCAGCCTGACAGACTCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 147
1121109493_1121109502 25 Left 1121109493 14:91303101-91303123 CCTGCAGGGGAGGTCCAGGGAAG 0: 1
1: 0
2: 1
3: 41
4: 352
Right 1121109502 14:91303149-91303171 GACTCCCCAGGCCTGGCCTCAGG 0: 1
1: 0
2: 4
3: 58
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121109493 Original CRISPR CTTCCCTGGACCTCCCCTGC AGG (reversed) Intronic
900371725 1:2335256-2335278 CTTCCCTGGAGCTCCACCGGTGG + Intronic
900481312 1:2900750-2900772 CTTCTCTGGCCTTCCCCTACTGG - Intergenic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
900772808 1:4559261-4559283 CTCCCCTGGACCTGTCCTTCAGG - Intergenic
902559895 1:17270857-17270879 CTCCCCTGGTCTGCCCCTGCAGG + Exonic
902917991 1:19650390-19650412 CATCCCTGGACCTCCCCTCAGGG + Intronic
903182018 1:21609595-21609617 CTTCTTTGGACCCCCCCTCCCGG - Exonic
903760257 1:25692781-25692803 CTTCCCTGGCCTTCCACTGGGGG - Intronic
905482100 1:38268654-38268676 CCCCCCTGCACCGCCCCTGCTGG + Intergenic
905689779 1:39934493-39934515 CTTGCCTGGACCTCCCACACTGG + Intergenic
906053210 1:42891962-42891984 CTGCACTGAAGCTCCCCTGCAGG - Intergenic
906727356 1:48053840-48053862 CTTCCCTGGAGCTCAACTCCTGG + Intergenic
912798011 1:112704662-112704684 CTTCCCTGGTCCACCCCACCCGG + Intronic
912798465 1:112706776-112706798 CTTCCCGGAACCTGCCCCGCCGG - Intronic
913958247 1:143321811-143321833 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
914052562 1:144147186-144147208 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
914126635 1:144819355-144819377 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
915635212 1:157181599-157181621 CAGCCCAGGGCCTCCCCTGCAGG - Intergenic
915650589 1:157307604-157307626 CAGCCCAGGGCCTCCCCTGCAGG + Intergenic
916022179 1:160802310-160802332 ATTTCCTGGATGTCCCCTGCAGG + Intronic
916076433 1:161202474-161202496 CTGCCCTCGATCTCACCTGCTGG - Exonic
916090779 1:161306324-161306346 CTTACCTGAGCCTCCTCTGCAGG + Exonic
916892087 1:169121917-169121939 CTTCCCCTGACCTTCCCTGAAGG + Intronic
919771035 1:201158684-201158706 CTTCCTTAGGCCTCCTCTGCTGG - Intronic
919772727 1:201173002-201173024 CTTCCCAGGCCCATCCCTGCTGG - Intergenic
919934650 1:202243573-202243595 CTGCTCTACACCTCCCCTGCAGG - Intronic
920684041 1:208095579-208095601 CTTCCCTGCTCCTCCTCTGTGGG + Intronic
920948352 1:210550563-210550585 CATCCCTAGTCTTCCCCTGCAGG - Intronic
922986639 1:229871231-229871253 CAGCCCTGGGCCTCCCCTCCTGG + Intergenic
1062952944 10:1518468-1518490 CGTCCCTGGACCTCCCCAAGGGG + Intronic
1063070748 10:2660637-2660659 CTTCCCTTCACCTCCCCAGATGG + Intergenic
1065633113 10:27702355-27702377 CCACCCTGCACCTCCCATGCAGG - Intronic
1066759416 10:38738750-38738772 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
1067131576 10:43570136-43570158 CTTCCTTGGGCCTGCCCTGCAGG + Intronic
1069779894 10:70948628-70948650 CTTCCCTGGACTTCACCAACTGG - Intergenic
1069902876 10:71715989-71716011 CGTCCCTCGACAGCCCCTGCCGG - Exonic
1069953469 10:72035543-72035565 CTTCCGTGGATGTCCCCAGCAGG + Intergenic
1070681394 10:78451732-78451754 CTTCCCAGGACCACCCCTTTGGG + Intergenic
1072412140 10:95212764-95212786 CTTCCCTGGACTTTCCCGCCTGG + Intronic
1072693487 10:97586708-97586730 CTTCTCTGGACCCTCCCTTCTGG + Intronic
1073124393 10:101140577-101140599 TCTCCCTCTACCTCCCCTGCCGG + Intergenic
1073398250 10:103236162-103236184 CTTCCCTGCAGCTCTCCTGCCGG - Intergenic
1074188662 10:111117175-111117197 CTTCCGGGCACCTCCCCAGCAGG - Intergenic
1074575361 10:114663826-114663848 TTTCTCTGCACCTCCCCTGACGG + Intronic
1075022214 10:118960318-118960340 CTTAGCTGGACCTGCTCTGCAGG - Intergenic
1075620927 10:123927858-123927880 TTTCCCTGGATCTCCCTTTCGGG + Intronic
1076275253 10:129192985-129193007 CTGCCCTGTGCCTCCCCTGTTGG - Intergenic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1076910180 10:133383985-133384007 CTTCTTTGACCCTCCCCTGCCGG + Exonic
1077144783 11:1040027-1040049 CTTCCCTGCCCCTGCCCCGCTGG + Intergenic
1077251071 11:1560989-1561011 CTTCCCAGGACCTCCCCAGGCGG + Intronic
1077350617 11:2091504-2091526 CTTCCCTGGAGCCCACCTGCTGG - Intergenic
1077412548 11:2410432-2410454 TTTCCCTGCACCTTCTCTGCCGG + Intronic
1077666604 11:4116062-4116084 CTTCCCTGGCCCTCCCCCTGCGG - Intronic
1077785806 11:5382360-5382382 CTTCCCTGGCCCTCACCTGTGGG + Intronic
1078086281 11:8234629-8234651 CTTCCCCGTGGCTCCCCTGCTGG + Intronic
1079125785 11:17718043-17718065 CCTGCCTGGATCTCCCCTCCTGG - Intergenic
1080349535 11:31367570-31367592 ATTCTCTAGACCTGCCCTGCTGG + Intronic
1080656627 11:34263576-34263598 CTTCCCTGAGGCTCTCCTGCAGG + Intronic
1081638211 11:44734887-44734909 GTTCCCTGGGCCTGCCCTGCTGG - Intronic
1081682813 11:45020445-45020467 TTTCCCTTGACCTGCCCTGATGG - Intergenic
1082827495 11:57591120-57591142 CTTCCATGCACCTCTCCTGAGGG - Intergenic
1084155258 11:67309691-67309713 CTTCACCTGCCCTCCCCTGCAGG + Intronic
1085342872 11:75744857-75744879 ATCCCCTGGAGCTCCCCTGAGGG + Intergenic
1085342933 11:75745186-75745208 CTTACCACCACCTCCCCTGCAGG + Intergenic
1085474418 11:76780986-76781008 TTTCCCTTGACCTCCCCTTAGGG - Intergenic
1086870756 11:92033842-92033864 CTTCCCTCTCCCTGCCCTGCAGG + Intergenic
1088906110 11:114156560-114156582 GTTCCCTGGACCCTCCCTCCAGG + Intronic
1089153936 11:116386138-116386160 CTTCCCAGGATCTCACCTGTGGG + Intergenic
1089745486 11:120614081-120614103 CTTCTGTGAACCTTCCCTGCAGG + Intronic
1090819811 11:130331426-130331448 CTTCCCTGGCCCTCCCCCTGCGG - Intergenic
1091168415 11:133500563-133500585 CTTCCCACCACCTCCCCTGCAGG + Intronic
1091320080 11:134643237-134643259 CTGCCATGGGCCTCCCCAGCTGG + Intergenic
1091415191 12:276713-276735 TTTCCCTGGAACTCCCTTGGAGG - Intergenic
1091445667 12:543108-543130 TCTCCCTGGACCTCCCATGCAGG - Intronic
1091664536 12:2409836-2409858 GTTGCCTCCACCTCCCCTGCTGG - Intronic
1092776690 12:11949947-11949969 CCTCCCTGCCCTTCCCCTGCAGG - Intergenic
1096260110 12:50085245-50085267 CTGCCCTGAGCCTCCCGTGCCGG + Exonic
1096411161 12:51378055-51378077 CTTTCCTTGACCTCCTCTGCTGG + Intronic
1096648318 12:53049926-53049948 ATTCCCAGGATCTACCCTGCTGG - Intronic
1096669298 12:53188979-53189001 CTTCTCTGGCCCTCACCTTCAGG + Exonic
1096816892 12:54207465-54207487 CTTCCCCCCACCTCCACTGCTGG - Intergenic
1099252079 12:80268790-80268812 CTTCCCTGGACCTTCCTCTCTGG + Intronic
1101041424 12:100759787-100759809 GTTCTCTGGGCCTCCCCTGCTGG + Intronic
1101806668 12:108069979-108070001 CCTCCCATGCCCTCCCCTGCTGG - Intergenic
1102423862 12:112825094-112825116 CTTCCCTGGAGCCCCCCACCTGG - Intronic
1103340969 12:120221008-120221030 CTGCCCTTCCCCTCCCCTGCTGG - Intronic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1104304249 12:127594864-127594886 CTGCTCTGGCCCTCCCCTCCTGG + Intergenic
1104753686 12:131255725-131255747 CACCCCTGGACCTCCACAGCAGG + Intergenic
1104793686 12:131500696-131500718 CTTCAGGCGACCTCCCCTGCTGG - Intergenic
1104848712 12:131860774-131860796 CATCCCAGGTCCTCCCCAGCCGG - Intergenic
1105464922 13:20630913-20630935 CTTCCCTGGTCTTACCCTTCAGG + Intronic
1106316198 13:28596267-28596289 CTCCCCTGGACCTACCCTCCTGG + Intergenic
1108528315 13:51304501-51304523 CTTCCCTGGGCCTGCTCTTCTGG + Intergenic
1112319531 13:98394451-98394473 CTTCCCTGGAGACCCCCTGTGGG + Intronic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1112388683 13:98963160-98963182 CTTCCCTACACCTCCCATGGGGG + Intronic
1112407811 13:99136580-99136602 CTGCCCTGAAGGTCCCCTGCAGG + Intergenic
1113385835 13:109846957-109846979 CCTCCCTGGAACAGCCCTGCTGG - Intergenic
1113443962 13:110351409-110351431 CTACCCTGCTCCTCCCTTGCCGG + Intronic
1113542255 13:111118030-111118052 CTTCGCTTGACCTCTGCTGCAGG + Intronic
1114526009 14:23367061-23367083 CTTCCCTGGACCTTCCCTCTGGG + Intergenic
1115113061 14:29847445-29847467 CTTCCCTGGACATCACAAGCAGG + Intronic
1117954359 14:61111271-61111293 ATGCCCTGGACCTCCCGTGGTGG + Intergenic
1118166537 14:63341692-63341714 CTTCCCCCAAACTCCCCTGCTGG - Intergenic
1119748945 14:77064207-77064229 CCTCCCTGACCCTCCTCTGCGGG - Intergenic
1119854121 14:77886577-77886599 CTTGCCTGGTCCTCCACTGCTGG - Intronic
1119891111 14:78182989-78183011 CCTGCCTGGACATCACCTGCTGG + Intergenic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1121358193 14:93232302-93232324 CTGCCCTGGCCCTGCCCTGCAGG + Intergenic
1121485219 14:94309622-94309644 CTTCCCTGGACTCACCCTCCAGG - Intronic
1122441629 14:101736172-101736194 CTTCCCTGGGTCTCCCCTGTGGG - Intergenic
1122484029 14:102066152-102066174 CCGCCCAGGACCTCCCCCGCAGG + Intergenic
1122834534 14:104424339-104424361 CTTCCTTGAACCTCTCCTTCGGG - Intergenic
1123033330 14:105461418-105461440 CTTCCCTGTACCTCCACCTCAGG + Intronic
1123034484 14:105466365-105466387 CCTGCCTGCCCCTCCCCTGCTGG + Intronic
1123105207 14:105838060-105838082 CTTGCCTGGATATCCCCTCCTGG - Intergenic
1123422227 15:20143163-20143185 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
1123531455 15:21149703-21149725 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
1123781651 15:23634319-23634341 CCTTCCTGCACCTTCCCTGCTGG + Intergenic
1124414908 15:29466670-29466692 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124415034 15:29466975-29466997 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124431993 15:29615860-29615882 CTTCCCTGTATCATCCCTGCCGG - Intergenic
1125510592 15:40290548-40290570 CAGCCCTGGGCCTCCCCTCCAGG + Intronic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1129238895 15:74240233-74240255 CTCCCCTGCACCTCCCCTCGGGG - Intronic
1129333555 15:74839702-74839724 CTTCCCTGCAGCTCCCCTTGCGG - Exonic
1129383809 15:75184606-75184628 CTGCCCGGGACCTCACCTGCAGG - Intergenic
1130238155 15:82158522-82158544 CTTCCTTGGACCTGCCTTGAGGG - Intronic
1130718627 15:86363525-86363547 CTTCCCTTGACCTCCATGGCAGG + Intronic
1131787769 15:95931593-95931615 CTCCCCTGGACCCCCACGGCCGG - Intergenic
1132294874 15:100727526-100727548 CTTCTGTGGACCTGCCCTGACGG + Intergenic
1132339294 15:101067940-101067962 CTTGCCAGGACCTCCCCTTAGGG - Intronic
1133326791 16:4946873-4946895 CTTTCCTGGTCCTCCCCTAAGGG - Intronic
1133649432 16:7797344-7797366 ATGCCTTGGACCTCCTCTGCAGG + Intergenic
1133937091 16:10278019-10278041 CTTCCCTGGCCCTCCCCCTGCGG + Intergenic
1136687292 16:32002926-32002948 CTTCCCTGTGCCACCCCAGCGGG + Intergenic
1136773563 16:32859918-32859940 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
1136787904 16:32946477-32946499 CTTCCCTGTGCCACCCCAGCGGG + Intergenic
1136881877 16:33907312-33907334 CTTCCCTGTGCCACCCCAGCGGG - Intergenic
1136897049 16:34001601-34001623 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
1137502218 16:49020130-49020152 TTTCCCTGCACGTTCCCTGCTGG - Intergenic
1138351141 16:56346874-56346896 CATCCCTTGGCCTTCCCTGCTGG - Exonic
1139443301 16:66979791-66979813 CTCCTCTGGGCCTCCCTTGCTGG - Intergenic
1139955112 16:70689485-70689507 CTGCCCTGGTCCTGCCCAGCAGG - Intronic
1139968056 16:70756506-70756528 CTTCCCAGCGCCTACCCTGCTGG + Intronic
1141423232 16:83930644-83930666 TCTCCGTGGAACTCCCCTGCTGG - Intronic
1141692225 16:85602848-85602870 CTGCCCTTGCCCTCCCCCGCAGG + Intergenic
1141908416 16:87042478-87042500 CTTCTCTGGACGCCCCCTCCTGG - Intergenic
1142106073 16:88303499-88303521 CTCCCATGGAACTCCACTGCCGG + Intergenic
1142260916 16:89042080-89042102 CCTCCCCGGACCTCCCGTCCTGG + Intergenic
1142444771 16:90129566-90129588 AGTCCCTGGACCACCCTTGCAGG - Intergenic
1203075979 16_KI270728v1_random:1122029-1122051 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
1203090134 16_KI270728v1_random:1208134-1208156 CTTCCCTGTGCCACCCCAGCGGG + Intergenic
1143031945 17:3972875-3972897 CTCCCCTGCCCCTCCCCTGAGGG - Intergenic
1143379668 17:6488151-6488173 CTTCCCTGTACCTTCCCCACAGG + Intronic
1143410198 17:6704056-6704078 CCTCCCTGCCCCTCCTCTGCAGG - Exonic
1144481032 17:15629077-15629099 CCTACCCGGACCTCCCCAGCAGG - Exonic
1144659373 17:17058380-17058402 CGGCCCTGGAGCTCCCCTCCCGG - Intronic
1144917333 17:18734976-18734998 CCTACCCGGACCTCCCCAGCAGG + Exonic
1146183693 17:30711877-30711899 CTGCCCTGGGACACCCCTGCAGG + Intergenic
1147148271 17:38498595-38498617 CTTCCCTGTGCCACCCCAGCGGG + Intronic
1147249426 17:39144147-39144169 CTTCCCTGGCCACCCCCAGCTGG - Intronic
1147563770 17:41524364-41524386 CTTCCCTCTACCTACCCGGCTGG + Exonic
1148543795 17:48501579-48501601 CATCCCTGGGCCTCCCCTTCTGG - Intergenic
1148741683 17:49896913-49896935 ATGCCCTGGACTTCCCCCGCAGG + Intergenic
1149455105 17:56781448-56781470 CTTCCTTGGACCTTCCCTCAAGG - Intergenic
1151333284 17:73423871-73423893 ATTGCCTGGACCGCCTCTGCCGG + Intronic
1151560930 17:74869131-74869153 CCTGCCTGGACCTACGCTGCAGG + Intronic
1151570069 17:74921608-74921630 CCTTCCTGGGCCTCCCCTCCTGG + Intronic
1152158355 17:78650075-78650097 CCTCACTGGAGCTCCCCTCCTGG - Intergenic
1152183999 17:78842706-78842728 CTTACCTTGACCTCCCAGGCAGG + Intergenic
1152276875 17:79363128-79363150 CTCCCCTCCATCTCCCCTGCAGG - Intronic
1152716811 17:81904194-81904216 GTTCCCTGGTCCTTCCCAGCAGG + Intronic
1152928262 17:83097746-83097768 CCACCCTGCACCTCCCCCGCTGG - Intergenic
1153930192 18:9871478-9871500 CTTTCCTGGATCTCCCCAGGAGG + Intergenic
1153987886 18:10369060-10369082 ATTGCCTGGACCGCCACTGCTGG + Intergenic
1154069174 18:11137650-11137672 TTTCCCTGGACTGTCCCTGCCGG - Intronic
1154214791 18:12408067-12408089 CTTTCCTGGACCGCTCCAGCCGG - Intronic
1156029902 18:32700664-32700686 CTTACCACGACCTCCCCAGCAGG - Intronic
1156857525 18:41799501-41799523 CTTCCCTCCACATGCCCTGCAGG - Intergenic
1157575498 18:48740462-48740484 CATGCCTGGGCCTTCCCTGCTGG + Intronic
1159002818 18:62988438-62988460 CTTCCCTGCACCAACCTTGCTGG - Intergenic
1159082604 18:63752625-63752647 CTTCCCTGGTTCTAACCTGCTGG + Intergenic
1160725956 19:617933-617955 CTTCCCTGGACCTCAAGTGGAGG - Intronic
1161288452 19:3480382-3480404 CCCCCCTGCACCTACCCTGCTGG + Exonic
1161543563 19:4866893-4866915 CTGGCCTGGAGCTCCCCTTCTGG - Intronic
1161717026 19:5882075-5882097 CCTCCCTGGCCCTCACCCGCTGG + Intronic
1161800981 19:6416678-6416700 CTTCCCTGGGCCATCACTGCAGG - Intronic
1162034747 19:7932807-7932829 CATCCCTGGACCTCGCAGGCTGG - Intronic
1164108820 19:22135586-22135608 CTTCCTGGGACCTCCCCTCAAGG + Intergenic
1164616031 19:29667227-29667249 CCTCCCAGGCCCTGCCCTGCTGG + Intronic
1164669262 19:30063501-30063523 CTTTCCTGGCCCTGCCCTGAAGG - Intergenic
1164971291 19:32534921-32534943 CCTGCCTTGACCTCCCCTGTAGG - Intergenic
1165367821 19:35380150-35380172 CTTCCCTGGCCCACACTTGCTGG + Intergenic
1166126709 19:40719000-40719022 CCTCCCTGAACCTGCCCGGCCGG - Intronic
1166340110 19:42132379-42132401 CTTACCTGGAGCCCCCATGCTGG + Exonic
1166652689 19:44586377-44586399 CCTCCCTGGACCCTCCCTGTGGG + Intergenic
1167095537 19:47373288-47373310 CTACCCTGGCCCTGCCCTCCCGG + Intronic
1202691960 1_KI270712v1_random:99610-99632 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic
926516305 2:13850960-13850982 ATTCCCTGGACCTTCCCAGTTGG - Intergenic
927475938 2:23414270-23414292 TCTCCCTGAACCTTCCCTGCAGG - Intronic
928303763 2:30148070-30148092 CTTTCCTGTACCTTCTCTGCAGG + Intronic
933559545 2:83874033-83874055 CTTCCCTGGCCCTCCCCCTGCGG - Intergenic
933899045 2:86836141-86836163 CCTCCCAGCACCTCCCCTGCTGG - Intronic
933937032 2:87214751-87214773 CTTCAGTGACCCTCCCCTGCTGG + Intergenic
933954432 2:87354346-87354368 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
934322737 2:91983101-91983123 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
934461045 2:94213897-94213919 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
935781504 2:106513085-106513107 CCTCCCAGCACCTCCTCTGCTGG + Intergenic
936356110 2:111751073-111751095 CTTCAGTGACCCTCCCCTGCTGG - Intergenic
937336552 2:121065851-121065873 CTCCCGCGGACGTCCCCTGCTGG + Intergenic
937470554 2:122170619-122170641 AGTCCCTGTACCTCCCTTGCTGG + Intergenic
938068443 2:128294066-128294088 CCTCTCTGCACCTGCCCTGCTGG + Intronic
941350636 2:164429794-164429816 CTTTCTTAGACCTTCCCTGCAGG - Intergenic
942406550 2:175662153-175662175 CATCCCAGGAACTCCCCTACTGG - Intergenic
942458788 2:176155596-176155618 CTTCCCTGGCCCACTCCTGTGGG - Intronic
944101957 2:196036675-196036697 CTACCCTGGACCTTTCCAGCTGG + Intronic
947577854 2:231291147-231291169 CTGCCTTGGCCCTGCCCTGCTGG + Intronic
948606737 2:239140736-239140758 CATCCCTTAACCTCCCCTCCAGG - Intronic
948752949 2:240143071-240143093 CTTCCCTGGCCCTACCCAGAGGG + Intronic
948840351 2:240645610-240645632 CTTGCCTGGACCCTCCCTTCAGG + Intergenic
948844707 2:240677498-240677520 CCTCCCTGGGCCTGCCCTCCTGG - Intronic
948846482 2:240685179-240685201 CCTCCCTGAACTTCCCCAGCAGG + Intergenic
948847380 2:240689554-240689576 CCTCCCTGAACTTCCCCAGCAGG - Intergenic
948849153 2:240697381-240697403 CCTCCCTGGGCCTGCCCTCCTGG + Intronic
949063840 2:241977171-241977193 CTTCCCCAGCCCTCCCCTGAAGG - Intergenic
1172624064 20:36337373-36337395 CTTCCCTGCACCTACCCAGCGGG - Intronic
1173208717 20:41015227-41015249 CCTCCCTTGACCTCATCTGCTGG - Intergenic
1173227146 20:41168578-41168600 CTGTCCTGGAGCTTCCCTGCAGG + Intronic
1175072719 20:56347801-56347823 CTCCCCTGGACCCTCCCTCCAGG + Intergenic
1175162677 20:57020736-57020758 CCTCCCAGCTCCTCCCCTGCAGG + Intergenic
1175368214 20:58469837-58469859 CTTCCCCCGACATCCCCTCCAGG - Intronic
1176220637 20:63967885-63967907 CTTCCCGGGACCACTCTTGCTGG + Exonic
1179362760 21:40727908-40727930 CGTCTCTAGACCACCCCTGCAGG + Intronic
1179505567 21:41837827-41837849 CTTCCCTGGGGCTTTCCTGCTGG + Intronic
1179790934 21:43755611-43755633 GTTCCCTGGAAATCCCCTCCTGG + Intronic
1179887134 21:44318995-44319017 CTTCCCCGTACCTCCTCTCCTGG - Intronic
1180549498 22:16529005-16529027 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
1180950062 22:19716926-19716948 CTTCCATGGCCCTGACCTGCAGG - Intronic
1180953568 22:19731436-19731458 CTTCCCAGGACCTCCTCCACGGG - Intergenic
1181031056 22:20149082-20149104 CTGCCCTGGACCTGCCCTCCTGG + Intronic
1181512270 22:23394320-23394342 CCACCCTGGACCTGCTCTGCTGG - Intergenic
1181583633 22:23841472-23841494 CCTCCCTTGGCCTCCCCAGCTGG - Intergenic
1182519563 22:30877740-30877762 CTTGCCTGGGCCCCGCCTGCAGG - Intronic
1183357105 22:37365441-37365463 CTTCCCTGGAGCCCTGCTGCGGG + Intergenic
1183706008 22:39475309-39475331 GGTCCCTGGAACTCCCCTCCAGG - Intronic
1183738822 22:39658901-39658923 GTACCCTGGGCCTGCCCTGCGGG + Intronic
1183978465 22:41526502-41526524 CCTCCCTGCACCTGCCTTGCAGG - Exonic
1184509642 22:44926055-44926077 CTTCCCCGGAAATCCACTGCAGG - Intronic
1184872179 22:47247790-47247812 CTCACCTGGACCTGCCCTGGTGG - Intergenic
1185323025 22:50210542-50210564 TTCCCCTGGGCCTCCCCTCCAGG + Intronic
950574863 3:13826126-13826148 CTTCCTGGGAACTCCCCAGCAGG - Intronic
950841670 3:15974001-15974023 CTTCCCTGGATTTCTCCTGAGGG + Intergenic
950964679 3:17138046-17138068 TTTGCCTGGAGCTCCTCTGCAGG - Intergenic
952041658 3:29268501-29268523 CTTCTCTGTACCATCCCTGCAGG + Intergenic
954747222 3:52794112-52794134 CTTCCCTGGCCATCCCCTAGAGG - Intergenic
960598238 3:119427768-119427790 CATCACTGGACCTGCCTTGCAGG - Intergenic
961977357 3:131040964-131040986 CTTCCTTGAATCTCCCCTGAAGG - Intronic
963106708 3:141653713-141653735 CTTCCCTGGAACTCTGCTGGGGG + Intergenic
963167184 3:142216622-142216644 ATTCCCTGAACCTCCCCTGGTGG - Intronic
963466100 3:145684979-145685001 CTTACCTGGAGCTGCCCAGCTGG + Intergenic
966677145 3:182601837-182601859 ATTGCCCTGACCTCCCCTGCTGG - Intergenic
967309081 3:188089188-188089210 CTTTACTGGACCAGCCCTGCTGG + Intergenic
968313124 3:197700608-197700630 ATTACCTGGAGCTCCCCTGGAGG + Exonic
968521600 4:1036902-1036924 GGTCCCTGCACCCCCCCTGCTGG + Intergenic
968573648 4:1355063-1355085 CTTCCCAGGTCCTGCCCGGCCGG + Intronic
968968067 4:3779396-3779418 CAGCCCTGCCCCTCCCCTGCTGG - Intergenic
969344922 4:6564293-6564315 CTTCCCCAGACCCGCCCTGCTGG + Intergenic
969618005 4:8264987-8265009 GTTCCCAGGACCCCCACTGCAGG - Intergenic
971593180 4:28495178-28495200 CTTCCCTTGACCCCCACTTCCGG - Intergenic
974868192 4:67605350-67605372 CTTCCCTGGCCCTGCCCTGAGGG - Intronic
976349871 4:84049137-84049159 CTTCCCTGGAAGTTGCCTGCTGG - Intergenic
978427129 4:108594342-108594364 CTTCCCTGGCCCTCCCCCTGCGG - Intergenic
979159493 4:117441425-117441447 CTTCCTTTGAACTCCCATGCTGG + Intergenic
982333745 4:154210938-154210960 CTTCCGGGGACCTCCCTGGCTGG + Intergenic
983040007 4:162914336-162914358 CTTCCCTGTACCACAGCTGCAGG - Intergenic
983490985 4:168388800-168388822 TTGCCCTGCCCCTCCCCTGCTGG - Intronic
985710423 5:1424649-1424671 TTTCCCTGGGCCTCCCCCTCTGG - Intronic
985755070 5:1708929-1708951 CTTCCCTCCTCCTCCCCTGCGGG - Intergenic
988976835 5:36524311-36524333 CTCCCCAGGACCTCCCTGGCTGG + Intergenic
989362826 5:40623151-40623173 CTTTTCTGGACCTCCTCTTCAGG - Intergenic
990992757 5:61701470-61701492 CTTCTCTTGACCGCACCTGCCGG + Intronic
992994899 5:82323183-82323205 GTTCCCTGGAGCTTCCCAGCAGG + Intronic
996403487 5:123086657-123086679 CTCCCCTGCACCTCCCCAGCAGG - Intergenic
997244328 5:132333621-132333643 CTTCACTGGACACTCCCTGCAGG - Intronic
998157230 5:139793978-139794000 CTTCCCTCCACAGCCCCTGCTGG + Intergenic
999089182 5:148920618-148920640 CCTCCCTGGACCTCCCTTCAAGG - Intergenic
1000771813 5:165364238-165364260 ATTCCCAGGACCTCCTCTTCAGG + Intergenic
1001219092 5:169883775-169883797 CTTCCTTGAATCTCACCTGCTGG + Exonic
1001972344 5:175966957-175966979 GCTCCAAGGACCTCCCCTGCGGG - Intronic
1002095845 5:176830244-176830266 CTTCCCAGGAGCTCCCAAGCAGG + Intronic
1002101986 5:176862278-176862300 TTGCCCTGGACCTCCCGGGCAGG + Intronic
1002245094 5:177876820-177876842 GCTCCAAGGACCTCCCCTGCGGG + Intergenic
1003057881 6:2839841-2839863 CTCCCCCTCACCTCCCCTGCAGG + Intronic
1006152677 6:31997758-31997780 CTTCCCTGGCCCTCACCTTCAGG - Exonic
1006158985 6:32030495-32030517 CTTCCCTGGCCCTCACCTTCAGG - Exonic
1006594907 6:35185789-35185811 CTACCCCAGACCTACCCTGCTGG - Intergenic
1007600314 6:43076969-43076991 CTTACCTGGGCCGACCCTGCCGG - Exonic
1007917207 6:45572784-45572806 CTTCCCTGGGCCTCTCCTAAAGG - Intronic
1009684966 6:66945178-66945200 CTGACCTGGACCTCCCTTTCTGG + Intergenic
1009930964 6:70177253-70177275 TTATCCTGGACCTGCCCTGCAGG - Intronic
1010635719 6:78256925-78256947 CTTCCCTGCCCCTCCCCTAGTGG - Intergenic
1011094421 6:83643774-83643796 TTTACATGGACCTCCCCTGTAGG + Intronic
1013168606 6:107616280-107616302 CTTTCCTGGACCAGCCCTGATGG + Intronic
1015803435 6:137084261-137084283 CTGCCCTGGAACTCCCAGGCTGG + Intergenic
1016427392 6:143949170-143949192 ATTCCCTGGCCCTACCCTGGAGG + Intronic
1017962535 6:159233964-159233986 CTTCCCCGGCGCTGCCCTGCTGG - Exonic
1018631713 6:165827282-165827304 CACCCCTGCACCTCCCCAGCGGG - Intronic
1019051512 6:169187055-169187077 CTTCCCCGGACCTGCTCTCCAGG - Intergenic
1019135794 6:169906883-169906905 CTTCCCTGCACATCCTCTGCGGG - Intergenic
1019288481 7:235588-235610 CTACCCAGGACCTCCTCGGCAGG - Intronic
1019407059 7:889387-889409 CTTCCCTGGTGCTTCCCTCCTGG + Intronic
1019522222 7:1466174-1466196 CTTCCCTCCGCCTGCCCTGCTGG + Intergenic
1019622146 7:1997807-1997829 CTCCCCAGGACCTCCTCTGAAGG + Intronic
1019910358 7:4096766-4096788 CTTGCCTGAACCTGCCCTGCTGG - Intronic
1020005850 7:4783500-4783522 CTTCCCAGGTCCTTCCCTGAGGG + Intronic
1020014959 7:4825423-4825445 ATTCCCTGGTCCTCTCCTGATGG - Intronic
1020021762 7:4873553-4873575 CCTCACTGGGCCTGCCCTGCAGG + Intronic
1021025198 7:15658240-15658262 CTTCCTCCCACCTCCCCTGCAGG - Intronic
1021167879 7:17362480-17362502 CTTCCCTGGCCCTCCCCCTGCGG - Intergenic
1022474330 7:30700116-30700138 CTTACCTTGGCCTCCCCTCCAGG - Intronic
1022531927 7:31072293-31072315 CTTCTCTGGACCACCCTTGAAGG - Intronic
1022537700 7:31108003-31108025 CTTTCCTCTACCTCCCCAGCTGG - Exonic
1022811197 7:33870500-33870522 CATCCCTGGCCCTCCCAGGCTGG - Intergenic
1023577918 7:41649285-41649307 TTTCCCAGGATCTCCCCTCCTGG + Intergenic
1024039314 7:45538139-45538161 CTTCCCTGGGTCCACCCTGCTGG - Intergenic
1025805928 7:64834992-64835014 CTTCCCTGGCCCTCCCCCTGTGG - Intergenic
1026979493 7:74518132-74518154 CTTCCCAGGGCCTCGCCTGTAGG - Exonic
1029257310 7:99278302-99278324 CATCCCTGGACTTTCCCTGCAGG - Intergenic
1029791315 7:102845835-102845857 CTTCCCTGGCATTCCCATGCTGG + Intronic
1031078016 7:117231415-117231437 CTTCCCTGGTCCTTCTCAGCTGG - Intergenic
1032200788 7:129821404-129821426 CCTCCCTGGACTTCTCCTTCAGG - Intergenic
1032576474 7:133060296-133060318 CCTCCCAGGACCTCCTCTTCTGG - Intronic
1032709610 7:134450427-134450449 CAGCCCTGGCCCTCCCCTCCAGG - Intronic
1034459046 7:151187814-151187836 CTCCCCTGCGCCTCCCATGCTGG - Intronic
1034563860 7:151898395-151898417 CTCCCCTGCGGCTCCCCTGCCGG - Intergenic
1034734303 7:153413908-153413930 CTTCCCTGGCCCTCCCCCTGCGG - Intergenic
1035168887 7:157006998-157007020 CTTCCCGGAACCTCCCTTCCTGG - Intronic
1035636699 8:1152602-1152624 CCTCCCCAAACCTCCCCTGCTGG - Intergenic
1035999940 8:4591485-4591507 CTTCCCTGGACCTACCATGCAGG - Intronic
1037543006 8:19889993-19890015 TTTCCCTGGGGCTCCCCTGTGGG - Intergenic
1037905113 8:22711627-22711649 CTTCCCTGGGCTTTCTCTGCAGG - Intergenic
1038665356 8:29532632-29532654 CTGCCCTGGAGCTCACCTCCTGG + Intergenic
1040455497 8:47593813-47593835 CTTCCCTGGCCCTCCCAGCCAGG - Intronic
1044849865 8:96417735-96417757 CTTCTCTTGCCCTCCCCTCCTGG + Intergenic
1047020224 8:120767956-120767978 CTTCCCTGGATAATCCCTGCAGG - Intronic
1049411227 8:142474846-142474868 CTGCCCTGGACCTGGCCAGCTGG - Intronic
1049424623 8:142532606-142532628 CTCCTCTGCTCCTCCCCTGCTGG + Intronic
1049614722 8:143571092-143571114 GTTTCCTGCCCCTCCCCTGCTGG - Intronic
1049740444 8:144238460-144238482 CTATCCTGTTCCTCCCCTGCAGG + Intronic
1049760849 8:144331485-144331507 CTTCCCTGGCCCACCCAAGCCGG + Exonic
1049928555 9:433388-433410 CTCCCCTGGACCTCCACTGTTGG + Intronic
1050589983 9:7150668-7150690 CTTCCTGGTCCCTCCCCTGCAGG + Intergenic
1053135507 9:35648049-35648071 CTCCCTTTCACCTCCCCTGCAGG + Intergenic
1053298997 9:36935543-36935565 CCTCCCTGGGCTTCCCCTGCTGG - Intronic
1053576153 9:39358434-39358456 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1053840670 9:42186371-42186393 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG + Intergenic
1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054588626 9:66989807-66989829 CTTCACTGCTCCTCCCCTGCGGG - Intergenic
1055029782 9:71762098-71762120 CTGGCCTGGAACTCACCTGCAGG - Intronic
1055986651 9:82060973-82060995 CTTCACTGCTCCTCCCCTGTGGG - Intergenic
1056584752 9:87920612-87920634 CTTCACTCCTCCTCCCCTGCGGG + Intergenic
1056612125 9:88132328-88132350 CTTCACTCCTCCTCCCCTGCGGG - Intergenic
1057070821 9:92098366-92098388 CTTCCCTGGCCCTCCCCCTGCGG + Intronic
1057160524 9:92885242-92885264 CTTCACTGCTCCTCCCCTGTGGG + Intergenic
1057171704 9:92966757-92966779 CTCCCCTGGACACCCCCAGCTGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059424261 9:114210960-114210982 CTCCCCTGTCTCTCCCCTGCAGG + Exonic
1060736343 9:126068822-126068844 CTGCCCTGATCCTGCCCTGCTGG - Intergenic
1060884837 9:127143916-127143938 CTGCCCTTGCCCTCCCCTTCCGG + Intronic
1061009427 9:127946348-127946370 CTTTCCTGGCACTCCCCAGCAGG + Intronic
1061738400 9:132679524-132679546 CTTCCTTGCTCCTCTCCTGCAGG - Exonic
1062001882 9:134220223-134220245 CATCCCTGGGCCTCTCCTGAGGG + Intergenic
1062233962 9:135499402-135499424 CTACCCTGAAACTCCGCTGCGGG - Intronic
1062282194 9:135757081-135757103 CCACCCTGCCCCTCCCCTGCTGG + Intronic
1062345483 9:136112580-136112602 CTTCCCTGGCCTTCCCCGCCTGG - Intergenic
1062386691 9:136314924-136314946 CATCCCAGGATCTCCCCAGCAGG + Intergenic
1062447018 9:136599374-136599396 CCTCCTGGGACCTCCCCTGTGGG - Intergenic
1062478489 9:136741074-136741096 CCTCCCGGGGCCTCCCCTCCCGG + Intronic
1062493856 9:136822345-136822367 CTTCCCTGGCTCTCCCCTCCTGG + Intronic
1062502638 9:136857953-136857975 CTGACCTGGGCCGCCCCTGCTGG + Intronic
1187135254 X:16541907-16541929 GATACCTGGACCTCCCCTGATGG - Intergenic
1187272614 X:17792677-17792699 CTAGCCTGTTCCTCCCCTGCAGG + Intergenic
1187358537 X:18602056-18602078 CTTCCCTGCTCCTTCCCTGCAGG - Intronic
1192194053 X:69016841-69016863 CTGCCCTGCACCGCCCCAGCTGG - Intergenic
1192701225 X:73476348-73476370 CTTCCCTTGACCTCACCCCCCGG + Intergenic
1195668150 X:107449126-107449148 CCTCCCTGCAGCTCCCCTCCTGG - Intergenic
1196434819 X:115665212-115665234 CTTACTTGGCCCTCTCCTGCTGG - Intergenic
1200122569 X:153798049-153798071 CTCCCTTGCACCTCCCTTGCAGG + Exonic
1201153268 Y:11107000-11107022 CTACCCTGGTCTTCCTCTGCCGG - Intergenic
1201190235 Y:11438277-11438299 CTTTCCTGGCCCTGCCTTGCCGG + Intergenic
1202583394 Y:26403638-26403660 CTTTCCTGGCCCTGCCTTGCCGG - Intergenic