ID: 1121110349

View in Genome Browser
Species Human (GRCh38)
Location 14:91308398-91308420
Sequence TGTGCTCTTAGAAGCACAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121110349_1121110350 -4 Left 1121110349 14:91308398-91308420 CCATCTGTGCTTCTAAGAGCACA 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1121110350 14:91308417-91308439 CACAATCTTTTCTTCTTTCATGG 0: 1
1: 0
2: 2
3: 52
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121110349 Original CRISPR TGTGCTCTTAGAAGCACAGA TGG (reversed) Exonic
900271114 1:1789385-1789407 TGTGCTCTGGTAAGAACAGAGGG + Intronic
901177316 1:7313916-7313938 AGAGCTCTCAGAGGCACAGAAGG + Intronic
901776293 1:11562687-11562709 AGTGTTCTTAGAAGTTCAGAAGG - Intergenic
903723982 1:25427485-25427507 TGTGCCCTTAGAATCCCAAAGGG + Intronic
905866186 1:41377994-41378016 TGGGGTCTTTGAGGCACAGAGGG - Intronic
907281715 1:53351356-53351378 TGTGCTCTTTTTAGCACAGGAGG - Intergenic
907651846 1:56302737-56302759 TCTGCTCATAGAAGCACAAGAGG - Intergenic
908072957 1:60483721-60483743 TGTGCTCTGGGAATCAGAGAAGG - Intergenic
908442067 1:64164790-64164812 TGTTCTCATAGACACACAGAGGG - Intronic
909034434 1:70581138-70581160 AGTGCTGGTAGAAGCACAGTGGG - Intergenic
909593566 1:77379289-77379311 TGTGCTCTGTGAACCACAGTAGG - Intronic
909619541 1:77652150-77652172 TGAGTTCTTGGAAGCACAAAAGG - Intronic
911325491 1:96466769-96466791 AGTGATCTGTGAAGCACAGAAGG - Intergenic
912526390 1:110286691-110286713 TCTGCTCTAAGAATCACAGCAGG + Intergenic
914813855 1:151048662-151048684 GGTGCTCTGAGAGGCACAGTTGG - Exonic
915605787 1:156949408-156949430 TGTGGTCCTAGAAGCAGAGCAGG - Intronic
920946185 1:210530734-210530756 TGCTGTCTTAGAAGCACATAGGG - Intronic
923197444 1:231682143-231682165 TGTGCTGTTAGAACAGCAGATGG + Intronic
1063090519 10:2862498-2862520 TCTACTAGTAGAAGCACAGACGG + Intergenic
1063160522 10:3415195-3415217 TGTGCTATTAGAGACACAGCCGG - Intergenic
1065849747 10:29777829-29777851 TGTGATCTTAGTAGGACATAAGG + Intergenic
1068202314 10:53797734-53797756 TGCTCTCTTCGAAGCTCAGATGG + Intergenic
1068762269 10:60725489-60725511 TGTGCTGGTGGAAGCACAGATGG - Intronic
1069611597 10:69776229-69776251 TGAGCTTTAGGAAGCACAGAAGG + Intergenic
1070666129 10:78345300-78345322 GGTGCCCTTTGAAGCACAAAAGG + Intergenic
1072860030 10:98994189-98994211 TGTGGGCTTATAACCACAGAAGG + Intronic
1074914329 10:117940889-117940911 AGTGCTCTTAGAAGAGAAGAAGG + Intergenic
1076044073 10:127276538-127276560 TGTGGTCTTAAAGGAACAGAGGG - Intronic
1079137022 11:17781172-17781194 TGTGGTGCCAGAAGCACAGAAGG + Intronic
1082105560 11:48217516-48217538 TGTGATGTGAGAAGCACAGGTGG - Exonic
1082254601 11:50019639-50019661 TATACTCTCAGAAGCACAGAGGG + Intergenic
1083004587 11:59330942-59330964 TATGTTGTTAGAAGGACAGATGG - Intergenic
1083368965 11:62163375-62163397 TGTGCTGTGAAAAGCCCAGATGG - Intergenic
1090403782 11:126465439-126465461 CGTGCTCTTGGCAGGACAGATGG + Intronic
1090813823 11:130272560-130272582 GGTGTCCTTTGAAGCACAGAAGG + Intronic
1091027108 11:132151312-132151334 TGGGTTCTTAGAAACACAGACGG - Intronic
1091549487 12:1527277-1527299 TGTTCTTTAAGATGCACAGAAGG - Intergenic
1092405233 12:8217179-8217201 TGTGACCTAAGAAGAACAGATGG + Intergenic
1093834485 12:23810614-23810636 TTTTCTCCTAGAAGGACAGAGGG + Intronic
1094133783 12:27102515-27102537 TGTGGTCCCAGAGGCACAGAAGG - Intergenic
1094183880 12:27620310-27620332 TGTGGTCCCAGAGGCACAGAAGG - Intronic
1096091480 12:48904628-48904650 TGTTCTCTGCGAAGCACGGAGGG + Intronic
1096532446 12:52250277-52250299 TGTGCTCTCGGAAGCAGTGAAGG + Intronic
1096603616 12:52748319-52748341 TATACTCCTACAAGCACAGAGGG + Intergenic
1099148788 12:79081849-79081871 TGTGCTCTTAGAAGCTCCTGGGG - Intronic
1099531216 12:83783768-83783790 TGTGCTCTTAGAAGTGTATAGGG - Intergenic
1099928118 12:89042287-89042309 TGTTCTCTTAGAAACCCAGATGG - Intergenic
1100378773 12:94042570-94042592 CGTGCTCTTAGAAGCAGGGCAGG + Intergenic
1100507090 12:95232925-95232947 TGTGCTCTTAGCAACTCAGGAGG - Intronic
1100567060 12:95806620-95806642 TGTGATTTTTGAAGCAGAGAGGG + Intronic
1101553982 12:105789594-105789616 TGTTCTCTGAGAAGCACAGAGGG + Intergenic
1103281124 12:119758830-119758852 TGTACTCTGAGGATCACAGATGG + Intronic
1103867619 12:124065178-124065200 GGTGCACTTAGAAGGACAGTGGG + Intronic
1104617339 12:130281592-130281614 GGTGCTATTCGAAACACAGATGG - Intergenic
1105245285 13:18644749-18644771 TTCTCTCTTTGAAGCACAGAAGG - Intergenic
1106815779 13:33405303-33405325 TGCACGCTTAGCAGCACAGAGGG - Intergenic
1107101057 13:36593021-36593043 TGTGATCTTGGAAGAAAAGAGGG - Intergenic
1108562183 13:51655008-51655030 TTTGTTATTAGAAACACAGATGG + Intronic
1111963843 13:94840544-94840566 TATGCCCTTTAAAGCACAGAAGG - Intergenic
1113242878 13:108359333-108359355 TGTGATTTTAGAATCACAAATGG + Intergenic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1121408948 14:93736070-93736092 TGGCCTCAAAGAAGCACAGACGG + Intronic
1121922932 14:97899908-97899930 TGTGCTTTTACAAGCTCACAAGG - Intergenic
1122449756 14:101796436-101796458 CTTGCTCTGAGAAGCACAGATGG - Intronic
1123908087 15:24940189-24940211 TGTGTCCTTTGATGCACAGAAGG + Intronic
1126646985 15:50884281-50884303 ACTGCTCTTAGCAGTACAGATGG + Intergenic
1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG + Intronic
1128505798 15:68271838-68271860 TGGGGCTTTAGAAGCACAGACGG + Intergenic
1129951906 15:79599493-79599515 ACTGCGATTAGAAGCACAGAGGG + Intergenic
1130086586 15:80782696-80782718 TCTGCTCTTAATAGCTCAGAAGG + Intronic
1131472173 15:92706945-92706967 TGTGGGCTCAGAAGCACAAAGGG + Intronic
1132646500 16:1001639-1001661 TGTCCTCATAGAAGCAGAGGAGG - Intergenic
1133022588 16:2973419-2973441 TGTGTTCTGAAAAGGACAGAGGG - Exonic
1133513140 16:6480161-6480183 TGTTCTCTTAAAAGAACAAAAGG - Intronic
1134684275 16:16147726-16147748 TGTGTTCGTGGAAGCACAGAAGG - Intergenic
1135871618 16:26156519-26156541 TCTGTTCTTAGAAGAACTGAAGG + Intergenic
1137425743 16:48379071-48379093 TGTGCTTTTAGATGCAAAGTAGG + Intronic
1139952875 16:70680475-70680497 CGTGCTCTTAGAAGGACACGAGG + Intronic
1140267405 16:73432735-73432757 GATGCTCTTAGGATCACAGACGG - Intergenic
1144508548 17:15855500-15855522 TGTGTTTTTAGAATAACAGAGGG + Intergenic
1145120180 17:20252075-20252097 TGTGTTTTTAGAAAAACAGAGGG + Intronic
1145172670 17:20673141-20673163 TGTGTTTTTAGAATAACAGAGGG + Intergenic
1145283227 17:21483683-21483705 TGTACTCACAGAAGCAGAGAGGG + Intergenic
1146558649 17:33849229-33849251 TGGGATCCTGGAAGCACAGAGGG + Intronic
1146770286 17:35562490-35562512 TGTGATCACAGAAGCAGAGATGG + Intergenic
1148367001 17:47063030-47063052 TCTGCTCTTATGAGCTCAGAGGG + Intergenic
1152904128 17:82961145-82961167 GGTGCTCGTAGAAGAACAGCAGG + Exonic
1154443663 18:14415198-14415220 TTCTCTCTTTGAAGCACAGAAGG + Intergenic
1156548302 18:37987865-37987887 TGTGCTCTTGGAAAGACAGGGGG - Intergenic
1157127772 18:44973500-44973522 GATGCTCTTAGAAACAGAGAAGG + Intronic
1158052977 18:53246020-53246042 TGTGCTCTGAGTAGCAGACATGG - Intronic
1158436459 18:57438050-57438072 TGTGCTCCTAGAACAATAGAGGG - Intronic
1158440382 18:57469937-57469959 TGTACTGTAAGAAGCTCAGATGG - Intronic
1160046453 18:75391341-75391363 TGGGGGCTTAGAAGCACACAGGG + Intergenic
1160211265 18:76882067-76882089 TTTGTGCCTAGAAGCACAGAGGG - Intronic
1165216211 19:34274677-34274699 GTTGCTCTTAGAAACAGAGAGGG + Intronic
926204448 2:10825502-10825524 GGTGCCCTTTGAAGCACAAAAGG - Intronic
928122313 2:28591990-28592012 TGTGCTCTAAGAGGCGCAGGTGG - Intronic
930062122 2:47298902-47298924 TGGGCCCTTAGGAGAACAGATGG + Intergenic
930543440 2:52736464-52736486 TGTCCTGTTAGAAGTAAAGAGGG - Intergenic
932098769 2:68877178-68877200 TGTGCTCTTAGAATCACTAGAGG + Intergenic
933238912 2:79897695-79897717 TTTGGTTTTAGAAGCACAAATGG - Intronic
933476396 2:82797417-82797439 TGTGCTCTCTGAAGAACAAAGGG + Intergenic
935548482 2:104425965-104425987 TCTGCTCTTACATGCACAGTTGG - Intergenic
938643291 2:133305058-133305080 TGTGCTGTTGGAGGAACAGAAGG + Intronic
939581411 2:143952578-143952600 TGTTATCTTAAAAGAACAGATGG + Intronic
939992012 2:148884886-148884908 TGTGGTGGTAGAAGCACACACGG + Intronic
941909004 2:170744323-170744345 TGTGTTCTTTTAAGGACAGAAGG + Intergenic
941990216 2:171548315-171548337 TGTGCTTTAACAAGCACATAAGG + Intronic
942622493 2:177861958-177861980 TCAGCTCTTAGAAGAACACATGG + Intronic
942623831 2:177877512-177877534 AGTGCCCTCAGAAGAACAGATGG + Intronic
943247242 2:185472170-185472192 TCTGCTCTTAGAAGGTCAGTAGG + Intergenic
943506538 2:188767661-188767683 TGTGCTCTGAGAATCAGAGTTGG + Intronic
943846436 2:192655238-192655260 TGTGCTCTAAGGAGCAGACAAGG + Intergenic
944537892 2:200729209-200729231 TGCCCTCTTGGAAGAACAGAGGG + Intergenic
945940594 2:215945664-215945686 TGTGTTTTTAGAATCACTGATGG + Exonic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1170996975 20:21371411-21371433 TGTGTTCAGTGAAGCACAGAAGG + Intronic
1172707036 20:36889456-36889478 TGTGCTGTTTGAAACACAGATGG + Intronic
1172912720 20:38421876-38421898 TGGGGTCTTAGAAGGACACACGG - Intergenic
1172927724 20:38554055-38554077 TTTGTCCTTAGAAGCACTGAAGG + Exonic
1173642824 20:44615643-44615665 TGTGCTGTGAGAAGCACACACGG - Intronic
1174132948 20:48358948-48358970 TCTGCCATCAGAAGCACAGAAGG - Intergenic
1176452425 21:6876040-6876062 TTCTCTCTTTGAAGCACAGAAGG - Intergenic
1176830598 21:13741089-13741111 TTCTCTCTTTGAAGCACAGAAGG - Intergenic
1178011132 21:28288730-28288752 TTTGCTCTTGGAAGCATGGAAGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1180149963 21:45942409-45942431 TGAACTCTGAGGAGCACAGAGGG - Exonic
1184320562 22:43739444-43739466 TGTGGTCAGAGAAGCAGAGAGGG - Intronic
949437761 3:4047822-4047844 TTTACTCTTATAAGCAGAGAAGG - Intronic
950054554 3:10014030-10014052 TGTACTTTCAGAAACACAGAAGG - Intergenic
950306681 3:11920391-11920413 TGTACTTTCAGAAACACAGAAGG - Intergenic
950574686 3:13825077-13825099 TGTGCTCTTACAAGCATACATGG - Intronic
953075309 3:39564592-39564614 TGTGCTCTGGGAAGCAGGGAGGG + Intergenic
955874426 3:63474997-63475019 TGTGCTAATAGAACCACACACGG - Intronic
956381916 3:68673288-68673310 TATCCTCATAGAAGCACACAAGG - Intergenic
956400455 3:68874045-68874067 TGGGATCCTAGAAGCAGAGAGGG - Intronic
956966606 3:74469095-74469117 TCTAATCTTAGAATCACAGAAGG + Intronic
959625237 3:108442314-108442336 GGGGCTCAAAGAAGCACAGATGG + Intronic
961050164 3:123738953-123738975 TGTGGTCAAAGAAGGACAGATGG - Exonic
963237885 3:142973603-142973625 AGTGCTCTTAAAAGCTCTGATGG - Intronic
963765114 3:149326760-149326782 TATTCTTTTAGATGCACAGATGG + Intronic
966938039 3:184726820-184726842 TGTGCTCTTGAAAGTTCAGATGG + Intergenic
967110006 3:186284740-186284762 TGTCCTCTAAGAAGCGCGGATGG + Intronic
968771091 4:2507695-2507717 TGTGCTTTTAGAAGCACAAAGGG + Intronic
969079368 4:4606586-4606608 TGGACACTGAGAAGCACAGAGGG - Intergenic
969760880 4:9180792-9180814 TGTGACCTAAGAAGAACAGATGG - Intergenic
972300760 4:37783774-37783796 TGAGCTCTCAGAAGCAAAGGAGG + Intergenic
972712768 4:41614390-41614412 TGTACTTTTAGAAGGAAAGATGG + Intronic
972840810 4:42928203-42928225 TCTACTCTTGGAAGCACATATGG + Intronic
973873312 4:55188351-55188373 TGCCATCTTGGAAGCACAGACGG + Intergenic
975750615 4:77519308-77519330 TGTTCTCTTCAAAGCTCAGATGG + Intronic
975964271 4:79951036-79951058 TATACTCTTAGAAGGACTGAAGG - Intronic
978568257 4:110108161-110108183 TGTTCTCAAAGAAGCAAAGAGGG - Intronic
982376548 4:154697104-154697126 TGTGGTTTTAGGAGCAAAGAAGG + Intronic
983942036 4:173544313-173544335 GGCCCTCTTAGAAGCACACATGG - Intergenic
984387774 4:179085521-179085543 GGTGTTCTTTGAAGCACAAAAGG + Intergenic
987121519 5:14772509-14772531 TGTGCTCTCAGAGGCTAAGAAGG - Intronic
991631840 5:68664437-68664459 TGAGCTCTTAAAAGCAGGGAAGG - Intergenic
992225637 5:74617624-74617646 TTTGCTCTTTGTAGCTCAGATGG - Intergenic
995865193 5:116682934-116682956 TGTGCTCTCAGCCTCACAGAAGG - Intergenic
996209602 5:120790730-120790752 TGTGCTGTTATTTGCACAGATGG + Intergenic
998621494 5:143799358-143799380 TGTTCTTTCAGAAGCAAAGATGG + Intergenic
999117330 5:149175367-149175389 TGTCCCTTTAGAAGAACAGAAGG + Intronic
999654473 5:153798782-153798804 TGTTGGCTCAGAAGCACAGAGGG + Intronic
1000009243 5:157216305-157216327 AATGCTCTTAGAGGCTCAGAGGG - Intronic
1000792710 5:165626937-165626959 GGTGCTCTTAGGAGGACAGAAGG + Intergenic
1001224101 5:169929020-169929042 TGTGCCCTGAGAAGAGCAGATGG + Intronic
1001284080 5:170409754-170409776 TCAGCTCTTAGCAGCACACAGGG - Intronic
1003154348 6:3578586-3578608 TGAGCCGTTAGAAGGACAGATGG + Intergenic
1004812927 6:19279179-19279201 AGTGCCCTTTGATGCACAGAAGG + Intergenic
1007376793 6:41462478-41462500 TGAGCTCTGGGAAGCAGAGAAGG - Intergenic
1008320547 6:50107232-50107254 TGTGCTGAAGGAAGCACAGAAGG + Intergenic
1008546334 6:52586942-52586964 TGTGATCTGAGAAGCAGAGATGG - Intergenic
1008550112 6:52620846-52620868 TGTGCTCTGAGAAACAGAGATGG - Intergenic
1008869489 6:56255747-56255769 TGAGCTTTTAGAAGCATTGAGGG - Intronic
1009972921 6:70643979-70644001 TGTGCTCTTGGATGTTCAGAAGG - Intergenic
1011724493 6:90195689-90195711 GATGCTCTTAGAAGAACAGTGGG - Intronic
1012735890 6:102942475-102942497 TGCCTTCTTAGAAGAACAGAAGG + Intergenic
1016597483 6:145817574-145817596 TGCTATCTTAGAAGCACAGATGG - Intergenic
1016961673 6:149678563-149678585 TGTGTTCACAGAAGCACAGGAGG + Intronic
1018535609 6:164815659-164815681 TGTCCTCTTTGTAGCATAGAGGG + Intergenic
1021796763 7:24263412-24263434 TGTGCTGTTGGAAGGACAGCTGG - Intergenic
1022160158 7:27702216-27702238 TGTGATGTTTGAAGCCCAGAAGG + Intergenic
1022866790 7:34429965-34429987 TTTTTTCTTAGAAGCACAAATGG + Intergenic
1023310552 7:38882153-38882175 AGTGCTCTTAGAATCACCGGTGG + Intronic
1024217041 7:47256491-47256513 CGTGATATGAGAAGCACAGAGGG + Intergenic
1024511765 7:50210064-50210086 TCTGCTTAGAGAAGCACAGAAGG - Intergenic
1024833180 7:53485513-53485535 TGTGCTGATGGAAGCAAAGATGG - Intergenic
1027569938 7:79853207-79853229 TGTGATATGAGAAGGACAGATGG + Intergenic
1028039187 7:86026359-86026381 TGTGCTCTCTGAAGAACAAAGGG - Intergenic
1029636411 7:101787403-101787425 TTTGATCATAGAATCACAGAAGG - Intergenic
1030556881 7:111036634-111036656 TTTGCTTCTAGAAGCACTGATGG - Intronic
1031278990 7:119771545-119771567 TGTGCTTTAAGAATCACAGGAGG + Intergenic
1032491740 7:132329090-132329112 AGTGCTCCTTGAAGCACAGACGG - Intronic
1034030036 7:147751222-147751244 TATGTTCTTAAAAGTACAGAAGG - Intronic
1034514834 7:151567794-151567816 TTTGCTGACAGAAGCACAGAGGG - Intronic
1034997216 7:155585301-155585323 TGTGTTATCAGAAGCACACAGGG + Intergenic
1035402006 7:158572017-158572039 TGAGCTTCTGGAAGCACAGAAGG + Intronic
1035440902 7:158898799-158898821 TGTTCTATTAAAACCACAGAAGG - Intronic
1036270989 8:7302643-7302665 TGTGACCTAAGAAGAACAGATGG - Intergenic
1036350360 8:8007701-8007723 TGTGACCTAAGAAGAACAGATGG + Intergenic
1037730703 8:21521228-21521250 TGTGCTCTGAGAGCCTCAGAGGG + Intergenic
1039323765 8:36462754-36462776 TATGCAATTAGAAGAACAGAGGG + Intergenic
1042374814 8:68038344-68038366 TGAGTTCTGGGAAGCACAGAGGG - Intronic
1043744299 8:83854501-83854523 TTTGCTCTGAGAAGTAAAGAAGG + Intergenic
1045594550 8:103636862-103636884 TGTGCTCTTTAAAGAACAAAAGG + Intronic
1047572323 8:126112681-126112703 TGCACTCTTTGATGCACAGAAGG + Intergenic
1048918071 8:139203224-139203246 GTGGCTCTTAGAAGCCCAGATGG + Intergenic
1049240036 8:141533005-141533027 TGTGCTCTTAGTTTTACAGATGG - Intergenic
1050543496 9:6689951-6689973 TGTGTTTTTAGAAGAACAAATGG + Intergenic
1050765394 9:9126915-9126937 TGTGCTCTTAGATGCTAGGATGG - Intronic
1050946255 9:11523529-11523551 TCTGCTCTTGGAGGGACAGAAGG - Intergenic
1052067471 9:24039928-24039950 TGTCCACTTACAAGCAGAGAAGG - Intergenic
1052567035 9:30168112-30168134 TGTGCTCTCAGAAGACCATAGGG + Intergenic
1055356124 9:75438761-75438783 TGTGCTCTCAGAAGGTCAGGTGG + Intergenic
1055709039 9:79038532-79038554 GGTGCTGTTGGAAGCACAGAGGG + Intergenic
1056277204 9:85004977-85004999 TGAGCTCTGAGAAACACTGAAGG + Intronic
1057559358 9:96115202-96115224 TGTCCTCGTAGGAGAACAGAAGG - Intronic
1058242870 9:102588115-102588137 TGTGAACTTGGAAGCATAGAAGG - Intergenic
1060948829 9:127587695-127587717 TGTACTCATAAAAGCAAAGAAGG - Intergenic
1061017931 9:127993424-127993446 TGAGATCTTAGGAGCACAGCTGG - Intergenic
1061674136 9:132206180-132206202 TGGGCTCTTAGGAGCGCAAAGGG + Intronic
1203516756 Un_GL000213v1:8475-8497 TTCTCTCTTTGAAGCACAGAAGG + Intergenic
1186119193 X:6340497-6340519 GGTGCTCTGAGAATCACAGCAGG - Intergenic
1186514159 X:10153855-10153877 TGAGCTCCTGGAAGGACAGAGGG - Intergenic
1186798603 X:13070369-13070391 TGTTCTCTCAGGAGCACACACGG - Intergenic
1188159605 X:26783802-26783824 TGTGATTTTAGAGGAACAGAAGG - Intergenic
1193468828 X:81875843-81875865 TGTGCTCTTGGGAGCCCAGAAGG - Intergenic
1194514456 X:94834280-94834302 TGTGGTCTATGAAGCACATATGG + Intergenic
1195505729 X:105654776-105654798 TGTGTTCTGAAAAGCAAAGAAGG - Intronic
1196658071 X:118240787-118240809 AGTTCTCTTAGAAGCGAAGAGGG - Intergenic
1198814308 X:140571269-140571291 TGAGGTCTTAAAAACACAGATGG + Intergenic
1199155958 X:144549769-144549791 TGTGTTATTAGAGGGACAGAAGG - Intergenic
1199304941 X:146256787-146256809 TGTGTCCTTTGATGCACAGAAGG - Intergenic
1199640297 X:149854049-149854071 TGGTCTCTTAGAAGAACAGATGG + Intergenic
1199938666 X:152602444-152602466 TCTGCTCTGGGACGCACAGATGG - Intergenic
1200151505 X:153953596-153953618 TGGGCTCTTACCGGCACAGAGGG + Exonic