ID: 1121110349 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:91308398-91308420 |
Sequence | TGTGCTCTTAGAAGCACAGA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 238 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 17, 4: 218} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1121110349_1121110350 | -4 | Left | 1121110349 | 14:91308398-91308420 | CCATCTGTGCTTCTAAGAGCACA | 0: 1 1: 0 2: 2 3: 17 4: 218 |
||
Right | 1121110350 | 14:91308417-91308439 | CACAATCTTTTCTTCTTTCATGG | 0: 1 1: 0 2: 2 3: 52 4: 523 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1121110349 | Original CRISPR | TGTGCTCTTAGAAGCACAGA TGG (reversed) | Exonic | ||