ID: 1121110349

View in Genome Browser
Species Human (GRCh38)
Location 14:91308398-91308420
Sequence TGTGCTCTTAGAAGCACAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121110349_1121110350 -4 Left 1121110349 14:91308398-91308420 CCATCTGTGCTTCTAAGAGCACA 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1121110350 14:91308417-91308439 CACAATCTTTTCTTCTTTCATGG 0: 1
1: 0
2: 2
3: 52
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121110349 Original CRISPR TGTGCTCTTAGAAGCACAGA TGG (reversed) Exonic