ID: 1121111692

View in Genome Browser
Species Human (GRCh38)
Location 14:91317265-91317287
Sequence CCCAGGCTGCACGCTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121111692_1121111698 6 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111698 14:91317294-91317316 TCGGGGTGAGATGAAGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 148
1121111692_1121111702 19 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111702 14:91317307-91317329 AAGAGCCAGGTTGGCACTAGGGG 0: 1
1: 0
2: 1
3: 9
4: 153
1121111692_1121111700 17 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111700 14:91317305-91317327 TGAAGAGCCAGGTTGGCACTAGG 0: 1
1: 0
2: 1
3: 13
4: 220
1121111692_1121111699 10 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111699 14:91317298-91317320 GGTGAGATGAAGAGCCAGGTTGG 0: 1
1: 0
2: 0
3: 26
4: 283
1121111692_1121111704 29 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111704 14:91317317-91317339 TTGGCACTAGGGGCCCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1121111692_1121111705 30 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111705 14:91317318-91317340 TGGCACTAGGGGCCCCCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1121111692_1121111701 18 Left 1121111692 14:91317265-91317287 CCAAAGCAAGCGTGCAGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1121111701 14:91317306-91317328 GAAGAGCCAGGTTGGCACTAGGG 0: 1
1: 0
2: 0
3: 5
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121111692 Original CRISPR CCCAGGCTGCACGCTTGCTT TGG (reversed) Intronic
901710794 1:11113469-11113491 CCCAGGCTGCAGGCTTGAAGGGG + Intronic
902330517 1:15729013-15729035 GCCAGGCTGAGCGCTTGCTGGGG - Intronic
904393971 1:30205692-30205714 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
904430928 1:30463506-30463528 TCCAGGCTCCAGGCTTGCTGTGG - Intergenic
905429303 1:37909951-37909973 CCCAGGCTGCAGGCATTCCTTGG - Intronic
909957967 1:81801884-81801906 CCCAGACCGCACGCTCCCTTAGG - Intronic
915441803 1:155950252-155950274 CCCAGGCTGCACTCTACCTCTGG + Intronic
915525585 1:156474109-156474131 CTCAGGCTGCAGGCTTTCTGAGG + Intronic
916328873 1:163593321-163593343 CCCAGGCTGCAGGCATGCCTTGG - Intergenic
917749668 1:178042277-178042299 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
919738643 1:200969563-200969585 CCCAGGCTGCAGGCTTCATTAGG - Intronic
920427328 1:205888682-205888704 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
922598988 1:226835567-226835589 CCCCGGCTGCAGGCATTCTTTGG - Intergenic
924265854 1:242281082-242281104 ACCAGGCTGCGGGCTTCCTTAGG + Intronic
924915805 1:248567325-248567347 GCCAGGCTTCAAGTTTGCTTTGG + Intergenic
1063754880 10:8996124-8996146 CCCAGACTGGAACCTTGCTTTGG + Intergenic
1064269855 10:13854858-13854880 CCAAGGCTGCAGGCATGCTCTGG + Intronic
1065720666 10:28626102-28626124 CCCAGGCTGCACTCCAGCCTGGG - Intergenic
1066209332 10:33221767-33221789 CCCAAGTTGCAGGCTTGATTCGG + Exonic
1068125755 10:52840297-52840319 TCCAGGCTGCCCACTTTCTTTGG - Intergenic
1068662112 10:59633211-59633233 CCCAGGTTGCACTTTTGCTTGGG - Intergenic
1071550776 10:86564649-86564671 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1073014033 10:100384045-100384067 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
1074162222 10:110844533-110844555 CCCATGAGGCAGGCTTGCTTGGG + Intergenic
1076059976 10:127406228-127406250 CGCAGGCTGCTCCCTTGCTCTGG - Intronic
1077434967 11:2534555-2534577 CCCGTCCTGCACACTTGCTTCGG + Intronic
1082998076 11:59268414-59268436 CCAAGGCTGCCTGCTTGCTTGGG + Intergenic
1084942294 11:72619343-72619365 GGCAGGCTGCACACATGCTTAGG - Intronic
1086279528 11:85170382-85170404 TCCAGGTTTCATGCTTGCTTTGG + Intronic
1088785575 11:113178632-113178654 CCCAGCAAGCAGGCTTGCTTTGG - Intronic
1088965502 11:114716956-114716978 CACAGGCTGCAGGCTGGATTTGG - Intergenic
1090662324 11:128891124-128891146 CCCCGGCTGCACCCCTGCTGCGG - Intergenic
1091805526 12:3353352-3353374 CCCAGGCTGCCCACCTGCTGGGG + Intergenic
1092148172 12:6229108-6229130 CCCAGGCTGCAAACTTGTTGGGG + Intronic
1092626732 12:10336341-10336363 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1094825312 12:34264840-34264862 GCCAGCCTGCCCGCTTGCCTAGG - Intergenic
1096214817 12:49793064-49793086 CCCAGGCTCCACCCTTACTCAGG + Intronic
1097592436 12:61589551-61589573 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
1098135877 12:67401346-67401368 CCCAGGCTGGAAGCTTGCTGGGG + Intergenic
1098429486 12:70403814-70403836 ACCAGGCTGCACACTTGTTAAGG + Intronic
1104013331 12:124947277-124947299 CCCAGGCTCCATGCCTTCTTGGG - Exonic
1109438609 13:62339634-62339656 CCCAGGCTGGAGGCTTCCTCAGG - Intergenic
1112561531 13:100519587-100519609 CCCTGACTGCACACCTGCTTGGG - Intronic
1113461889 13:110487965-110487987 CACAGGCTGCACCTTTGTTTAGG - Intronic
1114036810 14:18636859-18636881 CCCAGGCTGTGCCCTCGCTTTGG - Intergenic
1114121829 14:19678184-19678206 CCCAGGCTGTGCCCTCGCTTTGG + Intergenic
1114779353 14:25520785-25520807 CCCAGGATCCACTCCTGCTTGGG - Intergenic
1114947333 14:27700387-27700409 CACAAGCTGCACCCTTCCTTAGG - Intergenic
1116702391 14:48258794-48258816 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1116703275 14:48265786-48265808 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1117024693 14:51607640-51607662 TCCAGTCTGCACGCTTTGTTGGG + Intronic
1121107197 14:91288837-91288859 GCCAGGCTGCACTCTAGCCTGGG + Intronic
1121111692 14:91317265-91317287 CCCAGGCTGCACGCTTGCTTTGG - Intronic
1122037063 14:98956530-98956552 ACCAGGCTGCACTCTGACTTGGG + Intergenic
1122886338 14:104712081-104712103 CCCAGGCTGCCCTCCTGCCTGGG - Intronic
1123892474 15:24795127-24795149 CCCAAACTGAACGCTTGCTTAGG - Intergenic
1126312167 15:47329944-47329966 TCCAGGCTGCACACTTGGTAAGG + Intronic
1128591573 15:68902260-68902282 TCCAGGCTGCACTCCTGCCTGGG + Intronic
1128636882 15:69308217-69308239 TCGAGGCTGCATGCTTGGTTTGG + Intronic
1130226180 15:82059726-82059748 GCCAGGCTGCAAGTTTGTTTAGG + Intergenic
1131693658 15:94853991-94854013 CCCAGGCTGCAGGGTTCCCTAGG + Intergenic
1138526117 16:57608257-57608279 ACCAGGCTGCACGGTGGCTGTGG + Intergenic
1138594011 16:58019768-58019790 TCCAGCCTGCACGTTTGGTTTGG - Intronic
1139298738 16:65925808-65925830 CCCAGGCTGCAATCTTGGCTTGG - Intergenic
1139633017 16:68241962-68241984 CCCAGCCTGGACGCTTTTTTTGG + Intergenic
1142066467 16:88065776-88065798 ACCAGGTTGCATGCTTGCTCAGG + Intronic
1145158168 17:20556650-20556672 CCGAGGCTGGAGGATTGCTTGGG - Intergenic
1145208603 17:20997327-20997349 CCCAGGCTTCAGGCTGGCTCAGG - Intergenic
1147119375 17:38326925-38326947 CCCATGCTGCCTGCTTCCTTGGG + Exonic
1147241757 17:39095145-39095167 CCCTGGCTGCACCCATGCTTGGG - Intronic
1148045799 17:44743530-44743552 CCCAGGCTGCACTCTCCATTTGG - Intronic
1148647165 17:49225703-49225725 CTCCTGCTGCCCGCTTGCTTCGG - Intronic
1148857895 17:50588950-50588972 GCCTGGCTGCAGGCTTGGTTGGG + Intronic
1149599538 17:57884660-57884682 CCCCGGCTTCACTCTTCCTTTGG + Intronic
1150829801 17:68509397-68509419 CCCAGGCTGGAGGCTTCCTTGGG - Intergenic
1151557461 17:74853911-74853933 CCCTGTCTGCTCACTTGCTTAGG + Intronic
1151830241 17:76545075-76545097 CCCAGGGAGCAGGCTGGCTTTGG + Intronic
1151891009 17:76950186-76950208 GCCAGGCTGGACGCTTCCTGTGG + Exonic
1152016781 17:77756115-77756137 CCCAGGCTGCCTTCTTGCTTTGG - Intergenic
1154059121 18:11042341-11042363 CCCAGCCTGCAGGCCTGCGTGGG - Intronic
1157430346 18:47619545-47619567 CCCTGGTTGCACCCTTCCTTGGG + Intergenic
1160582940 18:79898050-79898072 CCTAGACTGCACGCTGGCTAAGG - Intronic
1161624141 19:5316150-5316172 CCGAGGCTGGAGGATTGCTTGGG - Intronic
1163447850 19:17357989-17358011 CCCAGGCTGCTCACTTCCCTGGG + Intronic
1165249250 19:34516295-34516317 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
929522476 2:42666476-42666498 GCCAGGCTGTACCCTTCCTTTGG + Intronic
929579155 2:43070829-43070851 CCCAGGCCCCGCGCTTTCTTGGG + Intergenic
930751471 2:54938686-54938708 CCCAGGCTTCACGCTGTCTGAGG + Intronic
932764494 2:74461371-74461393 ACCAGGCTACAGGCTTTCTTTGG - Exonic
948607769 2:239146884-239146906 CCCAGCCTGCACACCTGCCTGGG + Intronic
948692080 2:239712348-239712370 CCCAGGCTGCACCCCTGCTTTGG - Intergenic
1170325474 20:15151242-15151264 CCCAGGCTGCAGGCATTCCTTGG + Intronic
1173729412 20:45318053-45318075 CCTGGGGTGCACCCTTGCTTGGG - Intergenic
1173809770 20:45948736-45948758 CCCAGCCTGCAGGCAGGCTTTGG - Exonic
1175596520 20:60239082-60239104 CCCAGGCTGCACCATAGCCTGGG - Intergenic
1177631973 21:23740803-23740825 CCTCTCCTGCACGCTTGCTTAGG - Intergenic
1179961823 21:44771950-44771972 CTTAGGCTGCACATTTGCTTGGG - Intronic
1180460934 22:15563907-15563929 CCCAGGCTGTGCCCTCGCTTTGG - Intergenic
1182379203 22:29872700-29872722 CCCAGGCTGCAGGGAAGCTTTGG + Intergenic
1182422634 22:30256042-30256064 CCCCGGCTGCAGGCTGGCCTGGG - Intergenic
1182892745 22:33832517-33832539 CCCAGGCTTCACGCAAGCTGTGG + Intronic
1183364225 22:37398822-37398844 CCTAGGCTCCTCCCTTGCTTGGG + Intronic
1183381134 22:37491110-37491132 ACCAGGGTCCACGCTGGCTTGGG + Exonic
1185366058 22:50437317-50437339 CTCAGGCTGCGCGCTCGCTGCGG - Intronic
950536698 3:13583039-13583061 CCCATGCTGCACTCTTGTTTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954730248 3:52654468-52654490 CCCATGCAGCCAGCTTGCTTGGG + Intronic
957451448 3:80387182-80387204 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
961405770 3:126678759-126678781 CCGAGGCTGCACGGCTGCTCAGG - Intergenic
962655001 3:137534352-137534374 CCCAGCCTGAACACTGGCTTTGG - Intergenic
966279316 3:178209833-178209855 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
968220815 3:196938262-196938284 CCCAGATTGCAGGCTTGCCTCGG - Intronic
968532622 4:1101796-1101818 CCCCTGCTGCAAGCTTTCTTAGG - Intronic
969171744 4:5369470-5369492 CCCTGGCTGCATGGTTTCTTGGG - Intronic
969639163 4:8386795-8386817 CCCAGGCTCCACACCGGCTTCGG + Intronic
971455147 4:26837059-26837081 CCCATTCTGGACACTTGCTTGGG - Intergenic
975865079 4:78717271-78717293 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
976546112 4:86337586-86337608 CCTAGGTTGCAAGCTTGCTCTGG - Intronic
979146630 4:117254398-117254420 CCCAGGCTGCAGGCATTCCTCGG - Intergenic
982266691 4:153544472-153544494 CCCAGGCTGCCCTCTGCCTTGGG + Intronic
984437274 4:179722744-179722766 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
986368970 5:7061723-7061745 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
988199108 5:28047937-28047959 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
988716869 5:33836980-33837002 CCCAGGCAGGAAGATTGCTTGGG - Intronic
989129130 5:38087132-38087154 CCCAAGCTGCAAGATTTCTTGGG + Intergenic
991637082 5:68716833-68716855 CCCAGGCTGCAGTCTGGGTTTGG - Intergenic
992553928 5:77885162-77885184 CCCAGGCAAGAGGCTTGCTTAGG - Intergenic
992671894 5:79069655-79069677 CTCAGGCTGCCCGCTGGCCTCGG - Intronic
1001532506 5:172473607-172473629 CCCAGGCAGCCCGTCTGCTTTGG - Intergenic
1002194999 5:177496831-177496853 CCGAGGCTCCAGGCTGGCTTGGG - Intronic
1004256869 6:14072313-14072335 GTCAGGCTGCACTCTGGCTTCGG - Intergenic
1005252883 6:23967588-23967610 CCCAGGCTTCATTCTTGATTTGG - Intergenic
1006442229 6:34059810-34059832 CCCTGGCTGAGCGCTTGCTGTGG - Intronic
1009752090 6:67887193-67887215 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1011367888 6:86601783-86601805 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1012315836 6:97781896-97781918 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
1013556619 6:111262792-111262814 CCCAGGCTACACCCTGGATTGGG + Intronic
1013808074 6:114015725-114015747 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1014193724 6:118527388-118527410 CCCAGGCTGAACCCTAGTTTTGG + Intronic
1017914175 6:158819079-158819101 CCCAGGCTCCGCGTTTCCTTCGG + Intronic
1018077608 6:160230792-160230814 CCCAGGCTGCAGGCATTCCTTGG - Intronic
1021611335 7:22460670-22460692 CCAAGGCTGCAAGCTTGCAGAGG + Intronic
1023852856 7:44159794-44159816 TCCAGGCCTCAGGCTTGCTTTGG + Intronic
1025790115 7:64680981-64681003 CCCAGGCTGCAGGCATTCCTTGG - Intronic
1028640777 7:93039833-93039855 CCCAGGCTTCAGGCTTTCTCTGG - Intergenic
1034881652 7:154767404-154767426 CCCAGGCTGCTCGCTTGGAATGG - Intronic
1035351077 7:158246994-158247016 GCATGGCTGCACGCTTGCTCTGG - Intronic
1036070913 8:5440054-5440076 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1037326780 8:17699761-17699783 CCAAGGCAGCTCCCTTGCTTTGG - Intronic
1039548439 8:38426361-38426383 CCCAGGCTGCAGGGTTGGCTAGG + Intronic
1042316427 8:67431095-67431117 CCCAGGCTGGAGGATTGCTTGGG - Intronic
1042321001 8:67475528-67475550 CAAAAGCTGCAGGCTTGCTTGGG + Intronic
1044710639 8:95054178-95054200 CCAAGGCTGGAGGATTGCTTGGG - Intronic
1045990008 8:108295849-108295871 CCAAGGCTGGAGGATTGCTTGGG - Intronic
1046074917 8:109303108-109303130 CCCAGGCTGCGGGCTTTCCTTGG - Intronic
1049311100 8:141934314-141934336 CCCACGCTTCACGCTTGCTCAGG + Intergenic
1050896085 9:10887064-10887086 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
1051953395 9:22661980-22662002 CCCAGGCTGCAGGCATTCCTTGG + Intergenic
1054967694 9:71048486-71048508 ACCACCCAGCACGCTTGCTTGGG - Intronic
1056553101 9:87667209-87667231 CCAGGGCTTCAAGCTTGCTTTGG - Intronic
1057439723 9:95074153-95074175 CCCAGGTTGCATGTCTGCTTGGG + Intronic
1060552753 9:124493232-124493254 CCCAGGCTGCACGCCTAGTTGGG - Intronic
1062034211 9:134375625-134375647 CCCAGGCTGCCCGCTGGCCCTGG - Intronic
1062203334 9:135320979-135321001 CCCAGGGTGCACTCTGCCTTAGG - Intergenic
1187317210 X:18207037-18207059 CCCAGTGTGCAGGCTTGCTGAGG + Intronic
1196585135 X:117419962-117419984 CCCAGGCTGCAGGCATTCCTTGG - Intergenic
1198920950 X:141726259-141726281 CCCATACTGCAGTCTTGCTTTGG - Intergenic
1200965505 Y:9032349-9032371 CCTAGGGTCCACTCTTGCTTGGG + Intergenic
1202147594 Y:21816439-21816461 CCTAGGGTCCACTCTTGCTTAGG - Intergenic