ID: 1121112388

View in Genome Browser
Species Human (GRCh38)
Location 14:91321188-91321210
Sequence GGGACGCGTCCCGCAGCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121112378_1121112388 16 Left 1121112378 14:91321149-91321171 CCAGCTCCCCGCACTTGAGGCCG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1121112380_1121112388 9 Left 1121112380 14:91321156-91321178 CCCGCACTTGAGGCCGCTCTCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1121112379_1121112388 10 Left 1121112379 14:91321155-91321177 CCCCGCACTTGAGGCCGCTCTCC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1121112381_1121112388 8 Left 1121112381 14:91321157-91321179 CCGCACTTGAGGCCGCTCTCCTC 0: 1
1: 0
2: 1
3: 24
4: 165
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1121112384_1121112388 -4 Left 1121112384 14:91321169-91321191 CCGCTCTCCTCCAACACCAGGGA 0: 1
1: 0
2: 3
3: 56
4: 437
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1121112376_1121112388 22 Left 1121112376 14:91321143-91321165 CCTTCTCCAGCTCCCCGCACTTG 0: 1
1: 0
2: 5
3: 27
4: 319
Right 1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121112388 Original CRISPR GGGACGCGTCCCGCAGCCCC TGG Exonic
901055663 1:6447733-6447755 GGGACGCGACCCGGAGCCGGGGG + Intronic
901399284 1:9004929-9004951 GGGCCGCGTCCCGCCAGCCCTGG - Intronic
905276147 1:36819473-36819495 GGGATGCGTCCCGCATGCCCTGG + Intronic
905371212 1:37483530-37483552 GGGGCGCTTCCCACAGCTCCTGG + Exonic
908823073 1:68107848-68107870 GGGGTGTGTCCCGCAGACCCGGG - Intronic
909122782 1:71625726-71625748 GGCAGGCGTCCCCAAGCCCCAGG + Intronic
914678972 1:149925925-149925947 GGGCCATGTCCTGCAGCCCCAGG + Exonic
915549844 1:156625516-156625538 GGTCCGAGGCCCGCAGCCCCCGG - Exonic
916466974 1:165082451-165082473 TGGACACTTCCTGCAGCCCCAGG - Intergenic
916773616 1:167936965-167936987 GGGACGGGTCCTCCAGCCCGAGG - Exonic
923369421 1:233295562-233295584 GGGGCGCGGCCCGCGGGCCCGGG - Exonic
1062909024 10:1200116-1200138 GGAGCGCGCCCTGCAGCCCCAGG + Exonic
1065093123 10:22253513-22253535 GCGACGCGTCCCGGACGCCCGGG - Intergenic
1065490768 10:26279463-26279485 GGTACGGCTCCTGCAGCCCCTGG - Intronic
1069891657 10:71656118-71656140 GGGATGCAGACCGCAGCCCCAGG + Intronic
1069960173 10:72074909-72074931 GCCAAGAGTCCCGCAGCCCCTGG + Intronic
1073241991 10:102065286-102065308 GGGATGCCTCCCGCAGTCGCTGG - Intergenic
1076526686 10:131116595-131116617 GGGAGGCATCCCTCAGGCCCTGG + Intronic
1076872975 10:133202616-133202638 GGGAAGCCTCCCCCAGCCTCTGG + Intronic
1077023068 11:428247-428269 GGGACCCTTCCTGCTGCCCCAGG - Intronic
1080633770 11:34105640-34105662 GGGACGCGTGCCGCGGAGCCAGG + Exonic
1083822565 11:65181498-65181520 GCGCCGCCTCCCGCAGCCCCGGG - Exonic
1084193059 11:67507680-67507702 GGGACGCTTCCTGCAGCAACAGG + Exonic
1084195099 11:67520056-67520078 GGAAGGCGTCCCGTAGCTCCCGG + Exonic
1089543625 11:119206178-119206200 GGGACGCGCCCCGCCCGCCCCGG + Exonic
1091108376 11:132943605-132943627 TGTACGTGTCCCCCAGCCCCAGG + Exonic
1096693639 12:53335647-53335669 GGGACCCGTTCCCCAGCCTCAGG - Exonic
1096868424 12:54578545-54578567 GAAAGGCCTCCCGCAGCCCCTGG - Exonic
1102347115 12:112167427-112167449 GGCAGACGTCCCGCTGCCCCTGG - Exonic
1103308877 12:119989169-119989191 GGGACGCGGCCGGAAGCCCGGGG + Intergenic
1103407775 12:120687590-120687612 GGCTCGGGGCCCGCAGCCCCCGG - Intronic
1103945104 12:124521589-124521611 TTGCCGCCTCCCGCAGCCCCTGG - Intronic
1104736696 12:131139604-131139626 GGGGCCGGTCCCGCAGCACCAGG + Exonic
1104761552 12:131300013-131300035 GGAAGGGGTCCTGCAGCCCCTGG - Intergenic
1104818224 12:131660779-131660801 GGAAGGGGTCCTGCAGCCCCTGG + Intergenic
1104964284 12:132502076-132502098 GGGACGCATCACTCAGACCCGGG - Intronic
1110219622 13:73059363-73059385 GGGACCCGTGCCCCAGCCGCCGG + Exonic
1112771451 13:102799081-102799103 GACACGCGTCCCGGCGCCCCGGG + Exonic
1113757056 13:112819849-112819871 CGGACGCGCCCAGCGGCCCCCGG - Intronic
1113914773 13:113863761-113863783 GGGACGCGTCAAGCCGCGCCCGG + Intronic
1118289395 14:64505348-64505370 GGGAAGTGTCCCGGAGCCCGAGG + Intronic
1118571526 14:67199861-67199883 GGGCCATGTCCTGCAGCCCCAGG - Intronic
1119703464 14:76770192-76770214 GCGCCGCGTCCCACAGCACCAGG - Intronic
1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG + Exonic
1121323741 14:93007791-93007813 GGGAGTCGTCCTGCCGCCCCAGG + Intronic
1122558076 14:102592239-102592261 CGCACGCCTCCCGCAGCCTCTGG - Intergenic
1132383403 15:101382336-101382358 GGGACCCGTCCTGCAGCCTGGGG - Intronic
1132623455 16:879100-879122 GGGCTGCCTCCCCCAGCCCCCGG - Intronic
1137683290 16:50369039-50369061 GGGCCGCCACCCGCAGCCGCCGG - Intergenic
1139466059 16:67154843-67154865 GCGCCGGGTCCCGCAGCGCCCGG + Exonic
1141687668 16:85579544-85579566 GGGACGCGTCCTGGAGATCCAGG + Intergenic
1141972534 16:87493052-87493074 GGGACGGGCCCGGCAGGCCCGGG - Intergenic
1142128448 16:88421510-88421532 GGGACGCGTCCCCGAGCCCCTGG + Intergenic
1142145544 16:88491457-88491479 TGGATGCGTCCTGCATCCCCGGG - Intronic
1142637754 17:1268503-1268525 CGGCCGCGCCCCGCAGCGCCCGG + Intergenic
1144814824 17:18026634-18026656 GGGAAGCTTGCAGCAGCCCCAGG + Intronic
1144840744 17:18184158-18184180 GGGACGCGCCCCGGGGCCCCCGG - Intronic
1145002041 17:19312440-19312462 GGAAAGCGTTCCGCAGCCCCTGG - Intronic
1146377187 17:32302752-32302774 GGGACCCGAGCCGCGGCCCCTGG + Intronic
1146956041 17:36936857-36936879 CGGGCGCGTCCCTCAGTCCCTGG - Intronic
1147147071 17:38491548-38491570 GGGGGGCGCCCGGCAGCCCCTGG + Intronic
1147919549 17:43907452-43907474 GGTAGGCGTCCCCCGGCCCCCGG - Intronic
1149304574 17:55335491-55335513 GGGAGACGTCCCCCAGCCTCAGG + Intergenic
1151745408 17:76009181-76009203 GGGCCGCCTCCCGCACCTCCTGG + Exonic
1152181170 17:78822655-78822677 GGGAGGCGCCAGGCAGCCCCGGG - Intronic
1152279267 17:79375767-79375789 GGGCCGTGTCCTGCAGCCTCTGG - Intronic
1152378488 17:79930406-79930428 CGGAGGCCTCCCGGAGCCCCCGG - Intergenic
1152570719 17:81120153-81120175 GGAGCGCGACCCCCAGCCCCGGG + Intronic
1152627127 17:81393036-81393058 TGGACGCGCCCCGAGGCCCCGGG - Intergenic
1152704028 17:81833615-81833637 GGGACGGGTCCGGCCGCCCCTGG + Exonic
1153051345 18:905692-905714 CGGACGCCTCCCCCAGCCCTAGG + Intronic
1159100105 18:63949216-63949238 GGGGCGGGTCCCGCAGGCCGCGG - Intergenic
1160187748 18:76688617-76688639 TGGGAGTGTCCCGCAGCCCCGGG + Intergenic
1161065536 19:2235717-2235739 GCGGCGCTTCCCGCAGCCCGGGG - Intronic
1161783982 19:6311825-6311847 GGGAGGAGTCCCTCAGGCCCAGG + Intronic
1161831578 19:6608917-6608939 GGGCCCCGTCCCACAGCCCTCGG - Intergenic
1161946391 19:7440073-7440095 GCGCCGGGTCCCGGAGCCCCGGG + Exonic
1162802318 19:13118362-13118384 GGGGCGCGCCCCGCTGCGCCGGG - Exonic
1166091705 19:40513411-40513433 CGAGCGCGTCCCGCAGCCACTGG - Exonic
1166297533 19:41896390-41896412 GGGATGAGTCCCCCAGCTCCAGG - Exonic
1166366235 19:42279999-42280021 GGGGTACGTCCCGGAGCCCCCGG + Intronic
1166797980 19:45439679-45439701 CGGACGCGTCCCGACGCCCCTGG + Intronic
927114375 2:19886576-19886598 GGGATGTGGCCCACAGCCCCGGG - Intergenic
929242420 2:39666166-39666188 GGGGCGAGTCCCGCAGCGGCAGG - Exonic
929756352 2:44768672-44768694 CGGCCGCGTCCCGGAGCCCCGGG - Intronic
931355767 2:61537237-61537259 GGGAGGGGTTCCCCAGCCCCTGG - Intronic
932490224 2:72115565-72115587 GGCAGGCGGCCCCCAGCCCCAGG + Intergenic
932607837 2:73176390-73176412 GGCAGGCATCCAGCAGCCCCAGG + Intergenic
938114840 2:128595989-128596011 GGGACTCCTCCCTCAGCCCTTGG + Intergenic
948530451 2:238600387-238600409 GGGACCACTCCCGCAGCCCCTGG - Intergenic
948928999 2:241118862-241118884 GGGGCACTTCCCGCAGCTCCTGG + Intronic
1169021595 20:2334954-2334976 GGGACGCTTCCCACAGGACCTGG + Intronic
1169075910 20:2759730-2759752 GGGTGGCGCCCCGCAGCCTCGGG + Exonic
1169093233 20:2873814-2873836 GGGACCCCTCCCACCGCCCCCGG - Intronic
1175902976 20:62367258-62367280 GGGCCGCGTCCCCGAGCTCCAGG + Exonic
1175904550 20:62372916-62372938 GGGACGCTTCCCTCTGCCCCAGG - Intergenic
1175917741 20:62434782-62434804 GGGCCGAGTCCCCCAGACCCAGG + Intergenic
1178914644 21:36699580-36699602 GGGAGGCGTCTCGGAACCCCGGG + Exonic
1179024441 21:37668095-37668117 GGGACGGAGCCCACAGCCCCAGG + Intronic
1179717896 21:43299402-43299424 GGGACGAGGCCAGCAGCCCCAGG + Intergenic
1180093043 21:45542391-45542413 GGGCCGGGTCCGGGAGCCCCAGG - Exonic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183588555 22:38767162-38767184 GGCACGCCTTCCACAGCCCCAGG + Intronic
1184673357 22:46027378-46027400 GGGCCGCGCCCCGCCGCGCCGGG + Intergenic
1184679227 22:46061474-46061496 GGGTCGCGCCCCGGAGGCCCAGG - Intronic
1184759645 22:46537285-46537307 GGTCCGCGTCCCGCCTCCCCGGG + Intergenic
953013614 3:39052101-39052123 CGGACGCGGCCGGCAGCTCCGGG + Intronic
953947883 3:47164403-47164425 GGGCCGGGTCACGCTGCCCCCGG - Intergenic
961468580 3:127097022-127097044 GGGAGGCTTCCTGCAGCCACCGG - Intergenic
964852065 3:161105356-161105378 GGGCCGCGGCCGGAAGCCCCTGG + Intronic
967883178 3:194315748-194315770 GGGAGGCGGCGCGAAGCCCCGGG - Intergenic
968577461 4:1374536-1374558 GGGACGAGGCCACCAGCCCCTGG - Intronic
968775151 4:2536083-2536105 GGGCCGCGCCGCGCCGCCCCTGG + Intronic
972765762 4:42151597-42151619 GGGTCCCCTCCCGCTGCCCCCGG + Intronic
975973709 4:80072525-80072547 GGTCCCCGGCCCGCAGCCCCGGG - Exonic
977654521 4:99505515-99505537 GGGAAGTGTGCCGCAGCCACAGG - Intergenic
984795729 4:183658873-183658895 CGGGCGCGGCGCGCAGCCCCGGG - Intronic
984801812 4:183723008-183723030 CGGCCGCGTGCCCCAGCCCCAGG - Intergenic
985727601 5:1524130-1524152 GGGGCGCCTCCTGCAGCCACTGG + Intergenic
985766151 5:1780527-1780549 GGGACTCGGCTGGCAGCCCCTGG + Intergenic
987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG + Intronic
995048363 5:107673492-107673514 GGGACGCGTCCCGAGGCGCTGGG - Intergenic
998402934 5:141857408-141857430 GGGATGGGTCCTGCAGCTCCTGG + Exonic
999169511 5:149581527-149581549 GGGGCGCGTCGCCCAGCTCCCGG - Exonic
1002057977 5:176609754-176609776 GGGGCGGGTCCCGCAGCCCTGGG - Intronic
1002590913 5:180291525-180291547 GGGACGCGACCCCGGGCCCCTGG + Intronic
1005851944 6:29828822-29828844 GGGAGGCGCCCCACTGCCCCTGG - Intronic
1005866890 6:29943547-29943569 GGGAGGCGCCCCGTGGCCCCTGG - Intronic
1007751663 6:44075135-44075157 GGGACACCTCTCACAGCCCCAGG - Intergenic
1017103105 6:150865757-150865779 GGCACGCGCCCCGCCGCCCTCGG + Exonic
1017877513 6:158536794-158536816 GGTACGCTTCCCGCAGCCGCCGG - Exonic
1018368808 6:163149240-163149262 GGGACGCCTCCCGCGGGCGCTGG + Intronic
1019008882 6:168825831-168825853 TGCACGCGTCCCCCCGCCCCAGG - Intergenic
1019008896 6:168825870-168825892 TGCACGCGTCCCCCCGCCCCAGG - Intergenic
1019008942 6:168826014-168826036 TGCACGCGTCCCCCCGCCCCAGG - Intergenic
1019536229 7:1531083-1531105 GGGCCCCGCCCCGCAGGCCCGGG + Intronic
1020085679 7:5308984-5309006 GGGTCGGGTGCAGCAGCCCCCGG - Intronic
1020106282 7:5423664-5423686 GGCCCGGCTCCCGCAGCCCCCGG + Intronic
1023286947 7:38630842-38630864 GGGACGCGGCCCGCAGATCGGGG - Intronic
1027187702 7:75981785-75981807 GGGATGCACCCCGCTGCCCCAGG - Intronic
1029495980 7:100895693-100895715 GGGACGGCTCCCGCTTCCCCGGG - Intronic
1030270161 7:107661488-107661510 GGTCCGCGTCCTGCAGCCCTCGG - Intronic
1034086765 7:148329067-148329089 GGGAGGGGGCCAGCAGCCCCAGG - Intronic
1034392780 7:150799956-150799978 CGGACGCTTTCCCCAGCCCCGGG - Intronic
1035991695 8:4498001-4498023 AGTAAACGTCCCGCAGCCCCAGG + Intronic
1036910915 8:12755844-12755866 GGGGAGCGTCCCCCAACCCCCGG - Intronic
1041166918 8:55101158-55101180 GGGGCGCGGCCGGCAGCCGCGGG - Intergenic
1042159491 8:65877883-65877905 GGGACTCTGCCCGCAGCCCACGG + Intergenic
1043390117 8:79784076-79784098 CGGACGCGGCCCGGAGCTCCAGG + Intergenic
1043463869 8:80486620-80486642 CGGACGCGTGCAGCAGACCCGGG + Exonic
1045041385 8:98227710-98227732 GCCACTCCTCCCGCAGCCCCTGG - Intronic
1049805681 8:144537695-144537717 GGGCCTCTCCCCGCAGCCCCTGG - Intronic
1051841495 9:21402908-21402930 TCGGGGCGTCCCGCAGCCCCAGG - Intergenic
1057228989 9:93307655-93307677 GGGCCGCGTCAGGCAGCCCCAGG + Intronic
1057354190 9:94321355-94321377 GGGACCCATCCCCCAGTCCCAGG + Intronic
1057653574 9:96936280-96936302 GGGACCCATCCCCCAGTCCCAGG - Intronic
1061843940 9:133376289-133376311 GGGACGCGTTCCGCCGGGCCGGG - Intergenic
1062555869 9:137113236-137113258 GGAACGCTTCCCGCACACCCTGG + Exonic
1185458039 X:320113-320135 GGGAGGCGTCCGGGACCCCCAGG - Intergenic
1185791229 X:2929206-2929228 GGGCCGCGTCCCGGGGTCCCAGG + Intronic
1198936154 X:141904089-141904111 AGGACACGTCCCTCAGCCCTCGG - Intronic
1199793823 X:151177433-151177455 GGGAGCCGTCCTGGAGCCCCAGG - Intronic
1200010019 X:153113808-153113830 GGGACGCCTCCGTCAGGCCCAGG + Intergenic
1200029581 X:153286114-153286136 GGGACGCCTCCGTCAGGCCCAGG - Intergenic
1200986070 Y:9304364-9304386 TGGACCCGTCCTGCAGACCCTGG - Intergenic
1202110039 Y:21408654-21408676 CGGACCCCTCCCGCAGACCCAGG - Intergenic
1202124512 Y:21556537-21556559 TGGACCCGTCCCGCAGACCCCGG + Intergenic
1202154496 Y:21872843-21872865 TGGACCCGTCCCGCAGACCCCGG - Intergenic