ID: 1121114430

View in Genome Browser
Species Human (GRCh38)
Location 14:91333712-91333734
Sequence CCTAGAAATCTGCATTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121114430_1121114445 16 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114445 14:91333751-91333773 TAGGGTCTAGGGTGGGGCCCAGG 0: 1
1: 0
2: 7
3: 38
4: 368
1121114430_1121114438 5 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114438 14:91333740-91333762 CCCTTACTCCCTAGGGTCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1121114430_1121114441 9 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1121114430_1121114433 -3 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114433 14:91333732-91333754 AGGGCCTGCCCTTACTCCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 193
1121114430_1121114442 10 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114442 14:91333745-91333767 ACTCCCTAGGGTCTAGGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1121114430_1121114434 -2 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114434 14:91333733-91333755 GGGCCTGCCCTTACTCCCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 133
1121114430_1121114440 8 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114440 14:91333743-91333765 TTACTCCCTAGGGTCTAGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 76
1121114430_1121114436 4 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114436 14:91333739-91333761 GCCCTTACTCCCTAGGGTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121114430 Original CRISPR CCTAGAAATCTGCATTTTAC AGG (reversed) Intronic
900896919 1:5489437-5489459 CCTAGAATTCTGCATTTATGGGG + Intergenic
902129809 1:14249955-14249977 CCTAGAACTATCCCTTTTACAGG + Intergenic
906581114 1:46935744-46935766 CCAAGATATCTGCATGCTACAGG - Intronic
907936667 1:59047903-59047925 CCTTGAAATCTGCTATTTCCTGG - Intergenic
909949229 1:81699882-81699904 CCTAGTAATCTACATTTGAAAGG - Intronic
910722890 1:90306914-90306936 CCCAGGAATCTGCATTTTTATGG + Intergenic
910915973 1:92289514-92289536 CCTAGAAGACTGAATATTACAGG + Intronic
911226640 1:95314191-95314213 CCTAGGAGTATGTATTTTACAGG + Intergenic
911584491 1:99674920-99674942 CCTAGACTTCTGCATTCTGCAGG + Intronic
912277087 1:108270646-108270668 CATAGAAATTTGCATTTAAGTGG + Intergenic
912291141 1:108423710-108423732 CATAGAAATTTGCATTTAAGTGG - Intronic
914316935 1:146522162-146522184 CAGAGAACTCTGCATTTTATAGG + Intergenic
914497420 1:148211198-148211220 CAGAGAACTCTGCATTTTATAGG - Intergenic
916572822 1:166041957-166041979 CCTACAAACCTGCAGATTACAGG - Intergenic
916862998 1:168826251-168826273 CCTAGAAAGCTCCATGTGACTGG + Intergenic
917601556 1:176579224-176579246 AGTAGAAATCTGTATTTGACGGG - Intronic
920553721 1:206887803-206887825 ACTTGAAATCTGCATTTGGCAGG - Intergenic
921337775 1:214105794-214105816 CCAAGGAATCTGTATTTTAACGG + Intergenic
924334592 1:242974553-242974575 CTTAGAAATACTCATTTTACTGG + Intergenic
924359894 1:243228182-243228204 CATAAAGTTCTGCATTTTACAGG - Intronic
1063181829 10:3608462-3608484 CCACCAAATCTGCATATTACTGG + Intergenic
1064312388 10:14223162-14223184 CCTAGAAGTCTGCATCTCAGGGG - Intronic
1064500018 10:15961485-15961507 CCTAGCTAGCTTCATTTTACAGG + Intergenic
1064725289 10:18272925-18272947 CCCAGAGATCTGCATTTTTTTGG - Intronic
1068453563 10:57225770-57225792 TCAAGAAATCTGAATTTTAGGGG - Intergenic
1069607895 10:69751610-69751632 CCTAGAGATCTGCCTTCTATAGG - Intergenic
1073352010 10:102826617-102826639 CCTGGAAATCTGCATTTTACAGG - Intergenic
1073598031 10:104819198-104819220 CCTGGAAATCTGCATTTTATAGG - Intronic
1074962519 10:118460686-118460708 CCTAGAAATCTATTTTTTAAAGG + Intergenic
1077462773 11:2718922-2718944 CCCAGGAATCTGCATTTGAATGG - Intronic
1077871336 11:6264343-6264365 CCTTAAATTCTGCATTCTACTGG - Intronic
1078090232 11:8260408-8260430 CCTAGCCATCTCCACTTTACTGG - Intronic
1079416967 11:20246937-20246959 CCTAAAACTCAGCATTTTATAGG - Intergenic
1079470960 11:20776928-20776950 CCAACACATCTCCATTTTACAGG - Intronic
1079876446 11:25863379-25863401 CCTAGAAAGCAGCTTTTCACAGG + Intergenic
1081447748 11:43146741-43146763 CCTAGTAATCACCATTCTACAGG - Intergenic
1086703186 11:89923195-89923217 AATAAAAATCTGCATTTTACTGG + Intergenic
1088061818 11:105662221-105662243 TCTAAAAATATTCATTTTACAGG + Intronic
1089252589 11:117175667-117175689 CCCAGAAAACTGCAATTTAACGG - Intronic
1093614327 12:21203723-21203745 CCTAGAATACTGAATTTTAGAGG + Intronic
1095316076 12:40763310-40763332 CTTAGAAATCTTCATATTAATGG + Intronic
1095884273 12:47172677-47172699 CATAGCTATCTCCATTTTACAGG - Intronic
1098344104 12:69482929-69482951 CCTTGAAAGCTACATGTTACAGG + Intronic
1098574938 12:72030286-72030308 CCTAGAAATCTTCATTTTAAAGG - Intronic
1098970676 12:76852564-76852586 ACCTGTAATCTGCATTTTACAGG - Exonic
1100074224 12:90759092-90759114 CCTAGAAAAGGGCCTTTTACAGG + Intergenic
1100418993 12:94411093-94411115 CCTACTAATCTGAAATTTACAGG + Intronic
1102778628 12:115543369-115543391 CCTGGGAATCTGCATTTAACAGG + Intergenic
1103019974 12:117526105-117526127 CCCAGGAATCTGCATTTTCTCGG - Intronic
1104096914 12:125566331-125566353 CCTTACTATCTGCATTTTACAGG - Intronic
1105296050 13:19088755-19088777 CCTGTCAATTTGCATTTTACAGG + Intergenic
1108190417 13:47932775-47932797 CCTGCATATCTGCATTTTAAAGG + Intergenic
1108617320 13:52146720-52146742 CCTAGGCATCAGCATTTTAAAGG + Intronic
1109695507 13:65951242-65951264 ATTAGAAATGTGGATTTTACAGG - Intergenic
1109784633 13:67157306-67157328 CCAAGAAATTTGCAATTTAATGG - Intronic
1110005356 13:70259564-70259586 CCTACAAATCTGCAATATAAGGG - Intergenic
1110055931 13:70971520-70971542 CCTAGAAAACCCCATTTTATAGG + Intergenic
1110885383 13:80627400-80627422 ACTAGAAATCTCCATTCTAGAGG - Intergenic
1111756021 13:92397070-92397092 GCTAGAAATCTACATTTTTATGG - Intronic
1112047004 13:95607913-95607935 ATTACAAATCTTCATTTTACTGG + Intronic
1113136211 13:107092689-107092711 TCCAGCAATCTGCATTTTAATGG - Intergenic
1113777424 13:112955817-112955839 CCTGGATATCTGTATTTTAAAGG - Intronic
1115220010 14:31049525-31049547 CCTAAACATCTGCATTATACTGG + Intronic
1115343971 14:32322337-32322359 CCTAGGAAGCTGCATGCTACTGG + Intergenic
1115783051 14:36792340-36792362 GCTAGAAACATGAATTTTACAGG - Intronic
1119138967 14:72247571-72247593 CACAGAAATCAGTATTTTACGGG - Intronic
1121114430 14:91333712-91333734 CCTAGAAATCTGCATTTTACAGG - Intronic
1124087950 15:26569107-26569129 CCTAAATATATGCATTCTACAGG + Intronic
1127498861 15:59537613-59537635 CCTTGATATTTGCATTTGACTGG + Intergenic
1128788022 15:70412594-70412616 CCCAGGAATCTGCATTTAACAGG + Intergenic
1129495001 15:75970962-75970984 CCCAGAAAGGTGCATTTGACAGG - Intronic
1130085290 15:80773241-80773263 CATTGAGATCTGCAATTTACCGG - Intergenic
1133272774 16:4618762-4618784 CCCTGCACTCTGCATTTTACAGG - Intronic
1135951197 16:26916043-26916065 TGCAGAAATCTCCATTTTACAGG + Intergenic
1136000268 16:27287132-27287154 CCTAGAAAGAAGCATTTAACTGG + Intronic
1137344142 16:47638794-47638816 ACCAGTAATCTCCATTTTACAGG - Intronic
1139838100 16:69856244-69856266 CCTAGAATTTTGCCTTTTCCAGG - Intronic
1141076225 16:81008324-81008346 CCCAGGAATCTTCATTTTAACGG + Intronic
1143300423 17:5905814-5905836 CTTTGAAATCAGCATTGTACAGG - Intronic
1144250052 17:13407357-13407379 CCCAGAAATTTGCATCTTGCTGG - Intergenic
1146611205 17:34306550-34306572 CCAGGAAATCTGCATTTTCAGGG - Intergenic
1147668002 17:42160871-42160893 CCCAGAAATCTGCATTTAATAGG + Intronic
1150863298 17:68823377-68823399 CCTAGAGATCTGGATTTTACTGG - Intergenic
1153353585 18:4109423-4109445 CTTAGAATTCTGCACTTCACAGG + Intronic
1154350705 18:13580751-13580773 TCTAGGAATCTGCATTTTCCTGG + Intronic
1154362962 18:13679787-13679809 CTAAGAAAGTTGCATTTTACAGG + Intronic
1155378802 18:25193446-25193468 CTTAGAAGTCTGCAGTTTATGGG - Intronic
1156864647 18:41875210-41875232 CCTAGAAGTAGCCATTTTACTGG - Intergenic
1157858575 18:51122047-51122069 CCTAGAAGTCTGCATGTGAATGG + Intergenic
1158312951 18:56178431-56178453 CCTAGGAGTCTGCATTTCCCAGG - Intergenic
1158409056 18:57188277-57188299 TATAGAAATCTGCTTTTTAAAGG - Intergenic
1158462666 18:57660265-57660287 CCTAGAAGGCTGCCTTTTTCTGG - Intronic
1159418720 18:68186456-68186478 TTTAGAAATCTACATTTTAAAGG - Intergenic
1160021877 18:75187558-75187580 CCTTGAGCTCTGCATTTTCCTGG - Intergenic
926242219 2:11097095-11097117 CCCTGCAATCTGCATTTTAAAGG + Intergenic
926346907 2:11955323-11955345 CCTAGAAGTCTACATTTTAAAGG + Intergenic
926729878 2:16028570-16028592 CCTAGAAATTTGCATGTGATTGG - Intergenic
928420577 2:31135272-31135294 CCCAAAAATCTGCATGTTAATGG + Intronic
928953410 2:36835569-36835591 CCTAGAAATAGGCAGCTTACAGG + Intergenic
928954363 2:36847700-36847722 TCTAGAATTCTGCATTATACAGG - Exonic
929270752 2:39969156-39969178 CTTAGGAATCTGCATTGTAATGG + Intergenic
930744361 2:54866185-54866207 CCAAGAAATGTCCATTTAACAGG - Intronic
931457855 2:62426191-62426213 CCCAGGAATATGCATTTTAACGG + Intergenic
935311025 2:101783560-101783582 CCTGGAAGTCTGCATGTCACAGG + Intronic
935380348 2:102445513-102445535 ACTAGTAAACTGCATATTACTGG + Intronic
935808763 2:106774779-106774801 CTAAGAATTCTGCATTTTTCTGG - Intergenic
939734133 2:145822574-145822596 CCAAGATATTTACATTTTACTGG + Intergenic
940357267 2:152757353-152757375 GTTAGACATTTGCATTTTACTGG + Intronic
940476607 2:154169915-154169937 CCTAGAACTCTGGATGTAACTGG - Intronic
940505679 2:154550163-154550185 CCTAAAAAGCTGCATTTCCCTGG + Intergenic
942908446 2:181211606-181211628 CCTATAAATCTGCTTTGTCCAGG - Intergenic
944503410 2:200385269-200385291 CCTAGAAGTCTGCACCTTAGAGG + Intronic
944808645 2:203307036-203307058 CTATGAAATCTGGATTTTACAGG - Intergenic
945062576 2:205922199-205922221 CCTAGGACTCTTCTTTTTACTGG - Intergenic
945432536 2:209780917-209780939 CCCAGAAATCTGCATGCTGCTGG + Intronic
946067186 2:216997987-216998009 CCCAGGAATCTGCATGTTAAAGG + Intergenic
946354026 2:219173567-219173589 CCTAGGAATCTGGGTTTAACAGG - Intronic
1169700706 20:8443585-8443607 CCCAGAAAGCTGCATTATTCTGG + Intronic
1170249920 20:14269985-14270007 CCAAGAAATCTGCATTATATGGG + Intronic
1170627518 20:18041020-18041042 CATCGATATCTCCATTTTACAGG + Intronic
1171342741 20:24443528-24443550 TCTAGGAATCTGCATTTGAAAGG - Intergenic
1176008785 20:62880827-62880849 CCAAGAAATCTTCATTCTGCTGG - Exonic
1178552843 21:33556096-33556118 CCTAGAAATGTCCAGTATACTGG - Intronic
1181668358 22:24413597-24413619 CCTAGAAATGTGCATTTTTTAGG + Intronic
1183384436 22:37506868-37506890 CCCAGGAATCTGCATTTTATGGG - Intronic
1183827653 22:40401108-40401130 CCTAGAAATCAGCAAATTTCTGG - Intronic
1184475184 22:44716588-44716610 CCTTGTTATCTCCATTTTACAGG + Intronic
949362973 3:3251415-3251437 CCTTGAAACCTGCACTGTACTGG - Intergenic
949581336 3:5391509-5391531 CCCAGAAATCTGCATTCTAGTGG - Intergenic
949968554 3:9381444-9381466 CCTAAGAGTCTGCATTTTCCAGG + Intronic
953994780 3:47511583-47511605 CCTAGCAATCTGATTTTCACTGG - Intronic
954350548 3:50039656-50039678 TTTAAAAATCTGCATTTTAGTGG + Intronic
954520255 3:51218827-51218849 CCCAGAAATCTGTGTTTTATGGG - Intronic
954896940 3:53983638-53983660 CTTAGAAATTAGCATTTTCCAGG + Intergenic
955641106 3:61085395-61085417 CCTTTAAATTTGCATTTTCCTGG + Intronic
956052722 3:65265756-65265778 CTTAGAAATCTACATTGTACTGG - Intergenic
956591584 3:70921085-70921107 CCTAGAAATATGTATTTTCATGG - Intergenic
956639239 3:71399806-71399828 CTTACAAACCTTCATTTTACTGG + Intronic
958889554 3:99768458-99768480 TCTAGATATCACCATTTTACAGG + Intronic
960080307 3:113533538-113533560 CCTAGAAATCAGGACTTTCCTGG - Intronic
960122602 3:113962474-113962496 TCTAGAAATCTACATTTAAAAGG + Exonic
960419057 3:117421066-117421088 CCAAGAATTATGGATTTTACAGG + Intergenic
960642210 3:119836679-119836701 CCTATAAATGGGCATTTTAAAGG + Intronic
963635730 3:147793253-147793275 CTTAGAATTCTGCATTTAAAAGG - Intergenic
963658219 3:148087590-148087612 CCTAGGAATCTGGATTTTAATGG - Intergenic
963989989 3:151641721-151641743 CTTAGAAGTCTGAATTTTACAGG + Intergenic
964949054 3:162264512-162264534 CCTTGAAATTTTCATTTTACAGG - Intergenic
969044357 4:4325975-4325997 CCTAGGAATCTGCAGTTAACTGG + Intergenic
969267415 4:6073551-6073573 CCTGGGAATCTGCATTTCACAGG + Intronic
970205503 4:13651651-13651673 CATAGACATTTGCTTTTTACCGG + Intergenic
970911632 4:21283911-21283933 CTTTGAAATCTGCAATTTACTGG + Intronic
974349754 4:60729926-60729948 CCTAGAAATGTATATTTTATAGG - Intergenic
974844507 4:67335171-67335193 CCTACTAATCTGCCTTTTATTGG - Intergenic
974887294 4:67835245-67835267 CCTAGGAATCTGCATTTTAGAGG - Intronic
975956308 4:79844462-79844484 CAAAGAAGTCTGCATTTGACTGG - Intergenic
979242519 4:118460731-118460753 CTTAGAAATACTCATTTTACTGG - Intergenic
980878056 4:138681949-138681971 CCCAGAATTCTGCATTTTCCAGG + Intergenic
983614098 4:169682331-169682353 CCTAAAATTCTGATTTTTACTGG + Intronic
984616932 4:181909006-181909028 CCTGGAAATCTTTATTTCACTGG + Intergenic
984964816 4:185130377-185130399 CCTAATAATCTGCATTTGCCTGG + Intergenic
985000225 4:185475292-185475314 CCGAGAAATTTTCATTTTATAGG - Intergenic
988638603 5:33015986-33016008 CCTGGCAAGCTGCATTTTTCAGG + Intergenic
988857259 5:35240385-35240407 CCTTGGAATTTGCATTTTAATGG - Intergenic
989018943 5:36977551-36977573 GCTAGAAGTCTTCATTTTACTGG + Intronic
990047634 5:51453916-51453938 CCTAATAATCTGCATTTTGAAGG - Intergenic
992240107 5:74759800-74759822 CCTATAAACCTGCCTTTTCCAGG + Intronic
993014672 5:82521984-82522006 CCTTGTAAACTGCATTTTTCAGG + Intergenic
993063630 5:83072479-83072501 CCCAGAAATTTGGATTTAACTGG + Intronic
994059931 5:95463483-95463505 CCTAGGACTCTGCATTTTAAAGG - Intergenic
994060511 5:95471726-95471748 ACTAGAAATTTGCATTTAACTGG + Intronic
995008963 5:107236297-107236319 GCTAGAAAGCAGCATTTTAGAGG - Intergenic
997633387 5:135386730-135386752 CATAGAAATCTGTGTTTTCCTGG - Intronic
998870042 5:146542937-146542959 AGTAGAAATCTACCTTTTACAGG + Intergenic
999344218 5:150800897-150800919 CCAAGAATTCTGCATTTTTAAGG + Intergenic
1000365655 5:160488435-160488457 CCTAGAAATCTACTATTCACCGG - Intergenic
1000396567 5:160781246-160781268 CCTAGAATTCTGCATTTCTAAGG + Intronic
1000715771 5:164642489-164642511 ACTACAAATCTTCATTTCACAGG - Intergenic
1000846446 5:166287397-166287419 CTCAGAAATCTGAATTTTATAGG + Intergenic
1002962116 6:1924988-1925010 ACTAAAAATTTGCATTTTATGGG - Intronic
1005687028 6:28263166-28263188 CATAGAATTTTACATTTTACTGG + Intergenic
1007101834 6:39253935-39253957 CCTAAGAATGTCCATTTTACGGG + Intergenic
1007993358 6:46280604-46280626 CCTATAAAGCTGTATTTTAAAGG + Intronic
1008331640 6:50252658-50252680 ACTCTAAATCTGAATTTTACAGG + Intergenic
1011629083 6:89307456-89307478 CCTAGAGATTTGAATTTGACTGG + Intronic
1012294214 6:97500058-97500080 CCTAGAAACCAGCATTTAATAGG - Intergenic
1014329793 6:120048595-120048617 TCTAGAAATTTGCCTTTTTCAGG + Intergenic
1015700507 6:136031322-136031344 ATCAGAAATCTGCATTTTAATGG + Intronic
1015920499 6:138261946-138261968 CCTAGAAAACTGAATATTATAGG + Intronic
1016676638 6:146777908-146777930 CCTCAAGATGTGCATTTTACAGG + Intronic
1016688235 6:146905648-146905670 CCTGGACAGCTGCATTTGACTGG + Intergenic
1021928838 7:25559552-25559574 CCTAATAAACTGCATTTTACTGG - Intergenic
1022617212 7:31943740-31943762 TCTAAAACTCTGCATTTTATTGG + Intronic
1022853951 7:34297371-34297393 CCTAGACATGGGCTTTTTACAGG - Intergenic
1025614350 7:63105382-63105404 CCCAGGAATCTGCCTTTTTCAGG - Intergenic
1026609103 7:71841481-71841503 CCCAGCAATCTGATTTTTACTGG + Intronic
1029014670 7:97303330-97303352 CCTATAAATATGCATTTTGTTGG + Intergenic
1030406430 7:109120105-109120127 CCTAGAAATGTGTTTTTTTCTGG + Intergenic
1030770282 7:113466168-113466190 CCCAGAAATCTGGAGCTTACTGG + Intergenic
1031844456 7:126788093-126788115 GATAGAAATCTACATTTTTCAGG - Intronic
1034172402 7:149072248-149072270 CCCAGAAATCTGGATCTTCCTGG - Exonic
1034496626 7:151427220-151427242 CCTAGAAATGAACACTTTACGGG + Intergenic
1034633729 7:152550877-152550899 CCTTGAAACTTGTATTTTACAGG - Intergenic
1036031999 8:4984342-4984364 CATATAAATCTGCATATTTCAGG + Intronic
1037020074 8:13959193-13959215 CCTAGAGATCTGAGTTTCACAGG + Intergenic
1037071615 8:14657227-14657249 CCCAGAAATCTGTATTCTCCCGG + Intronic
1038264708 8:26029555-26029577 CCTTGAAATGTGCATGTTCCAGG - Intronic
1039116232 8:34094295-34094317 CCTATGAGTGTGCATTTTACCGG + Intergenic
1039472204 8:37820561-37820583 CCTAGACATCTGAGTTTGACAGG - Intronic
1040916118 8:52567330-52567352 CCTGTAAATCTGCGTTTTAAGGG + Intergenic
1041742084 8:61166724-61166746 CATTGAAATTTGCATTTTAAAGG - Intronic
1042595371 8:70441640-70441662 CCTGAGAATCTGCATTTAACAGG + Intergenic
1043329069 8:79091025-79091047 CTTGGAAATCAGAATTTTACAGG - Intergenic
1044460283 8:92436414-92436436 TCGAGAAATTTGCATTTTAATGG + Intergenic
1045170934 8:99666922-99666944 CCCAGAAATGTACTTTTTACAGG + Intronic
1045202974 8:100005863-100005885 CCTAGCATGCTGCATTTGACAGG - Intronic
1045631049 8:104122361-104122383 CCTAGAACTCTGCATGCTCCAGG - Intronic
1046103125 8:109637130-109637152 CTCAGGAATCTGCATTTTACAGG - Intronic
1046661619 8:116953605-116953627 CCTAGAAAGCTGCAAGTTCCAGG - Intronic
1047307665 8:123666137-123666159 CCTGGAAATTTGCCTTTTATTGG - Intergenic
1047620118 8:126597701-126597723 CCTAGAAATCTAAATTTCAGGGG - Intergenic
1048164713 8:132052218-132052240 CCTGAAAGTCTACATTTTACAGG - Intronic
1049704822 8:144036756-144036778 CCTGGAAATAGACATTTTACAGG - Intronic
1052172577 9:25419166-25419188 CTTAGTAATCTGAATGTTACTGG + Intergenic
1053158979 9:35800518-35800540 CCTTGAAAGCTGGATTTTGCAGG - Intronic
1058096649 9:100868762-100868784 CCTAAAAAGGTGAATTTTACTGG + Intergenic
1058524131 9:105840206-105840228 CCTAGAATTCTGGATCTGACTGG - Intergenic
1058734673 9:107883412-107883434 CCCAGCAATCTGCATTTAATAGG + Intergenic
1058914192 9:109549873-109549895 CCTGGAGATCTGCATTTAATAGG + Intergenic
1060317758 9:122528644-122528666 CCTAGAAATTTAAATTTGACAGG - Intergenic
1060826112 9:126689016-126689038 GCTTGACATCTCCATTTTACAGG + Intronic
1061314885 9:129788803-129788825 ATTGGAAATCTGCATTTTGCAGG - Intergenic
1189976444 X:46464992-46465014 CCTTTATATCTGCATTTTGCGGG + Intronic
1197352634 X:125397014-125397036 CCTAGAAATCTACCATTTACAGG + Intergenic
1197667166 X:129236635-129236657 CCTAGAAATTTGAATTTAAATGG - Intergenic
1200505522 Y:4007446-4007468 CCGATAAATCTGCATATTAAAGG + Intergenic
1202390262 Y:24362837-24362859 CTTAGAAATACTCATTTTACTGG - Intergenic
1202480522 Y:25307279-25307301 CTTAGAAATACTCATTTTACTGG + Intergenic