ID: 1121114441

View in Genome Browser
Species Human (GRCh38)
Location 14:91333744-91333766
Sequence TACTCCCTAGGGTCTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121114429_1121114441 21 Left 1121114429 14:91333700-91333722 CCTGGGAGAGGGCCTGTAAAATG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1121114430_1121114441 9 Left 1121114430 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG 0: 1
1: 1
2: 4
3: 26
4: 205
Right 1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121114441 Original CRISPR TACTCCCTAGGGTCTAGGGT GGG Intronic
902794590 1:18793048-18793070 TACTCCTGGGGGTCTTGGGTGGG - Intergenic
903759398 1:25687299-25687321 GACTCCCAAGGCTCTAGGTTAGG - Intronic
905043474 1:34978438-34978460 TACTCCCTTGGGAAGAGGGTAGG - Intergenic
906532165 1:46530194-46530216 TACTCCCCAGGGCCTGGGGGCGG - Intergenic
908865857 1:68547999-68548021 GACTGCCTAGGGTGTGGGGTGGG + Intergenic
912687619 1:111779536-111779558 TTCTGCCAAGGGTCCAGGGTTGG + Intronic
916004296 1:160645715-160645737 TACTTCCCAAGGTCTAGGGGAGG - Intronic
919106325 1:193155910-193155932 TATTCCCTAGGTGTTAGGGTAGG - Intronic
1064461575 10:15539852-15539874 TAATCCCCAGTGTCAAGGGTGGG + Intronic
1070657049 10:78278789-78278811 ACCTCCCTAGGGTCTAGAGCTGG + Intergenic
1072661122 10:97364093-97364115 TTATCCCTAGGGCCTAGGGTGGG - Intronic
1074673352 10:115820878-115820900 TAATCCCCAGTGTCTAGGGCAGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1087923920 11:103897975-103897997 TAAATCCTAGGTTCTAGGGTTGG - Intergenic
1088593028 11:111419532-111419554 GTCTCCCTTGGGACTAGGGTGGG + Intronic
1088988473 11:114929767-114929789 TCCTCCCCAGGGTCAGGGGTCGG - Intergenic
1091265003 11:134263418-134263440 TGCTCCAGAGGGTCTAGTGTGGG + Intronic
1096546398 12:52343050-52343072 TACTCCCAAGAGGTTAGGGTTGG + Intergenic
1102813491 12:115843853-115843875 TCCTCCCTAGGGTTTTTGGTGGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1125512673 15:40301255-40301277 TACTCCATGGGGTATAGGCTGGG + Intronic
1126567100 15:50112322-50112344 TACTCCCTAGGCTCTCAGATAGG - Intronic
1129524400 15:76204657-76204679 TGTTCCCTAGAGTCCAGGGTGGG - Exonic
1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG + Intergenic
1131407801 15:92180633-92180655 AACTCCCAAGTGTCAAGGGTGGG - Intergenic
1136265521 16:29115315-29115337 CACTCCTTCGGGTCTAGGGAGGG - Intergenic
1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG + Intergenic
1143892855 17:10115745-10115767 TTCTCCCCAGGGACTAGGGGCGG - Intronic
1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG + Intronic
1150471441 17:65440861-65440883 TACTACCGAGTGTCTAGGTTAGG - Intergenic
1150670663 17:67194030-67194052 TACTCCCTAGGGTCTTGTAATGG - Exonic
1155163722 18:23216182-23216204 TATTCCCCAAGGTCTGGGGTAGG + Intronic
1159918803 18:74209113-74209135 TACTCTCTAGGGTCCAGGAAAGG - Intergenic
1160964218 19:1738884-1738906 TGCTCCTTGGGGTCGAGGGTTGG - Intergenic
1161746632 19:6064097-6064119 TGCTACGTAGGGTCTGGGGTTGG - Intronic
925251910 2:2446120-2446142 TGCTCCCTCGGGTCCAGGGGTGG - Intergenic
925623417 2:5817365-5817387 TTCTCCCTGGGGCCTAGGATGGG + Intergenic
928312123 2:30219912-30219934 AACTCCCTATGGTGTATGGTAGG - Intergenic
929744435 2:44641448-44641470 TACTGCCTTAGGTCTGGGGTTGG - Intronic
931642705 2:64395823-64395845 TGGTCCCTAGGGTCAAGGATAGG + Intergenic
931920505 2:67009937-67009959 TAATCCCTACGGTCAAGGGAGGG - Intergenic
933398145 2:81757546-81757568 TAGACCATAGGGTATAGGGTAGG + Intergenic
935977107 2:108589046-108589068 TGCTGCCTAGGGTCTTTGGTGGG + Intronic
942370708 2:175281219-175281241 TCCTCCCTAAGGTATAGGGAGGG + Intergenic
943516087 2:188888958-188888980 TATTCCATAGGGTCTTGGCTAGG - Intergenic
1170243274 20:14193569-14193591 TGATCCCTAGGTCCTAGGGTTGG - Intronic
1171055567 20:21903278-21903300 TACACCCTAGGAACAAGGGTGGG - Intergenic
1180153722 21:45966837-45966859 CTTTCCCCAGGGTCTAGGGTGGG - Intergenic
1181561155 22:23701670-23701692 TACTTCCTAGGGTCTCTTGTAGG - Intergenic
1183856008 22:40635876-40635898 TACTCCATAGTGCCTAGGGCTGG - Intronic
1185195133 22:49464599-49464621 TAATCACTGGGGTTTAGGGTTGG - Intronic
951274759 3:20671906-20671928 ACATCCTTAGGGTCTAGGGTGGG - Intergenic
951609883 3:24479970-24479992 TACTCCCTTGCCTCTAGGATGGG + Intronic
955414916 3:58683260-58683282 TACTCCCTAGGGTGTAAACTTGG - Intergenic
961011794 3:123441225-123441247 AACTTCCAAAGGTCTAGGGTAGG - Intronic
966015842 3:175136079-175136101 TACTCCTTAGGGTGTAGAGAGGG + Intronic
989544614 5:42658837-42658859 GACTCCCTAGGCTTTATGGTAGG - Intronic
994457322 5:100027946-100027968 TAATCCAGAAGGTCTAGGGTAGG + Intergenic
995687654 5:114788600-114788622 TATTCCCTTGGGTCAAAGGTAGG - Intergenic
996655288 5:125927278-125927300 TACTTATTAGGGTCTGGGGTTGG - Intergenic
997480889 5:134183810-134183832 GACTGCCTTGGGTCTAGGGTAGG + Intronic
1007794834 6:44339099-44339121 TGCTCTCAAGGGTCTGGGGTTGG + Intronic
1011191059 6:84728776-84728798 TACCCCCTAGAGTCTAGTTTAGG - Intronic
1012980183 6:105821225-105821247 TAATCCCTTGGGTATAGAGTAGG - Intergenic
1019645683 7:2127584-2127606 AACGACCTGGGGTCTAGGGTGGG + Intronic
1028641215 7:93043823-93043845 CACTCCCAAGGCTCTGGGGTCGG + Intergenic
1032214447 7:129946568-129946590 TAATTCATTGGGTCTAGGGTGGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1034000582 7:147408258-147408280 TTCTCCCTGGGATCTAGGTTGGG + Intronic
1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG + Intergenic
1034736764 7:153436314-153436336 TAATTCCTAGTGTCAAGGGTGGG + Intergenic
1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG + Intronic
1035932764 8:3801905-3801927 CAATGCCTAGGGTATAGGGTGGG + Intronic
1044474441 8:92609577-92609599 TTCTCCCAAGGCTCTAGGGAAGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1049457502 8:142700976-142700998 TTCTCCCTTGGGTCTGGGTTGGG - Intronic
1052966103 9:34341798-34341820 AACTCCCCAGGGTCCAGGGGCGG - Intronic
1062075882 9:134589773-134589795 TACTCCTGGGGGTCCAGGGTGGG + Intergenic
1186008651 X:5104507-5104529 TATTCCCTGGTGTCTAGGGGAGG + Intergenic
1194882730 X:99273864-99273886 TACTGCCTGGGGTCAAGGGAGGG - Intergenic