ID: 1121116353

View in Genome Browser
Species Human (GRCh38)
Location 14:91345796-91345818
Sequence GAACACCTGCGCCTAGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121116352_1121116353 12 Left 1121116352 14:91345761-91345783 CCTGTTTATCTATCTCAAACACT 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1121116353 14:91345796-91345818 GAACACCTGCGCCTAGACGATGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121116353 Original CRISPR GAACACCTGCGCCTAGACGA TGG Intronic