ID: 1121118755

View in Genome Browser
Species Human (GRCh38)
Location 14:91362311-91362333
Sequence GTTGGAAAGGGGATTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121118755_1121118763 27 Left 1121118755 14:91362311-91362333 CCAGCCACAATCCCCTTTCCAAC 0: 1
1: 0
2: 1
3: 48
4: 329
Right 1121118763 14:91362361-91362383 TCCAAGCTCAGCCCTGTATCAGG 0: 1
1: 0
2: 2
3: 19
4: 183
1121118755_1121118765 28 Left 1121118755 14:91362311-91362333 CCAGCCACAATCCCCTTTCCAAC 0: 1
1: 0
2: 1
3: 48
4: 329
Right 1121118765 14:91362362-91362384 CCAAGCTCAGCCCTGTATCAGGG 0: 1
1: 0
2: 2
3: 25
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121118755 Original CRISPR GTTGGAAAGGGGATTGTGGC TGG (reversed) Intronic
900080941 1:856926-856948 GTGGGAGAGGGGCTTGAGGCAGG - Intergenic
900654798 1:3751167-3751189 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
903695994 1:25207362-25207384 GTTTGAAATGTGCTTGTGGCTGG + Intergenic
904222091 1:28980047-28980069 GTTTAAAAGTGCATTGTGGCAGG + Intronic
905481776 1:38266703-38266725 ATGGGAAAGGGGATGGTGTCGGG + Intergenic
906564528 1:46789295-46789317 CTTGGAGAGGGGGATGTGGCAGG - Intronic
906989110 1:50718322-50718344 GATTAAAAGTGGATTGTGGCCGG - Intronic
907256968 1:53186713-53186735 GTAGGACAGGGGACTGTGGGTGG - Intergenic
907442689 1:54488688-54488710 GCGGGAAAGGGGGTTGGGGCGGG + Intergenic
907464070 1:54623578-54623600 GTGGGGAAGAGGATTGGGGCGGG - Intronic
908651038 1:66333613-66333635 GCTGGAAAGGGCATGCTGGCAGG - Intronic
909880839 1:80875790-80875812 GTTGGAAAAGGGGTTGGGGTGGG - Intergenic
910859539 1:91730424-91730446 GATAGAAAGGGGATTGAGGAAGG - Intronic
912275064 1:108247597-108247619 TGTGGAAAGGGGATTGGGGGAGG - Intergenic
912293158 1:108446754-108446776 TGTGGAAAGGGGATTGGGGGAGG + Intronic
912367042 1:109142573-109142595 GATGGAAAGAGGATTCTGTCAGG + Intronic
912385384 1:109268782-109268804 GTTGGGGAGGGGTTTGTGGAGGG + Intronic
913316810 1:117560745-117560767 ATTGGACATGGGATTTTGGCAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914357710 1:146901893-146901915 GGTGGAGAGGGGATTGAGACAGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914805398 1:150987752-150987774 GATGGAAATGGGATTGAGGGTGG - Intronic
915943431 1:160133480-160133502 GTTGGGATGGGGAGGGTGGCTGG - Intronic
915992817 1:160533249-160533271 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
916057580 1:161078713-161078735 GTTTAAAAAGTGATTGTGGCTGG + Intronic
916077787 1:161212512-161212534 GTTGGAAAGGGGCCAGTGGCTGG + Intronic
916607748 1:166359631-166359653 GCTGCAAAGGGGACTGTGGATGG - Intergenic
916683173 1:167122389-167122411 TTTGGAAATGGGACTGAGGCAGG - Intronic
916759741 1:167805687-167805709 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
918327942 1:183427932-183427954 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918702078 1:187617674-187617696 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918933097 1:190882632-190882654 GGTAAAAAGGGGATTCTGGCCGG - Intergenic
920557682 1:206915979-206916001 GGGGGAAAGGGGGTTGGGGCAGG + Intronic
920812930 1:209304002-209304024 GTTGGAAGGGGGAGAGCGGCTGG + Intergenic
921163300 1:212487950-212487972 GTTAGAAAGTGGATTCTGCCTGG - Intergenic
923499770 1:234555124-234555146 GTTGGAAGGTGGAGTGGGGCTGG - Intergenic
924926966 1:248692546-248692568 AATGCAAAGGGGAATGTGGCTGG - Intergenic
1062967437 10:1618783-1618805 GTTGGAGAGATCATTGTGGCAGG + Intronic
1063197369 10:3756105-3756127 TTTGGAAAGGGGGATGTGGGTGG + Intergenic
1064249079 10:13693168-13693190 TTAGAAAAGGGCATTGTGGCCGG - Intronic
1064259381 10:13772800-13772822 GTTGGAAAGGGTAGTGAGGGTGG + Intronic
1064834429 10:19510007-19510029 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1065009135 10:21405957-21405979 GTTGGAAAGGGGATGGTGTGGGG - Intergenic
1065563756 10:26988957-26988979 GTGGGGAAGGGGAGTGTTGCAGG + Intergenic
1065815079 10:29475834-29475856 GTTGGAAATGGGATTGGAGCTGG - Intronic
1066192443 10:33068541-33068563 GGTGTCAAGGGGATTCTGGCTGG - Intergenic
1066283477 10:33941191-33941213 GTAGGGAAGGGGATGATGGCAGG - Intergenic
1066464471 10:35640620-35640642 GCTGAAAAAGGGGTTGTGGCAGG + Exonic
1066754406 10:38696356-38696378 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1068520187 10:58069049-58069071 GTTGGAGATGGGAATGTGGTTGG - Intergenic
1068868823 10:61922205-61922227 GCTGGAAAGGGCATTGTGTCTGG + Intronic
1068967499 10:62928308-62928330 GTCGGAGAGGGGGATGTGGCAGG + Intergenic
1072460202 10:95611637-95611659 GTTGGAACAGGGATTGAAGCAGG + Intronic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1074689439 10:115991057-115991079 TCTGGAAGGGGGATTGAGGCAGG + Intergenic
1074715143 10:116211359-116211381 CTTGGAGAGGGGTCTGTGGCTGG - Intronic
1075897877 10:126013671-126013693 CTGGGAAAGGGGCTTGTGTCTGG + Exonic
1075957662 10:126537860-126537882 ATTTGAAAGAGGATTGTTGCAGG + Intronic
1076630801 10:131850951-131850973 GGTGGAAAGGTGTTTGTGGGTGG - Intergenic
1077303742 11:1858718-1858740 GTTGGGGAGGGGATGGGGGCTGG - Intronic
1077318337 11:1929032-1929054 GTGGGCAAGGGGCCTGTGGCGGG - Intronic
1077608230 11:3626641-3626663 GGTGGAATGGGGGCTGTGGCTGG - Intergenic
1078304418 11:10169329-10169351 GCTGGGAAGGGTAGTGTGGCGGG - Intronic
1078628858 11:12983573-12983595 GTTGGAAAGTGGACTGGAGCCGG - Intergenic
1078999476 11:16739053-16739075 GTAGGAAGGGGGATTGAGGAAGG + Intronic
1079045692 11:17100665-17100687 GTAGGAAGGGGGATGGTGGATGG - Intronic
1080518913 11:33049516-33049538 CTTGGAGAGGGGGTTGTGGCAGG + Intronic
1081014564 11:37859680-37859702 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082673004 11:56058401-56058423 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1083388089 11:62327344-62327366 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1084097331 11:66920350-66920372 GTTAGGCAGGGGCTTGTGGCAGG - Intronic
1084607699 11:70182092-70182114 GTTGGAGAAGGGAATGAGGCAGG - Intronic
1088590301 11:111397181-111397203 TTTGGAAAGTGGATTGGGGGAGG - Intronic
1089184291 11:116604222-116604244 GGTGGCAAGGGGAATCTGGCAGG - Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1089910680 11:122097317-122097339 GTTGCAAAAGGAATTTTGGCTGG + Intergenic
1090067966 11:123519397-123519419 GTTTGGAAGCGGATTTTGGCTGG + Intergenic
1092118370 12:6025806-6025828 GCTGGAAGGGGGGTTGTGGGTGG - Intronic
1092284336 12:7120210-7120232 GCTGGAAAGGTGAGTGTGGAAGG + Intergenic
1092455141 12:8636410-8636432 CTCGGAGAGGGGAATGTGGCAGG - Intergenic
1093383149 12:18519952-18519974 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1094734995 12:33224169-33224191 GTTGCCAAGGAGAATGTGGCAGG - Intergenic
1096542255 12:52314447-52314469 ACTGGAAAGGGGCCTGTGGCTGG - Exonic
1096559510 12:52425430-52425452 TTTGGAAATGGGATCGTTGCAGG + Intronic
1098600330 12:72323862-72323884 GGTGGAAAGGAGAATCTGGCTGG + Intronic
1099012416 12:77307918-77307940 TTTGGAAAGAGAATTTTGGCAGG - Intergenic
1099875290 12:88397108-88397130 GTTGTAAATGGGATTGAGTCTGG - Intergenic
1101462101 12:104906447-104906469 GGTGGGAAGGGAATTGGGGCAGG + Intronic
1101616865 12:106346145-106346167 CTTGGAAAGGGGATGGGTGCAGG + Intronic
1104931054 12:132339694-132339716 GTTAGAAAGGGGCTTATGGAGGG - Intergenic
1105688677 13:22813848-22813870 CTCGGAAAGGGGAATGTGGCAGG + Intergenic
1106381262 13:29241937-29241959 GCAGGAAATGGGAGTGTGGCAGG - Intronic
1109959758 13:69615070-69615092 CTTGGAGAGCGGAATGTGGCAGG + Intergenic
1113263580 13:108592513-108592535 GTTGTATAGGGGATGGTGGGTGG + Intergenic
1113339978 13:109412818-109412840 GTTGGGAAGGGGAGTGAGCCTGG + Intergenic
1114354441 14:21891561-21891583 CTGGGAAAGGGGATCTTGGCTGG + Intergenic
1114491885 14:23107735-23107757 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1114578835 14:23737499-23737521 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115962625 14:38852717-38852739 GTTGGAAAAGAGATTTGGGCTGG + Intergenic
1118097345 14:62552247-62552269 TTTGGAGAGTGGATGGTGGCAGG + Intergenic
1118509690 14:66458032-66458054 GCTGGGAAGGGGAGTGGGGCAGG + Intergenic
1118573758 14:67220674-67220696 GTTTCAAAGAGGATAGTGGCAGG + Intronic
1118667855 14:68089666-68089688 GGGGGAAAGGGGATGGTGGGAGG - Intronic
1118757968 14:68859120-68859142 GTTAGAAAGGTGGTTGGGGCTGG - Intergenic
1118935537 14:70284618-70284640 CTTGGAAATGGGAATGTGGCAGG - Intergenic
1119268114 14:73277084-73277106 CTTGGAAAGGTGATGCTGGCTGG + Exonic
1119675308 14:76549103-76549125 GTGGGACAGGGGATGCTGGCTGG - Intergenic
1119817352 14:77581706-77581728 GTTGTAAAAGAGATGGTGGCTGG - Intronic
1121118755 14:91362311-91362333 GTTGGAAAGGGGATTGTGGCTGG - Intronic
1122770024 14:104093740-104093762 GTGGGAATGGGGAGTGTGGGTGG + Intronic
1122895161 14:104753150-104753172 GTTGGTAAGGGGCTGGCGGCCGG + Exonic
1123117457 14:105901104-105901126 CTTGGAATGGGGTTTCTGGCTGG + Intergenic
1202919304 14_KI270723v1_random:16200-16222 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1202925327 14_KI270724v1_random:18794-18816 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1123723689 15:23081915-23081937 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1125388980 15:39171802-39171824 GATGGAAAGGGGAGGGGGGCAGG - Intergenic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1126495402 15:49284491-49284513 GTTGGAGAGAGGACTGAGGCTGG + Intronic
1127062825 15:55204852-55204874 GGTGGGAAGGGGATTGGGGTGGG - Exonic
1131275050 15:90973853-90973875 CTTGGCAAGGGGAATGCGGCAGG - Intronic
1133013472 16:2927933-2927955 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1133056190 16:3146496-3146518 GTTAGAAAAGGGCTTCTGGCCGG + Intronic
1134872962 16:17668172-17668194 CTTGGGAAGGGGATTGATGCTGG + Intergenic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1136728275 16:32380487-32380509 GTTGCCAAGTGGATGGTGGCAGG - Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1138374203 16:56551549-56551571 GTGGGGGAGGGGATTGGGGCAGG - Intergenic
1138906959 16:61348482-61348504 GTTGGGAAGGGTATTGTGGTGGG - Intergenic
1139959075 16:70707402-70707424 GGTGGAAAGGGGATGGAGGGAGG + Intronic
1139976472 16:70815399-70815421 GGTGGAGAGGGGATTGAGACAGG - Intronic
1140390575 16:74583101-74583123 GTTGGAAAGAGGCTTGTGGAGGG - Intronic
1141429984 16:83966405-83966427 GGAGGAAAGGGGATTGTGGGAGG + Intergenic
1141795854 16:86273729-86273751 ATTGGAAAGGGGGTTCTGGTAGG - Intergenic
1202998163 16_KI270728v1_random:137267-137289 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1142529089 17:566579-566601 GGTGGAAACGGGATGGAGGCCGG + Intronic
1143631711 17:8143702-8143724 GCTGGGAAGGGGGTAGTGGCTGG + Exonic
1143684820 17:8505139-8505161 TTTGGAAAGGGGGCTGGGGCTGG - Intronic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1147424982 17:40342102-40342124 GGTGGAAAGGGGGTGGTGCCCGG + Intronic
1149572154 17:57679633-57679655 GTTGGGATGGGGAGTGAGGCTGG - Exonic
1149655319 17:58306750-58306772 GTTGGAAGGGGGCTGGTGGGAGG + Intronic
1150489317 17:65563499-65563521 GCTGGAAAGGGGCAGGTGGCAGG + Intronic
1151474220 17:74336522-74336544 TTTGGAAATGGGGTTGTTGCAGG - Intronic
1154482919 18:14854947-14854969 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1154567905 18:15923046-15923068 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154569172 18:15940357-15940379 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154632895 18:16813807-16813829 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154656030 18:17131386-17131408 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154676225 18:17407175-17407197 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154680684 18:17468422-17468444 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154736023 18:18227102-18227124 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154858472 18:19910768-19910790 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154861231 18:19949416-19949438 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154864274 18:19991465-19991487 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154905094 18:20553092-20553114 GTGGGAAACGGGATTGTCTCAGG + Intergenic
1154977300 18:21471915-21471937 TTGTGAAAGTGGATTGTGGCTGG - Intronic
1157518021 18:48324782-48324804 GTTGGGCTGGGGATGGTGGCAGG + Intronic
1159110041 18:64044736-64044758 GTTGGCAAGGTGTGTGTGGCAGG + Intergenic
1160388907 18:78515505-78515527 GTTGGAAATAGGGCTGTGGCAGG - Intergenic
1161289318 19:3484513-3484535 GTTAGAAAGGGAGGTGTGGCTGG + Intergenic
1161489495 19:4554100-4554122 GATGGATAAGTGATTGTGGCTGG + Intronic
1162626653 19:11889816-11889838 CTTGGCGAGGGGAGTGTGGCAGG + Intronic
1163252760 19:16136048-16136070 GTGGGAAGGGAGTTTGTGGCTGG - Intronic
1164153726 19:22575689-22575711 TTTGGAGAGGGGGATGTGGCAGG - Intergenic
1164706673 19:30325129-30325151 GCTGGAAAGGGCTTTGTGGAGGG + Intronic
1165295168 19:34920924-34920946 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1165607140 19:37115397-37115419 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1167509549 19:49888800-49888822 GTTGAGGAGGGGATGGTGGCTGG + Intergenic
1167870103 19:52361471-52361493 GTAGAAAATGAGATTGTGGCCGG - Intronic
1167939704 19:52936827-52936849 CTTGGAGAGGGGAATGTGGCAGG - Intronic
1168358570 19:55718665-55718687 CTTGGCGAGGGGAATGTGGCTGG - Intronic
1168614888 19:57829733-57829755 CTTGGTGAGGGGAGTGTGGCAGG - Intronic
1168638393 19:58013744-58013766 CTTGGCAAGGGGGATGTGGCAGG + Intergenic
928109609 2:28495959-28495981 CTTTGAAAGGGGGTAGTGGCGGG - Intronic
928483427 2:31706610-31706632 GGTGGAAAGGGGGTGGTGGGGGG - Intergenic
929200063 2:39225733-39225755 GTAGAAAGGGGAATTGTGGCTGG + Intronic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
929608638 2:43253228-43253250 GGAGGAAAGGGAATCGTGGCTGG + Intronic
930812251 2:55554982-55555004 ATTGAAAAGGGTATTGTGGCCGG + Intronic
931404621 2:61963959-61963981 GTTGGTGATGGGATGGTGGCTGG + Intronic
932598952 2:73111382-73111404 GAGGGTAAGGGGATTGGGGCAGG - Intronic
933351108 2:81153067-81153089 GTTGGAAGGGGGAATGTAGTGGG - Intergenic
933972341 2:87480383-87480405 GTTGGAATGTGGATGGAGGCTGG - Intergenic
934317699 2:91940600-91940622 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934660454 2:96140836-96140858 GAAGGAGAGGGGATTGGGGCTGG + Intergenic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
936321389 2:111469805-111469827 GTTGGAATGTGGATGGAGGCTGG + Intergenic
936559587 2:113525334-113525356 CTTGGAAAAGGGATTGGGGCAGG + Intergenic
936768304 2:115880289-115880311 GTTGGAAAGGAGATTTGGGTGGG + Intergenic
936770368 2:115905670-115905692 GTTGAAAAGGGGGATGTGGTGGG - Intergenic
937444614 2:121947126-121947148 GTTAGAAAGGGGGATGGGGCAGG + Intergenic
937967586 2:127525981-127526003 GTTGGAGAGGGGATTCTGGTGGG - Intronic
938818583 2:134930148-134930170 GTTGGGAAGGGGAGTGGGACTGG - Intronic
938936353 2:136131004-136131026 ACTGGAAAGGGGAATGTGGGGGG + Intergenic
939306773 2:140421890-140421912 GATGGAAAGGGTGATGTGGCAGG - Intronic
940300736 2:152174633-152174655 CTTGGAAATGGGGTTGGGGCGGG - Intronic
941462918 2:165793451-165793473 TTTGGAAAGGGCTCTGTGGCCGG - Intronic
944881994 2:204022702-204022724 GTTGGCGAGGGGATGGTGGTGGG - Intergenic
945305747 2:208256955-208256977 CTTGGCGAGGGGAGTGTGGCAGG + Intronic
946257167 2:218452048-218452070 GTTGGAAAGTTGCATGTGGCTGG - Exonic
947730146 2:232423755-232423777 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
948232896 2:236365142-236365164 GTGGGAGTGGGGACTGTGGCGGG + Intronic
948582011 2:238993979-238994001 GCTGGAAAGGGAGTTGTGGAGGG + Intergenic
948794498 2:240395325-240395347 ATTGGAAAGGGCTTTGTGCCTGG - Intergenic
949076405 2:242061498-242061520 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1169658907 20:7956951-7956973 CTTGGACAGGGGGATGTGGCAGG - Intergenic
1170663439 20:18364330-18364352 GGTGGAAAGGGGGCTGTGGTTGG - Intergenic
1171783266 20:29440490-29440512 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1172374442 20:34425772-34425794 CTTGGCGAGGGGAGTGTGGCAGG - Intronic
1172731132 20:37089034-37089056 GTTGGAAAGGGTATCATGGAAGG - Exonic
1172998887 20:39091509-39091531 GTTGGGAAGGGGCTTGAGGCAGG + Intergenic
1173448494 20:43141505-43141527 GTTTGAAAGGGACTTGTGTCTGG - Intronic
1174499055 20:50970848-50970870 GCTGGAAGGGAGATTGTGGAAGG - Intergenic
1175000390 20:55621789-55621811 GTGGGAAAAGCGATTGTGGTGGG + Intergenic
1176291039 21:5044786-5044808 GTTGGGAAGAGGATGGTGGCGGG + Intergenic
1176797683 21:13381630-13381652 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1176852538 21:13934291-13934313 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1178961372 21:37069217-37069239 TTTGGAAAGTGGATTGTGATAGG - Intronic
1179265380 21:39798227-39798249 TTTGGAAAGGGAAGAGTGGCAGG + Intronic
1179360731 21:40705886-40705908 GTTAGAAAGCAGTTTGTGGCCGG + Intronic
1179814537 21:43896998-43897020 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1179866216 21:44218855-44218877 GTTGGGAAGAGGATGGTGGCGGG - Intergenic
1180305868 22:11124269-11124291 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1180333660 22:11556101-11556123 CTTGGAGAGGGGTATGTGGCAGG + Intergenic
1180544387 22:16486452-16486474 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1180569801 22:16704219-16704241 GCTGGAAGGGGGGTTGTGGGTGG - Intergenic
1182779480 22:32856307-32856329 GTTGGAATGGGGGGTATGGCTGG + Intronic
1183273392 22:36875949-36875971 GGGGGAAAGGGGAATGAGGCTGG - Exonic
1184495847 22:44840914-44840936 GCTGGGAAGGGGCTTGTGGCCGG + Intronic
1184601410 22:45545782-45545804 GTTGCAACAGAGATTGTGGCTGG - Intronic
1184647722 22:45905336-45905358 GGTGGAGAGGTGACTGTGGCTGG + Intergenic
949217131 3:1583526-1583548 CTGGGAAAGGGGCCTGTGGCTGG - Intergenic
949903470 3:8838917-8838939 GCAGGAAAGGGGATGTTGGCTGG - Intronic
950152590 3:10699064-10699086 GATGAATAGGTGATTGTGGCTGG - Intronic
950469470 3:13175534-13175556 GTTGAAAGGAGGAGTGTGGCAGG - Intergenic
950627439 3:14258677-14258699 GCTGGAAAGTGGTATGTGGCTGG + Intergenic
950735363 3:15003244-15003266 GATAGAAAGTGTATTGTGGCTGG - Intronic
951122237 3:18942892-18942914 CTTGGAATGGGGACTGTGGGAGG + Intergenic
951728816 3:25787899-25787921 GTGGGAAAGGGCATCCTGGCAGG - Intronic
952419836 3:33121110-33121132 GTTGAAAATGGGAATTTGGCTGG + Intronic
953228656 3:41044066-41044088 GTGGGGATGGGGATTGTGACAGG - Intergenic
954599990 3:51859605-51859627 CTTGGAGAGGGGAATTTGGCAGG - Intergenic
955102354 3:55862754-55862776 GCTGGAAAGGGAAGTGTGACAGG - Intronic
956578353 3:70781139-70781161 GTTGGAAAGGAGAATGTGACTGG + Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
958044437 3:88266693-88266715 GTAGGAGAGGGGCTTCTGGCAGG - Intergenic
959861579 3:111222130-111222152 GTTGGAAATGGGATGCTGGGGGG + Intronic
960887811 3:122414711-122414733 GGTGGAAAGTGGATTGTGTCTGG - Exonic
960918732 3:122724691-122724713 CTTGGAGAGGGGGATGTGGCAGG + Intronic
961062364 3:123841687-123841709 GGTGGAAAGGAAATTGTGGCAGG - Intronic
961146007 3:124593859-124593881 GTTTGGCAGGGGAATGTGGCGGG - Intronic
964487395 3:157199961-157199983 GATGGAAAGCTGATTGTGGTGGG + Intergenic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
966090001 3:176122253-176122275 GTTGAGGAGGGGATTTTGGCTGG - Intergenic
967276813 3:187784285-187784307 GTTTGAAAAGGTCTTGTGGCTGG + Intergenic
968254946 3:197261257-197261279 TTTGTATAGGGGAGTGTGGCTGG - Intronic
968894257 4:3389604-3389626 GTGGGTGAGGGGATTCTGGCAGG - Intronic
969289506 4:6229725-6229747 GTTGGGATGGGGATGGAGGCTGG - Intergenic
969353043 4:6609240-6609262 GTGGAAATGGAGATTGTGGCGGG + Exonic
969829795 4:9786046-9786068 CTTGGAAATGGGATTGTTCCTGG + Intronic
969911360 4:10449733-10449755 GTTGGTAAGCAAATTGTGGCAGG - Intronic
971026905 4:22597990-22598012 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
971713578 4:30148235-30148257 GTGGGAAAGCGGGTTGTTGCGGG - Intergenic
971730287 4:30370372-30370394 GCTGGAAAAGGGATGGTGCCGGG - Intergenic
974848943 4:67382319-67382341 CTTGGAGAGGGGGTTGTGGCAGG - Intergenic
976310542 4:83607501-83607523 GTGGGGAAGGGTGTTGTGGCAGG + Intergenic
976879976 4:89909350-89909372 GTGGGAAAGGACCTTGTGGCTGG + Exonic
977950170 4:102961888-102961910 GTTGCCAAGTGGATGGTGGCAGG + Intronic
978991916 4:115094648-115094670 TTTGGAAATAGGATTGTTGCAGG + Intronic
979222106 4:118239293-118239315 GTTGGAAAAGGTTTTGTGGCAGG + Intronic
981178753 4:141714426-141714448 GAAGGAAAGGGGGTTGTTGCAGG - Intronic
982845849 4:160251716-160251738 GTTGGAGGGGGGATGGCGGCAGG - Intergenic
985180898 4:187261142-187261164 ATTGGAAGGGGGATTTTGACTGG - Intergenic
985769988 5:1803440-1803462 GGTGGAGAGGGGCTTGTGTCTGG + Intronic
989085558 5:37672668-37672690 CTTGGCAAGGGGAATGTGGCAGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989667652 5:43874672-43874694 GTAGGAATGGGGTTTGTGGCTGG + Intergenic
989826566 5:45863855-45863877 TTTGGAAAGGAGATAGTGGGAGG - Intergenic
989991592 5:50773879-50773901 CTTGGAGAGGGGGATGTGGCAGG + Intronic
991338679 5:65580461-65580483 GTTGGAGAGAGGTGTGTGGCTGG - Intronic
993306242 5:86278938-86278960 CTTGGAATGGGGCTTGTGGGAGG + Intergenic
997402845 5:133615913-133615935 GATGGAAAGGGAATTGTGAATGG + Intergenic
997917046 5:137937437-137937459 GTTGGAAAGTTGTGTGTGGCTGG + Intronic
998424000 5:142012129-142012151 CTTGGGAAGGGGATTGTTGCTGG - Exonic
1000064925 5:157686155-157686177 CTTGGCAAGGGGAATGCGGCAGG + Intergenic
1002118767 5:176985045-176985067 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1002415114 5:179116296-179116318 GTTGGAAAGGGGAAAGGGACAGG - Intronic
1002917300 6:1539739-1539761 CCTTGAAAGGTGATTGTGGCCGG - Intergenic
1005247174 6:23900542-23900564 ATTTGAAAGGGCATTCTGGCAGG + Intergenic
1005421933 6:25660259-25660281 GGTGGAAAGAGAATTGTGGTGGG - Intronic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1006665067 6:35688219-35688241 GCTGTGAAGGGGATGGTGGCGGG - Intronic
1007414758 6:41684853-41684875 GATGGAATGGGGATGGTGGCTGG + Exonic
1008415608 6:51236600-51236622 GATGGACAGGGGAGTGGGGCAGG - Intergenic
1009002752 6:57739275-57739297 GTTGGAAAGTGGAGGGTGGGAGG + Intergenic
1009532244 6:64833007-64833029 GTTGGAATGGGGAATGTGGCAGG - Intronic
1010323203 6:74537696-74537718 CTTGGAATGGGGATTGTGGGTGG + Intergenic
1012390002 6:98727797-98727819 GTTGGTAAGGGGAGTGAGGCGGG - Intergenic
1012944916 6:105455161-105455183 GTGGGAAAGGTGATTGTGAAAGG - Intergenic
1014157637 6:118129558-118129580 TCTAGAAAGGGGATGGTGGCTGG + Intronic
1014872956 6:126619021-126619043 TTTGGAAAGAGGATGGTGACAGG + Intergenic
1015962794 6:138668149-138668171 GTTAGAAAAGAAATTGTGGCTGG + Intronic
1017102620 6:150862218-150862240 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
1018398066 6:163396038-163396060 GTTGGAAAGATGACTGTTGCTGG + Intergenic
1020453878 7:8349937-8349959 GTTGGAAAGGTTATTGTGCCAGG - Intergenic
1021210669 7:17848250-17848272 GCTGAAAAGGGGAATGGGGCGGG - Intronic
1021995519 7:26175901-26175923 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1023083787 7:36550021-36550043 GTGGTAACGGGGATTGGGGCAGG - Intronic
1024728431 7:52228034-52228056 TTTGGAGAGTGGATTGTGCCTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026674848 7:72419884-72419906 GCTGGAAAGGGGATGGTGTGGGG - Intronic
1026708932 7:72719768-72719790 GCTGAAAAGGGGAGTGTAGCTGG + Intronic
1026857858 7:73766791-73766813 CATAGAAAGGGAATTGTGGCTGG - Intergenic
1027138729 7:75641888-75641910 GTGGGAGCGGGGATTGTTGCTGG - Intronic
1028564700 7:92216555-92216577 GTTGGAAATGTTATTGTGGTAGG + Intronic
1028951719 7:96643969-96643991 GTTGGGAATGGGCTTGGGGCAGG - Intronic
1030568776 7:111194575-111194597 TGTGGACTGGGGATTGTGGCAGG - Intronic
1031688767 7:124764380-124764402 CTTGGACAGGGGCTTGTGGTGGG + Exonic
1033230530 7:139594002-139594024 GATGGAAAGGGGGTTGGGGAGGG - Intronic
1033669646 7:143478769-143478791 GTTGGCAAGGGGCTTCTGGGTGG + Exonic
1033673233 7:143512480-143512502 GAGGGAAAGGGGATTGTTGAAGG + Intergenic
1033943280 7:146681601-146681623 GTGGGAAAGGGGAGAGTGGGAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034483522 7:151341690-151341712 CTTGGAAAGAGGGTTGTGGGCGG - Exonic
1035524328 8:300536-300558 GTGGGAGAGGGGCTTGAGGCAGG + Intergenic
1035528310 8:331956-331978 GCTGGAAAGGGGAGTGTGTTTGG + Intergenic
1037417950 8:18671447-18671469 CTTGGAAAGAGAGTTGTGGCTGG - Intronic
1037829172 8:22177958-22177980 GTGGGAGACGGGATTGGGGCTGG + Intronic
1037892293 8:22629723-22629745 GGTGGGAAGGGGGTGGTGGCAGG + Intronic
1038340744 8:26683175-26683197 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
1044617217 8:94154936-94154958 GCGGGAAAGGGGATTCTGGAAGG - Intronic
1045251361 8:100485785-100485807 GCTAGAAAGGGGGTTGTGACTGG - Intergenic
1046703812 8:117428014-117428036 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1048142778 8:131810984-131811006 GTTGGAAAGGGAACTTTGGCTGG + Intergenic
1048302551 8:133262139-133262161 GTTGAAGAGGGGGTTGTAGCAGG + Exonic
1048420966 8:134277966-134277988 GCTGGAACGGGGGTTGTTGCAGG + Intergenic
1049517325 8:143067661-143067683 CTTGGCGAGGGGAGTGTGGCAGG + Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049893278 9:90889-90911 CTTGGAAAAGGGATTGGGGCAGG - Intergenic
1050164065 9:2746109-2746131 TTTGGAAAGAGGGTTTTGGCAGG + Intronic
1051879696 9:21827232-21827254 ATTGGATGGGGGATTGTGGAAGG - Intronic
1053562237 9:39208568-39208590 GTTTGAAAGGTGATAGCGGCTGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054134881 9:61410390-61410412 GTTTGAAAGGTGATAGCGGCTGG - Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1055585503 9:77755225-77755247 GCTGGAAAGGGTAGTGGGGCTGG + Intronic
1056211297 9:84367645-84367667 CTCGGCAAGGGGAGTGTGGCAGG + Intergenic
1057685752 9:97232886-97232908 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1058876998 9:109252925-109252947 TTTGGAAAGGGGAAGGGGGCAGG + Intronic
1059460032 9:114423814-114423836 ATTGGAAAGGGTATTCTGGGTGG - Intronic
1061065832 9:128276813-128276835 GTTGGGATGGGGAGTGGGGCCGG - Intronic
1061448906 9:130658316-130658338 GGTGAAAAGGTGCTTGTGGCTGG - Intergenic
1061935858 9:133857269-133857291 GTGGGAGAGGGGTTTGTGGAAGG - Intronic
1062166675 9:135111288-135111310 GTTGGGGAGGGGATTTGGGCAGG + Intronic
1185551776 X:987701-987723 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1185593280 X:1292480-1292502 CTTGGCAAGGGGAATGTGGCAGG + Intronic
1185682454 X:1899679-1899701 CTTGGCAAGGGGAGTGTGGCAGG + Intergenic
1186075139 X:5870257-5870279 GTTGGACATGAGATTTTGGCAGG + Intronic
1186795099 X:13039489-13039511 GTTGGACAGGGCATAGAGGCAGG - Intronic
1188565395 X:31520974-31520996 GTTGAAAAGAGCATTGCGGCCGG - Intronic
1188580037 X:31700384-31700406 GTTGGAAATGGAATTTAGGCAGG + Intronic
1190227257 X:48555723-48555745 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1190736826 X:53261004-53261026 GTTGCAAAGGGAATAGTGGCAGG + Intronic
1191156783 X:57283104-57283126 GATGGGAAGGGGATTGCGGAGGG + Intergenic
1194802019 X:98285788-98285810 GGTAAAAAGGGAATTGTGGCAGG + Intergenic
1195218449 X:102722827-102722849 GCTGGAAAGGGTATTGGGGATGG + Intronic
1197519565 X:127480611-127480633 GCTGGAAAGGGTATTGAGGTGGG - Intergenic
1198062710 X:133062731-133062753 TTTGGAAGGGGTTTTGTGGCGGG - Intronic
1200094618 X:153651415-153651437 GGTGGAAAGGGGCATGTGCCAGG + Intergenic
1201282384 Y:12352875-12352897 CTTGGAGAGGGGAATTTGGCAGG - Intergenic