ID: 1121121253

View in Genome Browser
Species Human (GRCh38)
Location 14:91377129-91377151
Sequence CAGGGCAGGCAGTCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 422}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121121253_1121121261 -4 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121261 14:91377148-91377170 CCTGAGCTTTTCTCAGGAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 218
1121121253_1121121265 2 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121265 14:91377154-91377176 CTTTTCTCAGGAGGAGGGGGTGG 0: 1
1: 0
2: 2
3: 46
4: 478
1121121253_1121121263 -2 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121263 14:91377150-91377172 TGAGCTTTTCTCAGGAGGAGGGG 0: 1
1: 0
2: 7
3: 32
4: 309
1121121253_1121121269 22 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121269 14:91377174-91377196 TGGCAGTGGCCACTGAGGGCTGG 0: 1
1: 2
2: 6
3: 51
4: 471
1121121253_1121121266 8 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121266 14:91377160-91377182 TCAGGAGGAGGGGGTGGCAGTGG 0: 1
1: 1
2: 14
3: 222
4: 2269
1121121253_1121121256 -10 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121256 14:91377142-91377164 GCCTGCCCTGAGCTTTTCTCAGG 0: 1
1: 1
2: 0
3: 26
4: 257
1121121253_1121121264 -1 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121264 14:91377151-91377173 GAGCTTTTCTCAGGAGGAGGGGG 0: 1
1: 0
2: 2
3: 32
4: 295
1121121253_1121121262 -3 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121262 14:91377149-91377171 CTGAGCTTTTCTCAGGAGGAGGG 0: 1
1: 0
2: 3
3: 24
4: 342
1121121253_1121121268 18 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121268 14:91377170-91377192 GGGGTGGCAGTGGCCACTGAGGG 0: 1
1: 1
2: 1
3: 54
4: 404
1121121253_1121121267 17 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121267 14:91377169-91377191 GGGGGTGGCAGTGGCCACTGAGG 0: 1
1: 1
2: 7
3: 81
4: 620
1121121253_1121121258 -7 Left 1121121253 14:91377129-91377151 CCCACCTCAGACTGCCTGCCCTG 0: 1
1: 1
2: 5
3: 33
4: 422
Right 1121121258 14:91377145-91377167 TGCCCTGAGCTTTTCTCAGGAGG 0: 1
1: 0
2: 2
3: 29
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121121253 Original CRISPR CAGGGCAGGCAGTCTGAGGT GGG (reversed) Intronic
901020800 1:6254417-6254439 GAGGGCAGGCAGGCTCAGGAGGG - Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
901839097 1:11942803-11942825 CAGGGCTAGGGGTCTGAGGTGGG - Intronic
902124941 1:14201514-14201536 CAGGACAGACTGGCTGAGGTGGG - Intergenic
902275255 1:15334966-15334988 AAGAGCAGGGAGTTTGAGGTTGG - Intronic
902611974 1:17602904-17602926 TAGGACAGGAAGTCTGAGGGTGG + Intronic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
903731010 1:25495243-25495265 CAGAGCACACAGTCTGAGCTGGG - Intronic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
904164735 1:28546807-28546829 GAGGGCAGGGAGGCTGAGGTGGG + Intergenic
904327844 1:29739072-29739094 CAGGACAGGGAGTCAAAGGTGGG - Intergenic
904492961 1:30871611-30871633 CTGGGCAGGTGGGCTGAGGTTGG + Intronic
904532599 1:31179477-31179499 CAGGGCCGGGAGGCTGAGGAAGG - Intergenic
904873675 1:33637036-33637058 CAGGGCAGACAGTCTGCTTTTGG + Intronic
905607901 1:39320177-39320199 AACGGCAGGCAGTCAGATGTGGG - Intronic
905858232 1:41329232-41329254 GTGGGCAGGGAGTCTGTGGTGGG + Intergenic
905868888 1:41391731-41391753 CAGGGGAGGAAGACAGAGGTGGG + Intergenic
905986114 1:42284074-42284096 TAGGGTAGGCAGTCTGCGGCTGG - Intronic
906318516 1:44803047-44803069 CCGGGCAGGCAGTGAGAGGCTGG - Exonic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
908063342 1:60375166-60375188 GAGTCCAGGCAGTATGAGGTGGG + Intergenic
908572890 1:65427445-65427467 CAGGGTTGGGAGGCTGAGGTGGG + Intronic
910136094 1:83971783-83971805 CAGGACAGGGAGACTGAAGTGGG - Intronic
910401210 1:86839877-86839899 CAGGGAAGGCATTGTGACGTAGG + Intergenic
911097376 1:94065608-94065630 CAGGGCATGGAGGCTGAGGTGGG - Intronic
911163574 1:94705853-94705875 AAGGGCTGGCAGTTTGAAGTGGG - Intergenic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
912624657 1:111197241-111197263 CAGGGCCGGCAGGCTGGGGAGGG + Exonic
914446257 1:147753096-147753118 CAGGGAAGGGAGTCTGACATGGG - Intergenic
915512051 1:156391826-156391848 CATTACAGGCAGTGTGAGGTGGG - Intergenic
915637383 1:157196036-157196058 CAGGGGAGGGAGGCTGAGATGGG + Intergenic
916007836 1:160678109-160678131 AAAGGCAAGCAGTCTGTGGTGGG + Intergenic
916860843 1:168803382-168803404 CATGGCAGGTAGTAAGAGGTAGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917978334 1:180254264-180254286 CAAGGCAGGCAGGCAGAGATGGG + Intronic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
919746010 1:201009548-201009570 CTTGGCAGGCAGTGTGAGGGAGG - Intronic
919806987 1:201386150-201386172 CAGAGCAGGGAGGCTGAGATGGG - Intronic
920061379 1:203229201-203229223 CAGGACAGACAATATGAGGTTGG + Intronic
921359021 1:214313361-214313383 CAGGGCAGGGAGGCTGACATGGG - Intronic
921403015 1:214747151-214747173 CAGGGCAGTCAGTGTGTGGGAGG - Intergenic
921714096 1:218400851-218400873 CAGGGAAGGCAGGGTGAGATTGG + Intronic
922056106 1:222043865-222043887 CAGGGCAGGCACTCAGACCTGGG + Intergenic
922794037 1:228330279-228330301 CAGGGAAGGGAAACTGAGGTAGG - Intronic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
923384377 1:233452086-233452108 CAAGGCCAGCAGACTGAGGTAGG + Intergenic
923458258 1:234185170-234185192 CAGGAAAGGCATTCTGGGGTGGG + Intronic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
1063679292 10:8171905-8171927 CAGGGCAGGAAGGCAGAGGCAGG - Intergenic
1064331878 10:14401768-14401790 CAGGGCAGGCTTCCTGAGGGAGG - Intronic
1065973551 10:30823712-30823734 CAGGGGAGACAGGCTGAGCTGGG - Intronic
1068003356 10:51363299-51363321 CTGGGCAGCCAGTCTGAAGGGGG - Intronic
1069815852 10:71193893-71193915 CAGAGCTGGGAGCCTGAGGTGGG - Intergenic
1070539085 10:77403302-77403324 CGGGCCAGGCAGCCTCAGGTGGG + Intronic
1070693957 10:78548032-78548054 CAGGGCAGAAGGTTTGAGGTAGG - Intergenic
1071547640 10:86540371-86540393 CAGGACAGGGATTCTGAGGTTGG + Intergenic
1072159987 10:92757135-92757157 CAGGGCAGCCAGTCCCAGGCTGG + Intergenic
1072685122 10:97532041-97532063 CCTGGCAGGCAGTTGGAGGTGGG + Intronic
1072794687 10:98345653-98345675 CTGGGCATGGAGGCTGAGGTAGG - Intergenic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1073461251 10:103667184-103667206 CAGGGGAGGCAGTGTGGGCTGGG - Intronic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1074146564 10:110721864-110721886 CAGAGCAGGCAGTCTCTGGGGGG + Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076008796 10:126969742-126969764 CAGGGAAGGGAGTGTGTGGTGGG + Intronic
1076824744 10:132961184-132961206 CAGGGCCTGCAGCCTGAGGCTGG - Intergenic
1077034781 11:489367-489389 CAGAGCCGGCAGCCTGAGGAAGG - Intronic
1077189948 11:1251792-1251814 CAGGACAGGCAGACCCAGGTTGG - Intronic
1077411601 11:2406346-2406368 CAGGGCAGGCAGTCGGGGACAGG + Intronic
1077474869 11:2781557-2781579 CAGGGCTGGCAGTCTGTGTGGGG + Intronic
1077601135 11:3575732-3575754 CAGGGCTGGCAGTGTCAGGCAGG - Intergenic
1078856805 11:15212344-15212366 GAGGTCAGGGAGGCTGAGGTGGG - Intronic
1079724827 11:23867780-23867802 TAGGGCCAGCAGACTGAGGTGGG - Intergenic
1081400818 11:42640724-42640746 CAAGGCAGGCAGTTTGAGACTGG + Intergenic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1082000861 11:47393168-47393190 CTGGCCAGGCAGTGGGAGGTGGG + Intergenic
1082270000 11:50160156-50160178 CAGGGCTGGGAGTGTGTGGTGGG + Intergenic
1082764545 11:57156563-57156585 GAGGGCAGGCAACCTGGGGTGGG + Intergenic
1083611909 11:64008369-64008391 CAGGTGAGGGAGTCTGCGGTGGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083870286 11:65483401-65483423 CAGGCCAGGCAGTAAGAGGGTGG - Intergenic
1083964259 11:66033476-66033498 CAGGGATGCCAGGCTGAGGTGGG + Intergenic
1084110684 11:67012440-67012462 TAGCTCAGTCAGTCTGAGGTGGG - Intronic
1084113805 11:67030318-67030340 CAGGGCGGGCTGTCTGACCTTGG - Intronic
1084278990 11:68074044-68074066 CAGGGCATGGAGTCAGGGGTGGG + Intronic
1084425543 11:69081989-69082011 AGGGGCAGGCAGGCAGAGGTCGG + Intronic
1084862538 11:72029615-72029637 GACAGCAGGGAGTCTGAGGTGGG + Intronic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1086997330 11:93372921-93372943 CAGCTCAGACAGTCGGAGGTGGG - Intronic
1087019685 11:93589642-93589664 CAGGCCAGGGAGTGGGAGGTGGG + Intergenic
1087367055 11:97233380-97233402 CAGGGCATGGTGGCTGAGGTGGG - Intergenic
1088480465 11:110291911-110291933 CAAGGCAGGAAGTCTGAGGCAGG + Intronic
1089076082 11:115739948-115739970 CAGGGCAGGCAGACTCAGAAGGG - Intergenic
1091020150 11:132092314-132092336 GAGGCCAGGCACTCTGAGGAAGG - Intronic
1091077058 11:132629066-132629088 CAGGGCAAGCAGGCTTAGGATGG - Intronic
1091553559 12:1554790-1554812 CAGGGGTTGCAGTCTGAGTTTGG + Intronic
1092097880 12:5859266-5859288 CAGGCCTGTCAGTCTAAGGTAGG + Intronic
1092914519 12:13177967-13177989 CAGTGTAGCCAGGCTGAGGTTGG + Intergenic
1095548976 12:43410265-43410287 CAGAGGAGGCAGACTGGGGTTGG + Intronic
1096526217 12:52211871-52211893 TAGAGCAGGCAGTCTGAGGTGGG + Intergenic
1096538046 12:52287852-52287874 GAGGGCTGCCAATCTGAGGTTGG - Intronic
1096652184 12:53067269-53067291 GAGGGCAGGCAGGGGGAGGTGGG + Intronic
1096759836 12:53831995-53832017 CAGGGCCTGCAGTATGAGCTGGG - Intergenic
1097193770 12:57232841-57232863 CAGGTCAGGCTCCCTGAGGTCGG + Exonic
1097316774 12:58180156-58180178 CGAAGCAGGCTGTCTGAGGTGGG + Intergenic
1097629880 12:62047769-62047791 GAAGGCAGGTAGACTGAGGTAGG - Intronic
1097712910 12:62934802-62934824 CGGGGCATGCAGGCTGCGGTGGG + Exonic
1098264538 12:68705596-68705618 GAAGGCAGGCAGGCTGAGCTAGG - Intronic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1099860383 12:88218497-88218519 CAGTGCAGTCAGCCTGAGGTGGG - Intergenic
1101458867 12:104868456-104868478 CAGGGCAGTGATTCTGGGGTGGG - Intronic
1101817957 12:108160224-108160246 CAGAGCCTGCAGTCTGAGGGTGG + Intronic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1103528424 12:121582729-121582751 CAGGGCAGGCATTCTGGGGGAGG - Intergenic
1103573039 12:121857509-121857531 TAGGGCAGGCAGGCTGAGGGGGG - Intronic
1103897124 12:124280063-124280085 CAGAGCAGGCAGGCTCAGGCTGG - Intronic
1104768748 12:131346788-131346810 CAGGGCAGGCATTTAGAGGAAGG - Intergenic
1105927178 13:25018619-25018641 CAAGTCAGGCAGTCTGCGGCAGG - Intergenic
1108242109 13:48475526-48475548 CAGAGCAGGGACTCTGAGGGAGG + Intronic
1109400162 13:61816881-61816903 CAGGTCAGGCAGGCTGCTGTTGG - Intergenic
1111611035 13:90607067-90607089 CAAGGCAGACCTTCTGAGGTCGG + Intergenic
1112279846 13:98053347-98053369 CTTGGGAGGCAGGCTGAGGTGGG - Intergenic
1113443496 13:110347640-110347662 CAGGGCATGCAGTGTGTGGTGGG - Intronic
1113542829 13:111122285-111122307 CAGGGCCGGGAGTCAGAGATGGG + Intronic
1116446988 14:45021998-45022020 CAGAGCAGGCCATGTGAGGTGGG + Intronic
1117124440 14:52606548-52606570 CAGCCCTGGGAGTCTGAGGTGGG - Intronic
1118164372 14:63321580-63321602 CAGGGAAGGCAGTCCCACGTGGG + Intergenic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119543678 14:75456850-75456872 GAGAGCAGGCTGTCTGAGGAGGG + Intronic
1120646486 14:87080590-87080612 CAGGGCAGGAAGTCTTACATAGG - Intergenic
1121121253 14:91377129-91377151 CAGGGCAGGCAGTCTGAGGTGGG - Intronic
1122192540 14:100057568-100057590 CAGAGCAGGCAGGCTTAGGCAGG + Intronic
1122314580 14:100818184-100818206 CAAGCCAGGCTGTCTGAGTTGGG + Intergenic
1123994868 15:25711437-25711459 AAGGGCAGGCGGTCACAGGTGGG + Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1126055684 15:44727800-44727822 CAGGCTTGGCAGACTGAGGTGGG + Intergenic
1126208749 15:46075955-46075977 CAGGGAAGGCAGTGTGAGTGTGG + Intergenic
1126215172 15:46146219-46146241 CATGGCAGGGAGGTTGAGGTGGG + Intergenic
1126319620 15:47407973-47407995 GAAGACTGGCAGTCTGAGGTTGG + Intronic
1126928734 15:53622609-53622631 CAGTGGGGGCAGTCTGAGGAGGG + Intronic
1126994550 15:54425833-54425855 TAGGTCAGGAAGTCTGATGTGGG + Intronic
1128276370 15:66357026-66357048 CGGGGAAGGGAGGCTGAGGTGGG - Intronic
1129276303 15:74447953-74447975 CAGGGAAGGGGGTTTGAGGTAGG - Intronic
1129694161 15:77731139-77731161 CCTGGCAGGCAGGCTGGGGTGGG + Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129798751 15:78397471-78397493 CAGGGCAGGAAGTCTGGGGTTGG + Intergenic
1130008492 15:80126994-80127016 CTGGGTAGGGAGGCTGAGGTGGG + Intronic
1130552404 15:84898822-84898844 CAGGGAAGGAAAACTGAGGTGGG + Intronic
1131005534 15:88974429-88974451 CAGGGCAGACGGTGAGAGGTTGG - Intergenic
1132518052 16:375052-375074 CAGGCCGGGCTGCCTGAGGTTGG - Intronic
1132556938 16:576654-576676 CAGGGCAGGAAGTCCCAGCTGGG - Intronic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1132715696 16:1288934-1288956 CAGGGCTGGCACTCTGAGCCCGG + Intergenic
1132758803 16:1499076-1499098 CAGCTCAGGCAGTCGGAGGATGG + Intronic
1132944689 16:2526442-2526464 CAGGGCAGGCACTCTTCCGTTGG + Intronic
1133734858 16:8607334-8607356 CAGGGGAGGCAGCGTGATGTGGG - Intergenic
1133866437 16:9648116-9648138 CTGGGCAGGAAGTGTGAGATGGG + Intergenic
1133900662 16:9971093-9971115 AAGAGCAGACAGTATGAGGTGGG + Intronic
1134017804 16:10901564-10901586 CAGGGCAGGTGGGCTGGGGTTGG + Intronic
1136079373 16:27841474-27841496 CTGGGCAGGAAGACAGAGGTGGG + Intronic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1139435853 16:66935973-66935995 CCGGGTAGGCAGCCTGGGGTCGG + Intronic
1139558131 16:67725552-67725574 CAAGGCAGGCAGTGGGAGGTGGG + Exonic
1139655212 16:68383307-68383329 GAGGGCAGGCAGCCTCAGGTGGG - Intronic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1142154692 16:88527699-88527721 CAGGGACGGCAGCCAGAGGTGGG - Intronic
1142189408 16:88710926-88710948 CAGCTCAGGAAGTCTGAGGCAGG + Intronic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1143836884 17:9699957-9699979 GAGGGGAGGCACTGTGAGGTTGG + Intronic
1144944566 17:18963342-18963364 CAGGGCAGCAGGGCTGAGGTTGG - Intronic
1145910667 17:28540314-28540336 CAGGGCTGGTGGGCTGAGGTAGG + Intronic
1146373797 17:32281189-32281211 CAGGGCAGGCAGGCCCTGGTGGG + Intronic
1146579734 17:34026243-34026265 CAGGGCAGGCATACTGCTGTTGG - Intronic
1147314095 17:39611300-39611322 CAGAGAAGGAGGTCTGAGGTTGG + Intergenic
1147387198 17:40089615-40089637 CAGGGCTGGAGGTCTGAGGAGGG - Intronic
1147855952 17:43480178-43480200 GAGGGCAGGCAGATTGGGGTTGG - Intergenic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1148717352 17:49725157-49725179 CCGGGCAGGCCGTCTTAGATCGG - Intronic
1148776217 17:50096948-50096970 CAGGCCAGGCTGGGTGAGGTGGG + Intronic
1149776069 17:59358205-59358227 CTGGGCAGTCCTTCTGAGGTTGG + Intronic
1150226425 17:63527076-63527098 CAGGAAAGGCAGGCTGGGGTGGG - Intronic
1150288099 17:63965425-63965447 CAGGGAAGGCAGGCTGAGCCTGG - Intronic
1150617658 17:66784747-66784769 CAGGGCAGGCAGGCAGTGGTGGG - Intronic
1151437457 17:74106794-74106816 CTGGCCAGGCAGTCTCAGGGAGG - Intergenic
1151613356 17:75191532-75191554 CAGGCCTGGCAGGCTGAGTTGGG + Intergenic
1152344597 17:79743311-79743333 CAGGTGGGGCAGGCTGAGGTGGG - Intergenic
1152381089 17:79942551-79942573 CAGGCCAGGCCTTCTGAGGAAGG - Intronic
1152925762 17:83087073-83087095 CAGAGCAGGCATTCGGCGGTGGG + Intronic
1153229725 18:2924325-2924347 AGGGGCAGGCAGTGTGTGGTGGG - Intronic
1153480819 18:5544124-5544146 GAGGGCAGGCAGGACGAGGTTGG - Exonic
1153591940 18:6683344-6683366 CTGGGCAGGCAGTGGAAGGTGGG + Intergenic
1155047237 18:22113630-22113652 CTGGGCATGCAGCCTGAGGCTGG + Intergenic
1155934885 18:31743782-31743804 CAGAGCAGGCTGTCAGAGGCTGG + Intergenic
1156485661 18:37464020-37464042 CAGGGAGGGCAGCCTGAGTTCGG - Intronic
1156727573 18:40148009-40148031 CAGGCCACGCAGCCGGAGGTGGG - Intergenic
1157010259 18:43639778-43639800 CAGCTCAGTCATTCTGAGGTAGG - Intergenic
1157534213 18:48446753-48446775 CAGGGCTGGCAGTCTCGGGCGGG - Intergenic
1157676573 18:49573025-49573047 CAGGGCAGGCAGGCTCTGGCTGG + Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160139523 18:76309234-76309256 CAGATCAGGCACCCTGAGGTGGG - Intergenic
1161041849 19:2114634-2114656 CAGGGTGGGCAGGCTGGGGTGGG - Intronic
1161888910 19:7019488-7019510 CAGGGCCTGCAGTCTCCGGTAGG + Intergenic
1161890458 19:7032533-7032555 CAGGGCCTGCAGTCTCCGGTAGG - Exonic
1161890990 19:7038200-7038222 CAGGGCCTGCAGTCTCCGGTAGG + Exonic
1161892544 19:7051261-7051283 CAGGGCCTGCAGTCTCCGGTAGG - Exonic
1161893075 19:7056661-7056683 CAGGGCCTGCAGTCTCCGGTAGG + Exonic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162799374 19:13102578-13102600 CAGGGCTGGCAGTCTGGGCCAGG + Exonic
1162835745 19:13316511-13316533 CAGGGGAGGAAGTATTAGGTTGG + Intronic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1163382447 19:16977991-16978013 CAGGGAAGGCAGTATGAACTCGG - Intronic
1163756847 19:19111397-19111419 CAGGGCCGGCAGGGTGGGGTGGG - Exonic
1163775175 19:19213138-19213160 CAGGGCAGGCAGGAAGGGGTGGG + Intronic
1164835245 19:31351455-31351477 CGGGGCAGGGAGTCCGAGGCGGG + Intergenic
1165321691 19:35089324-35089346 CAGGTCAGGCATTCTGAGGGTGG - Intergenic
1165350429 19:35272279-35272301 CAGTGCAGGCAGTCACAGGCAGG + Intronic
1165757690 19:38304013-38304035 CAGGGGAGGCCGACTGAGGGGGG - Intronic
1166068653 19:40375204-40375226 GAGGGCAGGAAGCCTGAGGCAGG + Intronic
1166356166 19:42228895-42228917 CAGGGCAGGCAGAATGCAGTTGG + Intergenic
1166393131 19:42421207-42421229 CAGGGCAGGCAGTTTAAGAGAGG - Intronic
1166441237 19:42817027-42817049 CAGGGCAGGAAGTGAGAGTTTGG + Intronic
1166478008 19:43145607-43145629 CAGGGCAGGAAGCCAGAGTTTGG + Intronic
1166562072 19:43739518-43739540 GAGGATAGGCAGTCTGAGGGAGG + Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166783012 19:45352106-45352128 GAGGACAGGCAGGCTGAGGGTGG + Intronic
1166856934 19:45786876-45786898 CAGGGGAGACAGTGTGGGGTTGG + Intronic
1167081066 19:47276293-47276315 CTGGGCAAGGAGTCCGAGGTGGG + Intergenic
1168510064 19:56966982-56967004 CTGGGCAGGCTGTTTTAGGTAGG + Intergenic
924960011 2:26342-26364 CAGGGCAGGCAGGCTTAGGCTGG + Intergenic
925429446 2:3778455-3778477 GAGGGCAGGCAGGCTGTGGAGGG + Intronic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
926341251 2:11906487-11906509 CAGGGCAGGAAGTGCTAGGTAGG + Intergenic
926890825 2:17637547-17637569 CAGGGGAGGCATCCTGGGGTGGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928170981 2:29002826-29002848 CAGGGCATGGAGTCAGGGGTTGG - Intronic
928419450 2:31126485-31126507 CACGGCCGGCATTCTTAGGTTGG - Intronic
929053447 2:37856770-37856792 TCGGGCAGGCAGACTGAGTTTGG - Intergenic
930252073 2:49045537-49045559 AAGGGAAGGCAGACAGAGGTAGG + Intronic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
931400867 2:61930144-61930166 CAGGACAGTCAGTCTTTGGTTGG + Intronic
931554220 2:63482121-63482143 CAGAGGATGCAATCTGAGGTTGG - Intronic
931951519 2:67368629-67368651 CTTGGAAGGCAGTCTGAGATGGG - Intergenic
932550350 2:72763649-72763671 CAGGGCAGATTGTTTGAGGTAGG - Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933743625 2:85554006-85554028 CAGGGCAGTCACTATGAAGTAGG - Intronic
933769517 2:85734216-85734238 CAGGACAGGCTGCCTGAGGTTGG + Intergenic
934074593 2:88416912-88416934 CCCGGCAGGCAATCAGAGGTAGG + Intergenic
934496158 2:94801697-94801719 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
934605828 2:95694498-95694520 CAGTGCAGGAAGTGTAAGGTAGG + Intergenic
934636301 2:95992406-95992428 CAAGTCAGGCAGTCTGCGGCAGG - Intergenic
934735528 2:96687974-96687996 CAGGGCAGGCACGCGGGGGTGGG + Intergenic
934763223 2:96867575-96867597 CTGGGCAGGCAGTCTGGGGTGGG + Intronic
934797342 2:97113020-97113042 CAAGTCAGGCAGTCTGCGGCAGG + Intergenic
934836063 2:97590419-97590441 CAAGTCAGGCAGTCTGCGGCAGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936947798 2:117946188-117946210 CAGGGCATGCGGTCTGGCGTGGG + Intronic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
937577733 2:123444509-123444531 CAAGGCCAGCAGACTGAGGTGGG + Intergenic
937737942 2:125314011-125314033 CAAGGCATGCTGGCTGAGGTGGG - Intergenic
937772670 2:125739323-125739345 CATAGCAGGGAGGCTGAGGTGGG - Intergenic
937863938 2:126733714-126733736 CAGGACAGGCATTCTGGGGCAGG + Intergenic
937870597 2:126783271-126783293 CAGAGCTGGCAGTATGAGTTGGG + Intergenic
937952912 2:127402009-127402031 AAGGGAAGGCAGGCTGAGGTGGG - Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
938695652 2:133833151-133833173 CATGGCAGGCACTCTGTAGTTGG - Intergenic
940863279 2:158791678-158791700 CAGGGCAGGAAGGCTGTGCTGGG + Intergenic
941159825 2:162023624-162023646 AAGGGCAGGCAGACTGGGGAAGG - Intronic
941259608 2:163280395-163280417 CAAGCCAGGCGGCCTGAGGTCGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941645822 2:168039990-168040012 TAGGGTAGGGAGTCTGAGGTAGG - Intronic
941747730 2:169104804-169104826 AAGGTCTGCCAGTCTGAGGTTGG + Intergenic
942109287 2:172664081-172664103 GAGGGCAGATAATCTGAGGTAGG + Intergenic
945333684 2:208567244-208567266 CAGGGCCAGCAGACTCAGGTGGG - Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947486004 2:230549600-230549622 CACAGCTGGCAGTCTGAGGTGGG + Intergenic
948648612 2:239424848-239424870 CCAGGCAGGAAGGCTGAGGTTGG - Intergenic
1169023466 20:2348018-2348040 CAGGGCAGGCTCTCTGACGGTGG + Intergenic
1169135559 20:3195118-3195140 CTGGCCAGGCAGTGAGAGGTGGG - Intronic
1169423065 20:5474989-5475011 CAGGGCAGGGAGCCTCAGATGGG + Intergenic
1169522342 20:6387287-6387309 CAGGGCCAGTAGACTGAGGTGGG - Intergenic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171461256 20:25299287-25299309 CTTGGGAGGCAGGCTGAGGTGGG + Intronic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1173250547 20:41362200-41362222 AAGGGGATGCTGTCTGAGGTTGG - Exonic
1173663469 20:44750048-44750070 CCGGGCAGGCAGGCTGCGGGCGG + Intronic
1174115269 20:48222660-48222682 CAGGGCATGCAGTGTCAGATGGG + Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1176002553 20:62839572-62839594 CAGGGCACCCAGGCAGAGGTGGG - Intronic
1176078946 20:63262122-63262144 CAGAGCAGGAAGTGTGAGGAAGG + Intronic
1176115162 20:63429038-63429060 CAGGGCAGGAAGACAGGGGTGGG - Intronic
1177809149 21:25906109-25906131 CAGGCCAGGCATTCAAAGGTGGG + Intronic
1179646525 21:42779424-42779446 CAGGGCAGGGAGTCCCAGGGTGG - Intergenic
1180195519 21:46191416-46191438 CAGGGCGGGGAGTCTGAGCTGGG - Intronic
1180726154 22:17948170-17948192 CAGGGCAGGCAGTGGGAGTGGGG - Intronic
1181610311 22:24007407-24007429 CACGGCAGGCACTCTGAGTGGGG - Intergenic
1183960724 22:41410416-41410438 CAGGGCAGGTAGGGTGAGATGGG + Intergenic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184286738 22:43476252-43476274 CAGTGCTGGCAGGGTGAGGTGGG + Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184922052 22:47612773-47612795 CAGGGAAGGCAGGCTCAGGGCGG + Intergenic
1184968572 22:47998878-47998900 CAGGACAGGCAGGCTGATGGGGG - Intergenic
1185079873 22:48703753-48703775 CAGGGCAGGCTGTGAGAGGGTGG - Intronic
1185141968 22:49107670-49107692 CGAGGCAGGCAGGCTGGGGTGGG - Intergenic
1185217566 22:49610297-49610319 GATGGCTGGAAGTCTGAGGTGGG - Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
950105962 3:10388646-10388668 CAGGGCAGGTAGTAGGTGGTGGG - Intronic
951369402 3:21826643-21826665 CAGAGCAGGCACTCTAAGGGTGG + Intronic
952422446 3:33144318-33144340 CAAAGCAGGCTGTCTGTGGTTGG + Exonic
953133914 3:40166678-40166700 CATGGGAGGCAGTGTGAGGCAGG + Intronic
953565352 3:44027625-44027647 CAGGGCAGGAAGTGAGAGGCAGG - Intergenic
954690437 3:52392742-52392764 TAGGGCAGGCAGGGAGAGGTGGG - Intronic
955900473 3:63748364-63748386 TATGGCAGGCAGACTGATGTGGG - Intergenic
957404163 3:79755497-79755519 AAGGGCAGTCAGTCTCAGGGAGG + Intronic
961010895 3:123435050-123435072 CAGGGCAGGCAGACTGATGGAGG + Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
961516253 3:127439193-127439215 CAGAGCTGGCAGTGAGAGGTGGG + Intergenic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
964332442 3:155618915-155618937 CAGGGTATGCAGGCTGAGTTGGG - Intronic
967154544 3:186680559-186680581 CTGGGCATGGAGGCTGAGGTGGG + Intergenic
968581250 4:1396350-1396372 CAGGGCAGACTGGCTGAGGTTGG + Intergenic
968652399 4:1765451-1765473 CAGGGGTGGCAGTGTGAAGTGGG - Intergenic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969327629 4:6452958-6452980 CACTGCAGGCAGCCTGTGGTTGG + Intronic
970345578 4:15149428-15149450 CAGAGCAGGCAGTCTGATGCGGG - Intergenic
974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG + Intronic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
978291057 4:107141192-107141214 CCCAGCAGGCAGTCTGAGGCTGG - Intronic
978355683 4:107870336-107870358 CAGGGGAGGGAGTTTGAAGTCGG + Intronic
979372686 4:119908117-119908139 TGGGGAAGGCAGTGTGAGGTGGG + Intergenic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
979637954 4:122978527-122978549 GAGGGCAGGCTGTCAGAGCTGGG - Intronic
983682938 4:170374023-170374045 CCAGGCAGGCAGTCTTAGGAAGG - Intergenic
985469693 5:32369-32391 CAGGGCAGGCAGGCTTAGGCTGG + Intergenic
985720093 5:1484443-1484465 CAGGACAGGCGGTCTGAGAAGGG + Intronic
985937865 5:3110487-3110509 CAGGGCAGGCTTTCTGTGCTAGG + Intergenic
985958919 5:3284767-3284789 GTGGGCAGGCAGTGTGAGCTCGG - Intergenic
987093974 5:14532275-14532297 CAGGCCAGGTAGCCTGAGGCTGG - Intergenic
987386989 5:17339274-17339296 CAGGGGAGGCAGTCAGAGTGTGG + Intergenic
988264147 5:28928173-28928195 CAAGTCAGGCAGTCTGCGGCAGG - Intergenic
988417961 5:30970026-30970048 AGGGCCAGGCAGACTGAGGTGGG - Intergenic
990794689 5:59526157-59526179 CAGGGCAAGCAGTCCTAGGAAGG + Intronic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
992209670 5:74465750-74465772 CAGGGCAGGCAGTTCAACGTGGG + Intergenic
992400652 5:76408276-76408298 CAGGGCAGGCAGTTTAATATGGG + Intronic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
995191664 5:109324555-109324577 CAAGGCAGTGAGGCTGAGGTGGG - Intergenic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
995716293 5:115084579-115084601 CTGGGCAGGCTGTCAGAGGCTGG + Intergenic
997376815 5:133403417-133403439 CAGGGCAGGCACTTTGGGGTAGG - Intronic
998801280 5:145872163-145872185 CAAAGCAGGCAGTATGAGGAAGG + Intronic
999405439 5:151302946-151302968 AAGGGCAGACAGCCTGAGATAGG + Intronic
999629897 5:153560135-153560157 CAGGGCAGGAAGTCAGGAGTTGG - Intronic
1000346794 5:160321280-160321302 CAGGGCTGGCAGGCTCAGGGGGG - Intronic
1001518998 5:172377400-172377422 CACAGCAGGCAGTCTCAGCTGGG - Intronic
1001683613 5:173576567-173576589 CAGGGAAGGCCGTGTGATGTTGG - Intergenic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1002098285 5:176844850-176844872 CTGGGCAGGGAGTCTGTGGCTGG - Intronic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1004090306 6:12494251-12494273 CAGGGCAGGAACTATGATGTGGG - Intergenic
1004137098 6:12978116-12978138 CAGGCCAGGCAGGATGCGGTTGG - Intronic
1005715126 6:28539879-28539901 CAGAGCAGGAACTCTGAGCTTGG - Intergenic
1006022213 6:31123955-31123977 CAGAGCAGGCAGCCAGACGTGGG + Intronic
1006361178 6:33588256-33588278 CAGGGCAGGCTGGCTGGGGAGGG - Intergenic
1006511515 6:34524041-34524063 CAGAGCAGGGACCCTGAGGTTGG + Intronic
1006749503 6:36367710-36367732 GGGGGTAGGCAGTGTGAGGTAGG + Intronic
1007099998 6:39239635-39239657 CAGGGGAGGCAGGCTGGGGGAGG - Intergenic
1008137388 6:47792813-47792835 CAGGGCCTGGAGACTGAGGTGGG + Intronic
1008708337 6:54191524-54191546 CAGAGCAGGAAGTATAAGGTGGG - Intronic
1011710109 6:90044449-90044471 AAGGGCATGCAGTTCGAGGTAGG + Intronic
1011794141 6:90934261-90934283 CGGGGCAGGCAGGCTATGGTGGG - Intergenic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1013430433 6:110050460-110050482 TAGGGCAGCCAGTGTGAGGCAGG - Intergenic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1016289058 6:142507382-142507404 CTGGGCAGGCAGTCAGACCTTGG - Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019658181 7:2209200-2209222 CTGGGCAGGCTGGCTGGGGTGGG - Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020715756 7:11673578-11673600 CCAGGCAGGCAGTCTTAGGAGGG - Intronic
1022523345 7:31021903-31021925 CATGGCAGGCTGTCTGAGCCAGG - Intergenic
1022843832 7:34190608-34190630 AAGGTCAGGCAGCCTGAGGATGG - Intergenic
1023158353 7:37274137-37274159 CTTGGCAGGCAGGCTGAGATAGG + Intronic
1023274460 7:38503009-38503031 CAGGGCAGGCAGCGTGATGATGG + Intronic
1023923614 7:44649022-44649044 CAGGGCAGACAGGCTGTGATGGG - Intronic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1025142850 7:56479816-56479838 CTGGGCAGGCACTGTGAGGGAGG + Intergenic
1025610142 7:63070879-63070901 CTGGGCAGGCACTGGGAGGTAGG - Intergenic
1026460717 7:70612913-70612935 CTGGGCAGGCAGTCCAGGGTGGG + Intronic
1026843070 7:73681723-73681745 ACGGGCAGACAGCCTGAGGTCGG + Exonic
1026979473 7:74518080-74518102 GAGGGCAGCCAGGCTGGGGTCGG - Intronic
1027629703 7:80587545-80587567 CAGTGATGGGAGTCTGAGGTGGG + Intronic
1028588095 7:92470879-92470901 CAGAGCAGGCCATGTGAGGTGGG + Exonic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1030939647 7:115630246-115630268 TAGGGCAGGGAGTGTGAGGCAGG - Intergenic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1032427815 7:131835603-131835625 AAGGACAGGGAGTCTCAGGTGGG + Intergenic
1033286799 7:140048327-140048349 CAGGGCAGGCAGCGTGTGCTTGG - Intronic
1033965832 7:146974197-146974219 CTGGGCAGGGAGGCTGAGGTGGG + Intronic
1034544271 7:151779583-151779605 CAGGGCAGGCTTTCTGAGCGGGG - Intronic
1036770400 8:11574970-11574992 CAGGGAAGGCAGTGTGGTGTGGG - Intergenic
1037006807 8:13791562-13791584 CAGGGGAGGTAGGCTGAGGGAGG - Intergenic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1038494300 8:27990700-27990722 ACTGGCTGGCAGTCTGAGGTGGG - Intronic
1038627465 8:29207912-29207934 CACGGCAGACAGTCTGGGGCAGG + Intronic
1038645057 8:29354043-29354065 CAGAGCAGTGAGTCAGAGGTTGG - Intergenic
1039032796 8:33328175-33328197 CAGGACAGGCTGTCCGAGGAGGG + Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039815867 8:41094001-41094023 CAGGGCCTGGAGTCTGAGATTGG - Intergenic
1040822864 8:51584366-51584388 CAGAGCAGGCAGTCTGGGGTGGG - Intronic
1040880760 8:52201762-52201784 CAGCCCAGGGAGTCTGAGGACGG - Intronic
1041663391 8:60420507-60420529 CAGAGCAGGCCATGTGAGGTGGG + Intergenic
1041982079 8:63873630-63873652 CAGTGCAGGAGCTCTGAGGTGGG - Intergenic
1046566937 8:115914004-115914026 CAGGGAAGAAAATCTGAGGTAGG - Intergenic
1047115083 8:121832916-121832938 CAGGGCAGGCAGCTTGAGCTGGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1048427685 8:134338104-134338126 CAGGGCAAGCAGACTGTGTTTGG - Intergenic
1049610153 8:143551353-143551375 CAGGCCTGGGAGGCTGAGGTGGG - Intergenic
1049675055 8:143885612-143885634 CTGGGCAGGCAGCCAGAGGGAGG + Intergenic
1049800339 8:144514698-144514720 CAGAGCAGACAGACTGAAGTAGG + Intronic
1052875924 9:33563518-33563540 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053069139 9:35090635-35090657 CATGGCAGGCAGTCTCGGCTTGG - Exonic
1053166190 9:35845897-35845919 CAGGGGTGGGAGTCTGAGGGTGG + Intronic
1053500085 9:38580843-38580865 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1053660981 9:40278682-40278704 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053911358 9:42908019-42908041 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054373102 9:64424896-64424918 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054523629 9:66097602-66097624 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1054680733 9:67914675-67914697 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1057979874 9:99650160-99650182 CAGGGCAGGAACTATGATGTGGG - Intergenic
1059305700 9:113351411-113351433 CAGGGCAGGAATCCAGAGGTAGG - Intronic
1061238807 9:129357570-129357592 CAGGGCAGGCTGTCTGCGTGTGG + Intergenic
1061350751 9:130062829-130062851 CTAGGCAGGCAGGCTGAGGCAGG - Intronic
1061508318 9:131045329-131045351 CAGGGGAGGCTGTCTGAAGCAGG + Intronic
1061676218 9:132217310-132217332 GAAGGCAGGCAGCCTGAGGCAGG + Intronic
1062038403 9:134392884-134392906 CTGGGCAGGCACTCTGGGATGGG + Intronic
1062267474 9:135693899-135693921 CAGGGCAGACGGACTGAGGTGGG - Intronic
1062323893 9:136003544-136003566 CAGAGCCGGCATCCTGAGGTGGG - Intergenic
1062429159 9:136519316-136519338 CAGGCCAGGCAGACTAGGGTTGG - Intronic
1062519294 9:136950975-136950997 CAGGACAGGGAATCTGGGGTGGG + Intronic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1185621805 X:1454264-1454286 CAGGGCGGGCGCTGTGAGGTGGG + Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1188246331 X:27840249-27840271 CAAGGGAGACAGTCAGAGGTAGG - Intergenic
1188878973 X:35468659-35468681 CAGGGAAGGCAGTGTGGGGAGGG + Intergenic
1190249129 X:48708834-48708856 CAGGGCATACAGTCTCATGTAGG - Exonic
1190616947 X:52243573-52243595 TAGGCCAGGGAGGCTGAGGTGGG + Intergenic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1192204569 X:69087648-69087670 AAAGGCAGGCAGACCGAGGTGGG - Intergenic
1192589346 X:72346898-72346920 CTGGGCATGTAGTGTGAGGTAGG + Intronic
1193223585 X:78955697-78955719 CAGGGCTCACAGACTGAGGTGGG - Intronic
1195840595 X:109172225-109172247 CAGGGCTGGGAGGCAGAGGTGGG - Intergenic
1196128499 X:112125984-112126006 CAGGGCCGGCGGCCTAAGGTGGG + Intergenic
1196726514 X:118900691-118900713 GAAGGGAGTCAGTCTGAGGTAGG + Intergenic
1198093003 X:133350410-133350432 CTAGTCAGGCAGGCTGAGGTGGG + Intronic
1199619805 X:149689095-149689117 CATGGGAGGCATTCTGAGCTGGG - Intronic
1199843648 X:151675306-151675328 CAGGGCAGGCAGTGAGGGCTGGG - Intronic
1200394931 X:155979444-155979466 CAGGGCAGGCAGCTTGGGGTGGG - Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1202186626 Y:22191648-22191670 CAGTGCTGACAGTCTGAGCTTGG - Intergenic
1202204733 Y:22394748-22394770 CAGTGCTGACAGTCTGAGCTTGG + Intronic