ID: 1121121720

View in Genome Browser
Species Human (GRCh38)
Location 14:91379945-91379967
Sequence CTCACTACGGGGATATCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121121720 Original CRISPR CTCACTACGGGGATATCGAA AGG Intronic
904317395 1:29674547-29674569 CTCACTACCTGGATAAAGAATGG + Intergenic
1065321081 10:24510770-24510792 CTCACTGCGGGGATGTGGCAGGG - Intronic
1079169734 11:18081406-18081428 CTCACCACAGGGCTATAGAAAGG + Exonic
1088423501 11:109674801-109674823 CTCACTAGGTGGATATATAAAGG + Intergenic
1118842215 14:69521871-69521893 ATCACTCCAGGGATCTCGAATGG + Intronic
1119888407 14:78163984-78164006 CTCACTACAGGGATACCTGAGGG - Intergenic
1121121720 14:91379945-91379967 CTCACTACGGGGATATCGAAAGG + Intronic
1128052084 15:64673475-64673497 CTCACTATGAAGATATAGAAAGG - Intronic
1134265697 16:12690857-12690879 CTCAGCACTGGGATATCCAAAGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1155454530 18:25997042-25997064 CTCACTGGGGGAATATGGAAGGG - Intergenic
1156905525 18:42348018-42348040 CTCATTACAGGGATATCATATGG + Intergenic
1166564270 19:43754283-43754305 CTCTCTACGGGGTTCTAGAAGGG + Intronic
927899672 2:26810342-26810364 CTGACTAGGGGGAAATGGAAAGG + Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
969324422 4:6432686-6432708 CACACTACAGGGATAGAGAAGGG + Intronic
972097456 4:35365342-35365364 CTCCCTCCAGGGATATTGAAAGG + Intergenic
982654380 4:158129307-158129329 CTTACTAAGGTGATATCGCAGGG - Intronic
1045660250 8:104429628-104429650 CTCACTACTGGAATAAAGAATGG - Exonic
1050066924 9:1769719-1769741 CTCACTCTGGGGATTTCAAATGG + Intergenic