ID: 1121123109

View in Genome Browser
Species Human (GRCh38)
Location 14:91388754-91388776
Sequence CTCAAGCACACTTGCAGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121123103_1121123109 17 Left 1121123103 14:91388714-91388736 CCAAACACAGACTGAGATCCGCT 0: 1
1: 0
2: 0
3: 0
4: 81
Right 1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 154
1121123106_1121123109 -1 Left 1121123106 14:91388732-91388754 CCGCTCTAACTGTGGGCCATGAC 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121123109 Original CRISPR CTCAAGCACACTTGCAGCGA GGG Intronic
900699989 1:4040847-4040869 CTCCAGCAGACCTGCAGCTAAGG + Intergenic
903040620 1:20527217-20527239 CTCAAGCACACATGGACCCAGGG + Intergenic
910949891 1:92634906-92634928 CTCCAACAGACTTGCAGCTAAGG - Intronic
918167138 1:181961188-181961210 CTCCAGCAGACATGCAGCAAAGG - Intergenic
918906703 1:190505646-190505668 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
919499117 1:198314660-198314682 CTCAAACAGACTTGCAGCTGAGG - Intronic
924631552 1:245745498-245745520 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
924705703 1:246500215-246500237 CTCAACCTCCCTTGCAGCTAGGG - Intronic
1063347742 10:5327046-5327068 CTCCAGCACACTCTCAGAGACGG + Intergenic
1064150203 10:12856509-12856531 CTCCAGCACACCTGCAGCTGAGG + Intergenic
1066704794 10:38165857-38165879 CTCCAGGACATTTGCAGAGAGGG - Intergenic
1066985768 10:42465337-42465359 CTCCAGGACATTTGCAGAGAGGG + Intergenic
1066993387 10:42538968-42538990 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
1068210182 10:53910394-53910416 CTCCAACAGACTTGCAGCTAAGG + Intronic
1068951676 10:62783191-62783213 CTCCAGCAAACCTGCAGGGAAGG + Intergenic
1070349373 10:75576773-75576795 CTCCAGCACACTTGCAGCAGAGG + Intronic
1074016655 10:109541826-109541848 CTCCAGCAGACCTGCAGCGGAGG - Intergenic
1076389905 10:130091304-130091326 CTCCAGCATACCTGCAGCAAAGG + Intergenic
1077561942 11:3269667-3269689 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
1077567837 11:3315487-3315509 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
1077594656 11:3521541-3521563 ATCAAGGACACATGCAGAGATGG - Intergenic
1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG + Intronic
1078799128 11:14624989-14625011 CTCAAGCCCAACTGCAGCAATGG + Intronic
1079868002 11:25759181-25759203 CTCCAGCAGACTTGCAGCAGAGG + Intergenic
1079993639 11:27273159-27273181 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
1084822279 11:71700533-71700555 ATCAAGGACACATGCAGAGATGG + Intergenic
1086312192 11:85548244-85548266 CTCCAGCAGACTTGCAGCAGAGG - Intronic
1091417217 12:298431-298453 CTCCAGCACACCTGCAGCAGAGG + Intronic
1092420830 12:8330327-8330349 ATCAAGGACACATGCAGAGATGG - Intergenic
1094781971 12:33802111-33802133 CTCCAGCAGACCTGCAGAGAAGG - Intergenic
1095805238 12:46312286-46312308 CTCCAACACACCTGCAGCTAAGG - Intergenic
1097948718 12:65402860-65402882 CTCCAGCAGACTTGCAGCAGAGG - Intronic
1099344453 12:81480667-81480689 CTCAAGCAGACCTGCAGCAGAGG - Intronic
1100239447 12:92696714-92696736 CTCACCCACACTTGAAGGGAGGG - Intergenic
1102709894 12:114916620-114916642 CACAAGCACCCTGGCAGGGAGGG + Intergenic
1102970124 12:117159877-117159899 CTCAGCCACACATCCAGCGAAGG - Intronic
1104987629 12:132605918-132605940 CCCAAGCACACTTGAGGCTATGG - Intronic
1106426488 13:29635915-29635937 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
1108235151 13:48395130-48395152 CTCCAGCACACCTGCAGCAGAGG + Intronic
1109188008 13:59292584-59292606 CTCCAGCACACCTGCAGAAAAGG + Intergenic
1113147461 13:107223832-107223854 CCTAAGCACATTTGCAGGGATGG - Intronic
1114844992 14:26309797-26309819 CTCCAGCAGACTTGCAGCAGAGG + Intergenic
1115704614 14:35986389-35986411 CACAAGCAAATTTACAGCGAAGG - Intergenic
1116417245 14:44693803-44693825 CTCCAGCACACTGGCAGCAGAGG + Intergenic
1116867173 14:50040325-50040347 CCCAAGCCCACTTGCAAAGATGG + Intergenic
1118779901 14:69000898-69000920 CTCAGGCTCCCTTGCAGCTAAGG + Intergenic
1119249228 14:73137581-73137603 CTTAGGAACACTTGCAACGAGGG + Intronic
1119551911 14:75521081-75521103 CTCAAGCACACTTCCACCTCAGG + Intergenic
1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG + Intronic
1202912154 14_GL000194v1_random:128522-128544 CTCGAGCAAACCTGCAGCGGAGG - Intergenic
1130000414 15:80041713-80041735 CTCAAGCACACTGGCATTCAGGG - Intergenic
1130724119 15:86420350-86420372 CTCAAGCAGACCTGCAGCAGAGG + Intronic
1133279129 16:4655275-4655297 CTCAAGTGCACTTGAAGAGAGGG + Intronic
1135982815 16:27161609-27161631 CCCAAGCTCCCTTGCAGGGATGG - Intergenic
1139786787 16:69399466-69399488 CTCAAACACCCTTGCAGCTCTGG + Intronic
1140299406 16:73741467-73741489 CTTAAGCACACGTGCAGCATGGG - Intergenic
1149688406 17:58552732-58552754 CTCAAGAACTCTTGTAGCAATGG + Intergenic
1150479072 17:65495884-65495906 CTCCAGCAAACTTGCAGCTCTGG + Intergenic
1150726543 17:67655698-67655720 CTCAAGCACACTTCCTGCCTTGG - Intronic
1151064077 17:71131248-71131270 CTCCAGCACACCTGCAGCAGAGG - Intergenic
1151427313 17:74039383-74039405 CACATGCACAGTTGCAGAGAGGG - Intergenic
1157318647 18:46617174-46617196 CTCAAGCCCACATGCAGTGCAGG + Intronic
1157760549 18:50260694-50260716 CCCAAGCACACATGCAGCACAGG + Intronic
1157979062 18:52359424-52359446 CTCAGGCTCCCTTGCAGCTAGGG + Intronic
1159254821 18:65931822-65931844 CTCCAGCAGACTTGCAGAAAAGG + Intergenic
925245210 2:2376686-2376708 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
926761968 2:16286034-16286056 GTCCAGCACACCTGCAGCCAAGG + Intergenic
929333427 2:40712181-40712203 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
933413102 2:81950460-81950482 CTCCAGCACACCTGCAGCAGAGG - Intergenic
935980070 2:108618049-108618071 TTCATGGACACTTGCAGTGATGG - Intronic
937468299 2:122154041-122154063 CTCAGCCACATTTGCAGCCATGG + Intergenic
939656770 2:144835952-144835974 GTGAAGCACACTTACAGCTATGG - Intergenic
939942097 2:148362871-148362893 CTCCAGCAGACCTGCAGCAAAGG + Intronic
941571409 2:167175392-167175414 CTCCAGCACACCTGCAGCAGAGG - Intronic
943409895 2:187533448-187533470 CTCCAGCAGACCTGCAGCGGAGG + Intronic
944150313 2:196551289-196551311 CACAAACACACTTACAGCCAAGG + Intronic
944292142 2:198019116-198019138 CTCCAGCAGACCTGCAGCAAAGG + Intronic
948204710 2:236157067-236157089 CTCCAGCAGGCCTGCAGCGAAGG - Intergenic
1168912974 20:1464897-1464919 CCTAAGCACACTAGCAGGGATGG - Intronic
1169091817 20:2865513-2865535 CTCCAGCCCACTTCCAGTGAGGG + Intronic
1169497304 20:6127631-6127653 CCCAACCTCGCTTGCAGCGAGGG + Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171441496 20:25166827-25166849 CTCCAGCAGACCTGCAGCAAAGG + Intergenic
1175274284 20:57757079-57757101 CTCAAGCAGCCCTGCAGAGAGGG - Intergenic
1180337712 22:11594250-11594272 CTCCAGCAGACCTGCAGCTAAGG - Intergenic
1180375086 22:12084408-12084430 CTCAAGCAAACCTGCAGCAGAGG + Intergenic
1181097861 22:20518310-20518332 CTCAAGCTCCCTTGCAGGGATGG - Intronic
949640944 3:6035653-6035675 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
950561887 3:13735658-13735680 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
956243512 3:67155155-67155177 CTCCAGCAGACCTGCAGAGAGGG + Intergenic
956623066 3:71240372-71240394 CTCAAGCAGGGTAGCAGCGATGG + Intronic
958878493 3:99642285-99642307 CTCAAGCAGATTTGCAGGAATGG + Intronic
959955972 3:112238684-112238706 CTCCAGCAGACTTGCAGCTGAGG - Intronic
961288553 3:125826518-125826540 ATCAAGGACACATGCAGAGATGG + Intergenic
961898505 3:130189527-130189549 ATCAAGGACACATGCAGAGATGG - Intergenic
962512440 3:136115149-136115171 CTCCAGCACACCTGCAGCAGAGG + Intronic
968279974 3:197469039-197469061 CTCTAGCACACTTCAAGAGAAGG - Intergenic
968760485 4:2440516-2440538 CTCAAGCAAACTTCCAGCTTTGG - Intronic
969009488 4:4050025-4050047 ATCAAGGACACATGCAGAGATGG - Intergenic
969744862 4:9062289-9062311 ATCAAGGACACATGCAGAGATGG + Intergenic
969804279 4:9594395-9594417 ATCAAGGACACATGCAGAGATGG + Intergenic
969807233 4:9618508-9618530 CTCCAGCAGACTTGCAGCTGAGG + Intergenic
970284951 4:14501631-14501653 CACAAACAGACTTTCAGCGACGG + Intergenic
974719972 4:65725562-65725584 CTCCAACAGACCTGCAGCGAGGG + Intergenic
975149306 4:71004214-71004236 CTCCAGCAGACTTGCAGCAGAGG - Intronic
976006902 4:80440437-80440459 CTCCAGCACACCTGCAGCAGAGG + Intronic
976114959 4:81716112-81716134 CTCAAGCAGACCTGCAGCAGAGG + Intronic
977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG + Intronic
977971385 4:103217925-103217947 CCCAAACACACTGGCAGAGATGG - Intergenic
978139164 4:105297846-105297868 CTCCAGCAGACCTGCAGCAAAGG + Intergenic
978683878 4:111415654-111415676 CTGAAGAACACTAGCAGGGATGG + Intergenic
982808748 4:159799778-159799800 CTCAAGCACACTTCCTGCCTTGG + Intergenic
983840959 4:172456083-172456105 CTCCAGCAGACTTGCAGCAGAGG + Intronic
987112322 5:14699901-14699923 CTCAAGCACACAGGCAACTAGGG - Intergenic
988606752 5:32685003-32685025 CTGAAGCACACTCGAAGCAAGGG - Intergenic
989768700 5:45117050-45117072 CTCAAGCAGACCTGCAGCTGAGG - Intergenic
993404046 5:87488697-87488719 CTCCAGCAGACTTGCAGCAGAGG + Intergenic
993775257 5:91986784-91986806 CTCAAACAAACCTGCAGAGAGGG - Intergenic
995620717 5:114022130-114022152 CTCCAGCAGACATGCAGCTAGGG + Intergenic
995815817 5:116166727-116166749 CTCCAGCAGACTTGCAGCAGAGG + Intronic
998972675 5:147610439-147610461 CTCCAGCAGACTTGCAGCAGAGG - Intronic
1000991776 5:167918591-167918613 ATCAAGCACACTGCCAGGGAGGG + Intronic
1002807645 6:592489-592511 CTCATGCACAGTTGCAAAGAGGG - Exonic
1004705345 6:18119239-18119261 CTCAAGCACACATGCGCTGAGGG - Intergenic
1004707027 6:18134209-18134231 CTCAAGCACACAGGCATCCAAGG - Intronic
1007804672 6:44432390-44432412 ATCAAACACACTGGCAGCCATGG - Intronic
1011120191 6:83943346-83943368 CTCCAGCAGACTTGCAGCAGAGG + Intronic
1014176934 6:118341798-118341820 CTTCAGCACACTTGCAGCAGAGG - Intergenic
1014906310 6:127032989-127033011 TTCAAGAACACTTGCAGGGGAGG + Intergenic
1015457522 6:133444545-133444567 CTGTAGCACAGTTGCAGCAAAGG + Intronic
1016241966 6:141940981-141941003 CTCCAGCAGACCTGCAGCGGAGG + Intergenic
1018094427 6:160373262-160373284 CTCCAGCAGACTTGCAGCAGAGG - Intronic
1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG + Exonic
1024974900 7:55104349-55104371 ATCCAGCACAGTAGCAGCGACGG - Intronic
1028755349 7:94427457-94427479 CCCAGGCACACTTGCAGGGATGG - Intronic
1029068451 7:97875544-97875566 ATCAAGGACACATGCAGAGATGG - Intergenic
1030331654 7:108277992-108278014 CTCCAGCAGACCTGCAGCGGAGG - Intronic
1030510132 7:110473118-110473140 CTCCAACACACTTGCAGCTGAGG + Intergenic
1033050753 7:138002021-138002043 CGCAAGCCCACTTGCCGCTACGG + Exonic
1034832032 7:154317181-154317203 TTCAAGCACAGCTGCAGTGAAGG - Intronic
1036250773 8:7160700-7160722 ATCAAGGACACATGCAGAGATGG - Intergenic
1036366717 8:8126757-8126779 ATCAAGGACACATGCAGAGATGG + Intergenic
1036884169 8:12538905-12538927 ATCAAGGACACATGCAGAGATGG - Intergenic
1039221536 8:35336636-35336658 TTCAAGCAGACTTGGAGGGAGGG - Intronic
1041423654 8:57696061-57696083 CTCCAGCAGACCTGCAGCAAGGG + Intergenic
1043647143 8:82535619-82535641 CTCCAGCAGACCTGCAGAGAAGG - Intergenic
1055338611 9:75258923-75258945 CTCCAACAGACCTGCAGCGAAGG - Intergenic
1055537775 9:77267422-77267444 CTCCAGCAGACCTGCAGCAAAGG - Intronic
1061287397 9:129631870-129631892 CACAACCACACCTGCAGGGAGGG - Intronic
1203537472 Un_KI270743v1:54711-54733 CTCAAGCAAACCTGCAGCAGAGG + Intergenic
1187784416 X:22867565-22867587 CTCCAGCAGACGTGCAGCAAAGG + Intergenic
1189248471 X:39581466-39581488 CCCAAGCTCACCTGCAGCCAAGG + Intergenic
1189721757 X:43927047-43927069 CTCCAGCACACCTGCAGCAGAGG - Intergenic
1191039404 X:56063419-56063441 CTCCAGCAGACTTGCAGCAGAGG - Intergenic
1191079530 X:56494690-56494712 CTCCAACACACTTGCAGCTGAGG - Intergenic
1191206805 X:57842963-57842985 CTCAAGCAGACCTGCAGCAGAGG + Intergenic
1191625462 X:63266303-63266325 CTCCAACACACTTGCAGCTGAGG - Intergenic
1195391336 X:104365868-104365890 CTCCAACAGACTTGCAGCTAAGG - Intergenic
1195456735 X:105078260-105078282 CTCCAACACACCTGCAGCTAAGG - Intronic
1201633817 Y:16099482-16099504 CTCAAGCACACTTGTAGCAGAGG + Intergenic