ID: 1121123594

View in Genome Browser
Species Human (GRCh38)
Location 14:91392079-91392101
Sequence TAGTGCCTCTGGGGCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121123584_1121123594 23 Left 1121123584 14:91392033-91392055 CCTCATGAGTTCACTCCCTGGCT 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 218
1121123586_1121123594 8 Left 1121123586 14:91392048-91392070 CCCTGGCTCCATTTGGCTGTTCC 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 218
1121123588_1121123594 0 Left 1121123588 14:91392056-91392078 CCATTTGGCTGTTCCTGACTCTC 0: 1
1: 0
2: 4
3: 46
4: 368
Right 1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 218
1121123587_1121123594 7 Left 1121123587 14:91392049-91392071 CCTGGCTCCATTTGGCTGTTCCT 0: 1
1: 0
2: 2
3: 17
4: 212
Right 1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121123594 Original CRISPR TAGTGCCTCTGGGGCCTCCA GGG Intronic
900602604 1:3509501-3509523 TAGGGACTCTGGGGCCTAGAGGG + Intronic
900617262 1:3571030-3571052 ATGTTCCTCGGGGGCCTCCAGGG + Intronic
900643605 1:3698733-3698755 TGGTGCCCCCCGGGCCTCCACGG - Intronic
901772031 1:11535416-11535438 CTGTTCCTCTGAGGCCTCCAGGG + Intronic
902300002 1:15494969-15494991 TCGTGCCTCAGGGGTTTCCATGG - Intronic
902666780 1:17945051-17945073 CAGTGACTCTGAGGCCTCAAAGG - Intergenic
902685457 1:18073995-18074017 GATTTTCTCTGGGGCCTCCATGG - Intergenic
902770368 1:18642447-18642469 TAGAGGCTCTGGGGCCTTGAAGG + Intronic
902794585 1:18793000-18793022 AAGTACCTCTGGGGTCTGCAGGG + Intergenic
905635756 1:39550909-39550931 TGTTGCTTCTGGGGGCTCCAAGG - Intergenic
906292865 1:44631519-44631541 CAGTGCCTATGGGAGCTCCAGGG + Intronic
908347021 1:63244201-63244223 TTCTGCTCCTGGGGCCTCCATGG - Intergenic
908576924 1:65469844-65469866 CAGTGCCTCTTGACCCTCCAAGG + Intronic
912451768 1:109771816-109771838 TAGAGCCTCTGGGACCACAAAGG - Intronic
912492326 1:110069297-110069319 TGGCGCCTCGCGGGCCTCCACGG - Intronic
912995809 1:114531526-114531548 TAGTGCCTATGAGGACTGCAGGG + Intergenic
915110960 1:153564479-153564501 TAGAGGCTCAGGGGCCTTCAGGG - Intronic
918226179 1:182485089-182485111 TAGTGCCTGTGAGGACTGCAGGG + Intronic
918428461 1:184434606-184434628 GTGTGGCTCTTGGGCCTCCAAGG + Intronic
919568971 1:199222088-199222110 TAGTGCCTGTGAGGACTGCAGGG + Intergenic
919897899 1:202020835-202020857 TAGTGCTTCTGGGGCCACACAGG - Intergenic
920802614 1:209203503-209203525 CAGTGTCTCTGGGACCACCATGG + Intergenic
924442868 1:244101157-244101179 CTGTGCCTCTGGGGCCTCGCTGG + Intergenic
1063139480 10:3243691-3243713 TTGAGACTCTGGGGCCACCAGGG - Intergenic
1066518223 10:36187621-36187643 TATTGCAACTGGGGCCTCCAGGG - Intergenic
1067220181 10:44338277-44338299 TCGAGGCTCTGTGGCCTCCATGG + Intergenic
1067672095 10:48332877-48332899 TAGTGCCTTTTTGGCCTTCAAGG + Intronic
1067760094 10:49038725-49038747 AGGTGCCTGTGGGCCCTCCAGGG + Intronic
1069721136 10:70549995-70550017 TCTTGCCTCTGGGCCCTCCAAGG - Intronic
1074491640 10:113944279-113944301 CGGGGCCTCTGGGGCCTCCACGG - Intergenic
1075682074 10:124340375-124340397 TGGTTGCTCTGGGGCCTGCATGG - Intergenic
1076247275 10:128957310-128957332 CAGTGCCTCTGAAGCCTACACGG + Intergenic
1076343445 10:129765360-129765382 TGGGGGCTCTGGGGGCTCCAGGG - Intronic
1076657102 10:132031938-132031960 GAGTGCCTCTGTGCCCTCCAGGG - Intergenic
1076711742 10:132339462-132339484 TAGGGACTCTGGGGTCTGCAGGG + Intronic
1077374301 11:2198365-2198387 CAGTGACTGTGGGGACTCCAGGG - Intergenic
1077478584 11:2802585-2802607 TAGTGCCTCCTGGGTCCCCAGGG + Intronic
1078038450 11:7833740-7833762 TACTCCCTCTGGAGGCTCCAAGG - Intergenic
1081619268 11:44609402-44609424 CAGAGCCTCAGGGGCCTCCCTGG - Intronic
1081861286 11:46334541-46334563 TAATGGCTCTGGGGCCATCAGGG + Intronic
1083587394 11:63870199-63870221 TAGGGCCTCTGGCACCTCTATGG - Intronic
1084330717 11:68428442-68428464 TGCTTCCTCTGGGGGCTCCAGGG + Intronic
1084803915 11:71565839-71565861 TGGTTCCTGTGGGGGCTCCAAGG + Exonic
1084803959 11:71565959-71565981 TGGTTCCTGTGGGGGCTCCAAGG + Exonic
1084955542 11:72689392-72689414 TGGTGCCCCTGTGGACTCCAGGG - Intronic
1085647890 11:78239772-78239794 TAGTGCCTATGAGGACTTCAGGG - Intronic
1087945160 11:104150620-104150642 TACTCCCTCTGGAGGCTCCAGGG + Intronic
1088753379 11:112864918-112864940 CAGAGGCTCTGGGGCCTCTAGGG + Intergenic
1091279584 11:134374376-134374398 GAGGGCCGCTGGGGCCTCCCTGG + Intronic
1092547037 12:9461179-9461201 TACTGCAGCTGGGGCCTCCATGG + Intergenic
1093014594 12:14143556-14143578 AGGTGCCTGTGGGGCCTCTAGGG - Intergenic
1094505901 12:31060893-31060915 TACTGCAGCTGGGGCCTCCATGG - Intergenic
1094523954 12:31219590-31219612 TGGTTCCTCTGCGTCCTCCACGG - Intergenic
1096186894 12:49587363-49587385 TAGTGTCTCAGAGGCCACCAGGG - Intronic
1098560502 12:71866364-71866386 TAGTGCCTGTGAGGACTGCAGGG + Intronic
1101578658 12:106021634-106021656 TAGTCCTGCTGGGGACTCCAGGG - Intergenic
1102787228 12:115614682-115614704 TGGTGCCTCTGTGGGCCCCAAGG + Intergenic
1104825006 12:131701849-131701871 TAGTGCCTGGGGGGACTACAGGG - Intergenic
1105608460 13:21946905-21946927 AAGTGCCTGAGGGGCCACCAAGG - Intergenic
1107153375 13:37138403-37138425 TACTCCCTCTGGAGGCTCCAGGG - Intergenic
1107722529 13:43263796-43263818 CAGTCCCTCTGTGGCTTCCAGGG - Intronic
1109256004 13:60083659-60083681 TAGTGCATTTGTGGCCCCCATGG + Intronic
1111858291 13:93668670-93668692 TGCAGCCTCTGGGGGCTCCAGGG - Intronic
1115502846 14:34064647-34064669 TATTCCCTCTGAAGCCTCCAGGG - Intronic
1117146079 14:52837891-52837913 TAGTGCTGCTGGGGCCAGCAGGG + Intergenic
1118256729 14:64211809-64211831 TAGTGCTTCTGGGGCTTTCTGGG + Intronic
1119946752 14:78703370-78703392 TCTTGCTTCTGGGGTCTCCACGG - Intronic
1121038863 14:90728735-90728757 TGGTACCCCTGGGACCTCCAGGG + Intronic
1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG + Intronic
1121718558 14:96093302-96093324 TTGTGTCTCTGGGACCTCCAGGG + Exonic
1122646681 14:103199105-103199127 TAGTTTCTCTGGGGTCTCCTTGG + Intergenic
1123983688 15:25625420-25625442 AGGTGTGTCTGGGGCCTCCATGG + Intergenic
1124394774 15:29291528-29291550 TTGTGCCTCAGGGCCCTGCAAGG - Intronic
1127638122 15:60890457-60890479 TTCTGCTGCTGGGGCCTCCAGGG - Intronic
1129172539 15:73817018-73817040 TGCTGGGTCTGGGGCCTCCATGG + Intergenic
1129603448 15:77013386-77013408 AGCTGCCTCTGGGGTCTCCATGG + Intronic
1129679824 15:77652362-77652384 AAGCGTCTCTGGGGCTTCCAGGG + Intronic
1130352973 15:83107683-83107705 GAGTGCCTCTGCGGCCACCGGGG + Exonic
1132195676 15:99913112-99913134 TTGTGGCTCTGTGTCCTCCAGGG + Intergenic
1132828909 16:1918178-1918200 TACTGCCTCTGCGCCCTCCCCGG - Exonic
1132906987 16:2287761-2287783 CAGTGTCTCTGGCACCTCCAGGG + Intronic
1132921602 16:2398552-2398574 TGGAGCCTCTGTGGCCTCCCCGG + Intergenic
1133580886 16:7143511-7143533 TGGTGCTTCTGCTGCCTCCAGGG - Intronic
1133982294 16:10642171-10642193 TAGTGCCTCTAGGGTCAGCAAGG - Intronic
1135581762 16:23633602-23633624 CAGTGTCTCTAAGGCCTCCAAGG - Intronic
1138299146 16:55911884-55911906 CAGTGCCTATGGGGCTGCCAGGG + Intronic
1140299859 16:73746520-73746542 AAGTCCCTCTGGGGAGTCCAGGG + Intergenic
1140663223 16:77207651-77207673 TAGGGCCTCTTGGGCCACCGTGG - Intronic
1140772007 16:78213867-78213889 GAGGGCTTCTGGGGCCCCCAGGG + Intronic
1141153253 16:81579265-81579287 TGGTCCTCCTGGGGCCTCCATGG + Intronic
1141795680 16:86272051-86272073 CAGTGTCTCTGGGACCTTCAGGG - Intergenic
1141921728 16:87140001-87140023 TAGTTCCTCTGGAGGCTCCAGGG - Intronic
1142359747 16:89620415-89620437 TACTGCCTGGGGGGCCTCAAAGG + Intronic
1142500087 17:327442-327464 GAGTACCTCTGGGGCCCCCCAGG - Intronic
1144259866 17:13507825-13507847 TAGTTCCTGTGGGTCCTCGATGG + Intronic
1145761068 17:27425739-27425761 CTGTGCCTCTGTCGCCTCCAGGG - Intergenic
1146351839 17:32101847-32101869 TACTGCCTCAGTGGCCTCCTGGG + Intergenic
1146373405 17:32279397-32279419 TAGGGGCTATGGGGCCTCCAAGG - Intronic
1146653786 17:34623347-34623369 TAGCAGCTCTGGGGTCTCCAGGG + Intronic
1147717847 17:42520139-42520161 TAGGGGCTCCGGTGCCTCCAGGG + Intronic
1147909764 17:43848567-43848589 GATTTCCTCTGGGCCCTCCAGGG - Exonic
1147932101 17:43988099-43988121 TGGTGGCTCTGGGGCTCCCACGG - Intronic
1152060278 17:78068043-78068065 AAGGGTCTCTGGGACCTCCAAGG - Intronic
1152245217 17:79181879-79181901 TTGTGCCCCTTGGCCCTCCAAGG - Intronic
1152848262 17:82615835-82615857 CAGTGCCCCAGGGGCCTCCTGGG - Exonic
1152902358 17:82950180-82950202 TGGGGGCTCTGGGCCCTCCAAGG + Intronic
1153819740 18:8823287-8823309 CAGTGCCTCTGGGGCATGGATGG - Intronic
1154194082 18:12253574-12253596 TAGGGCCTCTGAGACCTCCGAGG - Intergenic
1155844036 18:30683188-30683210 TACTGCCTCTGGGCCCTTCTGGG - Intergenic
1158583595 18:58708114-58708136 GAGGGCCTCGTGGGCCTCCAAGG + Intronic
1160754734 19:751367-751389 TAGGTACTCTGGGGCCTCAAGGG + Intronic
1160782477 19:883984-884006 TACTGCCTCTGCGGCCACAATGG + Intronic
1164603885 19:29581830-29581852 CAGTGACTGTTGGGCCTCCATGG - Intergenic
1164899016 19:31902342-31902364 TAGTGCTCCAGGGTCCTCCAGGG + Intergenic
1164903087 19:31944725-31944747 TAGCTCCTCTGGAGACTCCAAGG - Intergenic
1164995700 19:32719593-32719615 GAGTGTCCCTGGGGCCTGCAGGG + Intergenic
1165686372 19:37824461-37824483 CAGGGCTTCTGTGGCCTCCATGG + Intergenic
1165774272 19:38395664-38395686 TAGTGCCGCTGGGGGACCCAGGG - Exonic
1165937827 19:39399863-39399885 GAGTGCCTCTGTGGGCTCCCTGG - Exonic
1166379890 19:42350383-42350405 AGGTGCCTGTGGGGCCACCAGGG + Exonic
1166640514 19:44491181-44491203 TAGTGCCTCCAGGGACCCCAGGG - Intronic
1166999971 19:46739966-46739988 TAGTTGATCTGGGGTCTCCAAGG - Intronic
1167293710 19:48637624-48637646 TGGGGCCTCTGGGTCCGCCAGGG + Intergenic
1167499402 19:49836777-49836799 TAGTGCCTCTGGGCCCTCCTGGG + Intronic
1167698153 19:51026740-51026762 CAGTGCCTCAGAGGCCTCCGGGG - Intronic
1167772532 19:51530210-51530232 TACTGCCTCAGGCGTCTCCATGG - Intronic
925483672 2:4304304-4304326 CAGTGCCTCTAGGGCCTCAAGGG + Intergenic
926417218 2:12661520-12661542 TTCTCCCTCTGGGGGCTCCAGGG - Intergenic
929561564 2:42959619-42959641 TATGGCCTCTGGGGGCTGCAGGG + Intergenic
929609498 2:43259475-43259497 TAGGGCCTCTGCTGCCTACAGGG - Intronic
934220268 2:90075791-90075813 TAGTGGCTCTGGGCCCTGAATGG - Intergenic
935526829 2:104181086-104181108 GAGTGCCACTGTGGTCTCCAGGG - Intergenic
935537954 2:104316392-104316414 TAGTGCCTGTGGGGTTTCCTGGG + Intergenic
936236097 2:110743987-110744009 TGCTGCCTCTGGGGCCCCCCAGG + Intronic
937016433 2:118610354-118610376 AAGTGTCTTGGGGGCCTCCATGG - Intergenic
937776708 2:125786280-125786302 AAGTGCCTCTGTTCCCTCCAAGG + Intergenic
937883357 2:126884441-126884463 TCGTGGCTCTGTGGCCCCCAGGG + Intergenic
940982989 2:160024029-160024051 TAGTGCCTGTGGGGGCTGCAGGG - Intronic
944580551 2:201129032-201129054 CAGGGCCTCTGGCACCTCCATGG + Intronic
944786962 2:203081627-203081649 TGGTGCCTCTGGGATCTTCAGGG + Intronic
945476311 2:210285898-210285920 TAGTGCCTGTGAGGGCTGCAGGG + Intergenic
946843813 2:223841483-223841505 TAGGGCCTCTGGGTCCTCCCTGG - Intergenic
949063114 2:241973004-241973026 TGGTTCCTCTGGAGGCTCCATGG + Intergenic
1170363066 20:15568527-15568549 TAGGGCCTCTAGGGACTTCATGG + Intronic
1172629351 20:36367657-36367679 TAGAACCTCTGGGGCCCCCAGGG + Intronic
1176520727 21:7822145-7822167 TAGAGGCTCTGGGGCCAGCAGGG - Intronic
1180976834 22:19853355-19853377 TACTGGCTCTGGAGCCTCCTAGG - Intronic
1182041200 22:27240083-27240105 TGCTGGCTCTGGGGCCTCCTGGG + Intergenic
1183231554 22:36585289-36585311 AAGCTCCTCTGGGGCCTCCCTGG - Intronic
1183341603 22:37284739-37284761 TGGTGACTCAGGGGCCCCCAGGG + Intronic
1184878311 22:47289397-47289419 GAGTGCCTCTCGGGCCTCGGGGG - Intergenic
1185145570 22:49133792-49133814 TCCTGCTTCTGTGGCCTCCATGG + Intergenic
950156876 3:10728011-10728033 GTGTGCCTCTGGGACCCCCAGGG - Intergenic
950532055 3:13557950-13557972 GACTGCCTTGGGGGCCTCCAAGG + Intronic
950533788 3:13568148-13568170 GGGAGCCTCTGGGGCCTCGAGGG - Intronic
958022205 3:88011359-88011381 TCGAGCCTCCGGGGCTTCCAAGG - Intergenic
960619079 3:119621896-119621918 TAGCTCCCTTGGGGCCTCCAGGG + Intronic
960996524 3:123343912-123343934 AAGTGTCTCCGGGGTCTCCAGGG + Intronic
961511858 3:127408333-127408355 TGGAGCCTCTGAGGCCTCCATGG + Intergenic
962364865 3:134772185-134772207 TAATGCCCATGGTGCCTCCAAGG - Intronic
964280208 3:155055728-155055750 TAGTGCCTCAGGGACCTCTTTGG - Intronic
968471933 4:786424-786446 TCGTCCCTCAGGGGCCTCCGCGG + Exonic
968657681 4:1785674-1785696 GAGGGCCTCAGGGGCCTCCCAGG - Intergenic
972245691 4:37244060-37244082 TAGTTCCTCCGAGGCCTCCAAGG - Intergenic
972889515 4:43539317-43539339 TAGTGGCTATGGTGTCTCCATGG - Intergenic
974488310 4:62531937-62531959 TGGTGCTTCTGAGACCTCCAGGG - Intergenic
975434578 4:74336124-74336146 TAGTGCCTTTGAGACCTCCTAGG + Intergenic
978491947 4:109319032-109319054 TAGTGCCTCTGAGACCCCCTGGG - Intergenic
980448055 4:132937804-132937826 TAGTGCCTATGAGGACTGCAGGG - Intergenic
984005608 4:174303187-174303209 AAGTGCCTCTTAGGCTTCCATGG - Intronic
986285492 5:6355515-6355537 AGGTACCTCTGGGGCCTCCTGGG + Intergenic
986337603 5:6766905-6766927 TTTTGCCCCTGGGGCTTCCAAGG - Intergenic
987540457 5:19248004-19248026 CAGTGCCTGTGGGGACTACAGGG - Intergenic
987905996 5:24078006-24078028 TGGTGCCTCTAAGGCCTCCCTGG - Intronic
988721534 5:33883990-33884012 TGATGCCTCTGGCTCCTCCAGGG + Intronic
994038247 5:95227073-95227095 TTCTGCCTCGGTGGCCTCCAAGG - Intronic
995365795 5:111358733-111358755 TATTGCCACTGGGGCCTACCTGG - Intronic
998004464 5:138647963-138647985 TCCTCCCTCTGGGGCCTGCAGGG - Intronic
999638157 5:153643938-153643960 TTGGGCCTCTGGGGCCCTCATGG - Intronic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1002563886 5:180099545-180099567 TTGTGCCTCAGGATCCTCCAGGG - Intergenic
1003962870 6:11225419-11225441 TAGTGCTTCTGGTGCTTACACGG - Intronic
1004449942 6:15736094-15736116 CAATGCCTGTGGGGCCTCTAAGG + Intergenic
1005800554 6:29418043-29418065 TCATGCCTCAGGGACCTCCATGG + Intronic
1006808051 6:36801428-36801450 TATGGCCTATGGAGCCTCCAGGG - Intronic
1008546828 6:52590566-52590588 TGCTGCCTCTGGGGACCCCAGGG + Intergenic
1011481321 6:87796621-87796643 TAGAGCCTCAGGGCCCTGCAAGG - Intergenic
1011914547 6:92487847-92487869 TAGCACCTCTGGGCCCACCAGGG - Intergenic
1013329231 6:109082168-109082190 TAGTGCCTCTAGGAACTACAAGG - Intronic
1014287520 6:119517413-119517435 ATGTGCCTGTGGGGCTTCCAAGG + Intergenic
1016894385 6:149037932-149037954 TAAGGCATCTGGGGCCTCCGAGG + Intronic
1019922638 7:4172703-4172725 TGCTGCCTCTGAGGGCTCCAGGG + Intronic
1021629358 7:22629286-22629308 TATTCCCTCTGGAGGCTCCAGGG - Intronic
1022901187 7:34812090-34812112 TAGTGGCTCTGGGCTGTCCATGG - Intronic
1023578817 7:41659421-41659443 TTCTGCCTCTGGGGACCCCAGGG + Intergenic
1024095427 7:45979006-45979028 TTGGGCCTCTGGGCCATCCAGGG - Intergenic
1028334628 7:89636609-89636631 TAGGGACTTTGGGACCTCCAAGG + Intergenic
1029019385 7:97348283-97348305 TGGTGCCTGTGTAGCCTCCAGGG - Intergenic
1029253000 7:99250387-99250409 TTGTGCCCCTGGGGCAGCCAGGG - Intergenic
1029597440 7:101545335-101545357 CAGGGCTCCTGGGGCCTCCAGGG + Exonic
1030096632 7:105906484-105906506 TACTGCTTCTGGGGCCTGGAGGG + Intronic
1033340923 7:140491647-140491669 TTCTGCTTCTGTGGCCTCCACGG - Intergenic
1033422573 7:141216876-141216898 TCCTGCCTCTGTGGGCTCCAAGG + Intronic
1034979289 7:155466223-155466245 TGGTTCCTCTCGGGCCTCCCGGG + Intergenic
1035203129 7:157279332-157279354 GAGAGCCTCTGGGGACTCCAGGG + Intergenic
1035820790 8:2589457-2589479 AACAGGCTCTGGGGCCTCCAGGG - Intergenic
1038484784 8:27926909-27926931 TGGTGCCTCTTGGAGCTCCAGGG - Intronic
1038535016 8:28347538-28347560 TGGTGTTTCTGGAGCCTCCAGGG - Exonic
1039576255 8:38626256-38626278 TAGGGCCTGCTGGGCCTCCAGGG - Intergenic
1040391549 8:46954837-46954859 GAGTGCCGCCCGGGCCTCCAGGG + Intergenic
1040610526 8:48977879-48977901 AAGTGCCCCTGGGGTCGCCAGGG - Intergenic
1041317441 8:56579214-56579236 AAGTTTCTCTGGGGCCTCCTTGG + Intergenic
1041539546 8:58967484-58967506 TGGTGCCTCTGGAGGCTACATGG - Intronic
1047499969 8:125432825-125432847 TGGTGACTCTGCAGCCTCCAAGG - Intronic
1047781696 8:128116728-128116750 TAGGGCCCCTGGTGACTCCAGGG - Intergenic
1048167737 8:132078352-132078374 TTGTGCCTCTGTCTCCTCCATGG + Intronic
1048354703 8:133643494-133643516 TGCTGCCTCTGGGCCCTCCAGGG - Intergenic
1048577198 8:135702104-135702126 TAGTGCCTGTGAGGACTGCAGGG + Intergenic
1049284544 8:141767409-141767431 CAGTGCCCCAGGGGCCTACAAGG - Intergenic
1049598530 8:143496311-143496333 CAGTGGCTCTCGGCCCTCCATGG - Intronic
1056084232 9:83129113-83129135 TAGTGCCTTTGGGGCCAAAATGG + Intergenic
1056551679 9:87658166-87658188 GGGAGCCTCTGGCGCCTCCAGGG + Intronic
1056835812 9:89954243-89954265 TGTGGCCTCTGGGGCGTCCAGGG - Intergenic
1057068041 9:92073385-92073407 TAGGTCCTTTGGGGCCTTCACGG - Intronic
1058651705 9:107181064-107181086 TACTCCCTCTGGAGGCTCCAGGG + Intergenic
1059336106 9:113569331-113569353 CAGTGCCTCTGGGGACCACATGG + Intronic
1061590734 9:131596054-131596076 TAGTGACCCCAGGGCCTCCAGGG - Intronic
1061876610 9:133547230-133547252 CAGGGCCCCTGGGGCCCCCAAGG - Intronic
1062058611 9:134482472-134482494 TAGTGCCTCTGGGGCTGTGATGG + Intergenic
1062207770 9:135346778-135346800 TGGTGGCCCTGGGGCCTCCCTGG + Intergenic
1062227749 9:135463098-135463120 TGGTCCCTCTGGGGTCTCCTGGG + Intergenic
1186960289 X:14729227-14729249 TAGTGCCTCTGGTGACTCAGAGG + Intronic
1190221299 X:48514112-48514134 TGGTGCCCCTAGGGCCCCCAGGG - Exonic
1194872409 X:99148284-99148306 TAGTGTCTCATGTGCCTCCAAGG - Intergenic
1196831051 X:119775836-119775858 TAGCTCCTCGTGGGCCTCCAGGG + Intergenic
1196928182 X:120654956-120654978 CAGTGCCTGTGGGCCCTCAATGG - Intergenic
1198535167 X:137578071-137578093 GAGTGCCTCTGTGGCATCCAGGG + Intergenic
1200218783 X:154380458-154380480 TGGTGGCTCTTGGGCCTCCGGGG + Intronic
1201508700 Y:14733894-14733916 TACTTCCTCTGGGGCTTCCAGGG - Intronic