ID: 1121128760

View in Genome Browser
Species Human (GRCh38)
Location 14:91426889-91426911
Sequence TTTCTTTTCTGTGGCATCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121128760_1121128762 -7 Left 1121128760 14:91426889-91426911 CCGATGATGCCACAGAAAAGAAA No data
Right 1121128762 14:91426905-91426927 AAAGAAAAACCCATTTTCTGAGG 0: 874
1: 1680
2: 1421
3: 975
4: 1275
1121128760_1121128763 -6 Left 1121128760 14:91426889-91426911 CCGATGATGCCACAGAAAAGAAA No data
Right 1121128763 14:91426906-91426928 AAGAAAAACCCATTTTCTGAGGG 0: 16
1: 43
2: 62
3: 125
4: 660
1121128760_1121128764 -5 Left 1121128760 14:91426889-91426911 CCGATGATGCCACAGAAAAGAAA No data
Right 1121128764 14:91426907-91426929 AGAAAAACCCATTTTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121128760 Original CRISPR TTTCTTTTCTGTGGCATCAT CGG (reversed) Intergenic
No off target data available for this crispr