ID: 1121135070

View in Genome Browser
Species Human (GRCh38)
Location 14:91489917-91489939
Sequence TCCCATTGGGTGATGCGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121135070 Original CRISPR TCCCATTGGGTGATGCGTAA AGG (reversed) Intronic
905713845 1:40131308-40131330 TCCCATTGGGGAATGGGTCAGGG - Intergenic
910072659 1:83237687-83237709 TCCCATAGGGTGATGCCAAGAGG - Intergenic
915027572 1:152845406-152845428 ACCCATTGTGTGATGTTTAAAGG - Intergenic
919139155 1:193548719-193548741 TCTCATTAGGTGAAGAGTAATGG - Intergenic
1063908928 10:10810479-10810501 CCCCATTGGGGGATGCTTAAGGG - Intergenic
1068612307 10:59073611-59073633 TCCCACAGGGTGATGCAAAAAGG + Intergenic
1075520649 10:123141758-123141780 TCTCTTTGGGTGATGCAGAAAGG - Intergenic
1082711778 11:56561354-56561376 TCCCACTGGGTCCTGCGTAATGG + Intergenic
1088294668 11:108278812-108278834 CCCCATTAGGTTATGCCTAATGG - Intronic
1089195110 11:116689725-116689747 GCCCATTGGGTCATTCATAAGGG - Intergenic
1091054367 11:132404519-132404541 TCCTATTGGGTGATCCATGATGG + Intergenic
1092084353 12:5743316-5743338 GCACATTCGGTGATGAGTAAAGG + Intronic
1097430589 12:59500255-59500277 TCATATTGGGTGATGCGGAGAGG - Intergenic
1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG + Intronic
1104629944 12:130391793-130391815 ACCCATGGGGGCATGCGTAAGGG + Intergenic
1114630800 14:24158247-24158269 TCCCACCGTGTGATGGGTAAAGG + Intronic
1115049611 14:29041794-29041816 TCCTATTGGGTGATATGTAAAGG - Intergenic
1117205971 14:53443979-53444001 TGCCATTGGGGGATGCTAAATGG + Intergenic
1118700224 14:68425746-68425768 TGGTATTGGGTGATGGGTAAAGG + Intronic
1119878071 14:78077200-78077222 TCCCATGGGGTGAGGGGAAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1124249535 15:28097759-28097781 TCCCAGTTGGTGATGGGTGATGG - Intronic
1125813704 15:42565268-42565290 CCACTTTGGCTGATGCGTAAAGG + Intronic
1129953041 15:79608862-79608884 TGCCATAGGGTGATGAGTGAGGG - Intergenic
1146470592 17:33121323-33121345 CCCCACTGGGTGATTCCTAAAGG - Intronic
1151322915 17:73362218-73362240 TCCCATGGGATGCTGCATAAGGG - Intronic
1153134564 18:1899897-1899919 TCCAGTTGGGTGATGTGTAAGGG + Intergenic
1153811208 18:8753505-8753527 GCCCATTGGGTCATGCTTACTGG - Intronic
1164914433 19:32039686-32039708 TCTCATTGCGTGATGCGTGAAGG - Intergenic
931384595 2:61786687-61786709 TCCAACTGGCTGATGTGTAAAGG + Intergenic
943587041 2:189753082-189753104 TCCCATTTTGAGATGGGTAATGG + Intronic
944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG + Intronic
944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG + Exonic
949034851 2:241811674-241811696 TCCCATTGGGAGATGCATGTGGG - Intronic
1171523395 20:25792403-25792425 TCCCACTGGGTGATCAGGAATGG + Intronic
1171553431 20:26063480-26063502 TCCCACTGGGTGATCAGGAATGG - Intergenic
1179886800 21:44317682-44317704 TCCCACTGGGTGCTGCGAAGGGG + Intronic
951173789 3:19575516-19575538 TCCCAGTGGGTAATGAATAAAGG - Intergenic
953173142 3:40525349-40525371 TCCCAGTGGGTGATGCTGACCGG - Intronic
954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG + Intronic
966334798 3:178856139-178856161 GCCCATTGGGTGATGGGGAATGG - Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
977169546 4:93743754-93743776 TCCCATTAGGTGGGGCCTAATGG - Intronic
992041427 5:72837072-72837094 TGCAATTGGGTAATGGGTAAAGG - Intronic
998229103 5:140348159-140348181 TCCTTTTGGGTGATGAGTATCGG + Intergenic
1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG + Intergenic
1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG + Intergenic
1008765471 6:54908165-54908187 TCAGAGTGGGTGCTGCGTAAAGG + Intronic
1010275369 6:73962689-73962711 TCCCATTGGGTAGAGCTTAAAGG + Intergenic
1019759531 7:2800138-2800160 TCCCATTTGTTGCTGGGTAATGG - Intronic
1020617759 7:10480750-10480772 TCCCATTGGTTGACGGATAAGGG + Intergenic
1023013554 7:35943927-35943949 AACCATTGGCTGATGAGTAAGGG - Intergenic
1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG + Intergenic
1025106135 7:56173808-56173830 TGCCACTGGGTGATGGGTATGGG + Intergenic
1025126839 7:56351505-56351527 AACCATTGGCTGATGAGTAAGGG - Intergenic
1026316309 7:69230700-69230722 TGCCACTGGGTGATGGGTATGGG + Intergenic
1027290381 7:76702842-76702864 TCCCATAGGGTGATGCCAAGAGG - Intergenic
1034921963 7:155090789-155090811 TCACATTAGGTGATGTGTAAAGG - Intergenic
1036455205 8:8900556-8900578 TCCCATTGAGTGATGCCCAGTGG - Intergenic
1037853229 8:22349994-22350016 TCCCAGTGGGTGATATATAAAGG + Intronic
1039377648 8:37052257-37052279 TCCAATTTGGTGATGAATAAAGG - Intergenic
1050771751 9:9209952-9209974 TCCCATGGGGTGATGCAGAAGGG + Intronic
1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG + Exonic
1059046710 9:110876969-110876991 GCCCATTAGGTGAGGTGTAATGG - Intronic
1189265888 X:39715876-39715898 TCCCAGTGGGAGGTGGGTAAAGG + Intergenic
1191830391 X:65408507-65408529 TCCCGAAGGGTGAGGCGTAAGGG - Intronic
1192180004 X:68910500-68910522 TCTCATGGGGTGATGGGAAAGGG + Intergenic
1199340491 X:146671515-146671537 TCCCATTGGATCATTGGTAATGG - Intergenic