ID: 1121136375

View in Genome Browser
Species Human (GRCh38)
Location 14:91502561-91502583
Sequence TAGGGTGGAAAAGCTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121136375_1121136384 11 Left 1121136375 14:91502561-91502583 CCCCCAAAAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1121136384 14:91502595-91502617 CTCCTTTTCTAATCACAGTAGGG 0: 1
1: 0
2: 1
3: 14
4: 145
1121136375_1121136386 18 Left 1121136375 14:91502561-91502583 CCCCCAAAAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1121136386 14:91502602-91502624 TCTAATCACAGTAGGGATAGAGG 0: 1
1: 0
2: 1
3: 15
4: 155
1121136375_1121136383 10 Left 1121136375 14:91502561-91502583 CCCCCAAAAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1121136383 14:91502594-91502616 CCTCCTTTTCTAATCACAGTAGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121136375 Original CRISPR TAGGGTGGAAAAGCTTTTGG GGG (reversed) Intronic
901847958 1:11996463-11996485 AAGGATGTAAGAGCTTTTGGGGG + Intronic
902051483 1:13567038-13567060 TGGGGTGGCAAAAATTTTGGGGG - Intergenic
902266460 1:15270305-15270327 TTGGGTGGCAAAGTGTTTGGTGG + Intronic
904138528 1:28333086-28333108 TAGGGTGAATAAGATTTTGGAGG + Intronic
904622391 1:31783169-31783191 TTGTGTGGAAAAGCCTCTGGAGG + Intergenic
905060056 1:35132543-35132565 TAGGGATGACAAGTTTTTGGGGG + Intergenic
905927163 1:41759611-41759633 GTGGGTGGAAAACCTTTTGGAGG - Intronic
907598832 1:55746134-55746156 GAGGGTAGAACAGGTTTTGGTGG - Intergenic
907600852 1:55767907-55767929 TTGGGTTTAAAAGCTTTTGCAGG - Intergenic
908852759 1:68390982-68391004 TAGGGATGACAAGATTTTGGGGG - Intergenic
909737272 1:78978076-78978098 TCATGTGGAAAAGATTTTGGGGG + Intronic
910853810 1:91673824-91673846 TTGGGTGGAGCAGCTTTTGCTGG - Intergenic
912296812 1:108477652-108477674 TAGGGATGACAAGTTTTTGGGGG - Intergenic
912536763 1:110379613-110379635 TAGGGGGGGCAAGTTTTTGGAGG + Intronic
914338194 1:146736225-146736247 GGGGGAGGAAAAGCTTTTGGAGG - Intergenic
917497396 1:175553291-175553313 GAGGGTGGAAAAAGTGTTGGTGG - Intronic
918058820 1:181045175-181045197 TAGGGATGAAATGTTTTTGGAGG + Intronic
919437228 1:197576779-197576801 AAAGGTAGAAAAGGTTTTGGGGG + Intronic
919775779 1:201193111-201193133 TGGGTTAGAAAAGCTCTTGGGGG + Intronic
920875015 1:209826883-209826905 GGGGATGGAAAAGCTTTTGAAGG - Intergenic
921571902 1:216789874-216789896 CAGGGTGGAACAGATTTTGATGG - Intronic
923853792 1:237824309-237824331 CATGGTGGATAAGCTTTTCGAGG - Intronic
1064762532 10:18635984-18636006 CAAGGAGGAAAAGTTTTTGGTGG + Intronic
1064762798 10:18638575-18638597 CAAGGAGGAAAAGTTTTTGGTGG + Intronic
1065595116 10:27303006-27303028 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1065606365 10:27422020-27422042 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1066472334 10:35711297-35711319 AATAGTGGAAAAGCTTTCGGAGG - Intergenic
1066558866 10:36646562-36646584 TGGGGTGTAATATCTTTTGGGGG + Intergenic
1066790694 10:39059625-39059647 GAGGCTGGAAATGCTTTTGTTGG + Intergenic
1070002584 10:72391674-72391696 TACGTTGGAAAAATTTTTGGAGG + Intronic
1071758326 10:88571323-88571345 AAAGGGGAAAAAGCTTTTGGAGG + Intronic
1073519695 10:104116289-104116311 TAGGATGGTCAGGCTTTTGGAGG - Intergenic
1073684705 10:105739491-105739513 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1074067271 10:110027941-110027963 TTGGGTAGAAAAGGTTGTGGGGG + Intronic
1074786578 10:116847513-116847535 TAGGGTGGAAAAGTAGTTTGAGG - Intergenic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1077092799 11:787341-787363 TAGAGTAGAACTGCTTTTGGCGG - Exonic
1079463198 11:20702868-20702890 CATGGTGGATAAGCTTTTTGAGG + Intronic
1085430930 11:76446897-76446919 TAGGGAGGACAAGCTCTTTGGGG + Intronic
1087505599 11:99017034-99017056 TGTGGTGGTCAAGCTTTTGGTGG - Intergenic
1088221126 11:107570913-107570935 TAGAGTGTGAAAGTTTTTGGGGG - Intergenic
1088855899 11:113753297-113753319 TTGGTTGGAAAAGCTCTTGAAGG + Intronic
1089744616 11:120607987-120608009 GAGGGTGGAAAAGCTTTCGCTGG + Intronic
1093024288 12:14232517-14232539 TAGGGTGGTAAAGCGTTTAAAGG - Intergenic
1093648403 12:21615799-21615821 TAGGGTGGAAAGGGTGGTGGTGG - Intergenic
1096591458 12:52662638-52662660 TAGGGTGGAGAACCTGTAGGAGG - Intergenic
1096598776 12:52714740-52714762 CAGGCTGGAAGAGCTGTTGGTGG - Intergenic
1096969197 12:55651899-55651921 AAGGGTGGAAAAGCTGTCAGTGG - Intergenic
1097293911 12:57943022-57943044 AAGGTTGGAAAATCTTTCGGTGG - Intronic
1097577116 12:61408823-61408845 TAGCCTCGAATAGCTTTTGGTGG - Intergenic
1102248436 12:111369346-111369368 TAGCCTGCAAAAGCATTTGGGGG + Intergenic
1102460219 12:113095255-113095277 CAGGGTGGAGAAGCATCTGGAGG - Intronic
1106957206 13:34953537-34953559 TTGGGAGGAATAGCTTTTAGGGG - Intronic
1108268932 13:48739528-48739550 AAGAGAAGAAAAGCTTTTGGCGG - Intergenic
1108882236 13:55134260-55134282 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1110593596 13:77293505-77293527 TAGGGTATAGAAGTTTTTGGAGG - Intronic
1111458427 13:88513323-88513345 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
1112898564 13:104332239-104332261 TGTGGTGGACAAGCTTTTTGAGG + Intergenic
1114764477 14:25355554-25355576 TATGCTGGAAAGTCTTTTGGGGG + Intergenic
1116545736 14:46163497-46163519 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1117986203 14:61388446-61388468 TGGGGTGGAAAGGCCTTTGTGGG + Intronic
1118136298 14:63031900-63031922 AAGGGTGGAACAGCTTTTTAGGG + Intronic
1119380513 14:74225304-74225326 TTTGGTGGAAAAGCGTTGGGAGG + Intergenic
1120081583 14:80223412-80223434 TGGGCTGGAAAAGGTTTTGTAGG + Intronic
1121136375 14:91502561-91502583 TAGGGTGGAAAAGCTTTTGGGGG - Intronic
1121704048 14:95977881-95977903 TAGGGTTGACAAGTTTTTTGGGG - Intergenic
1121844171 14:97158761-97158783 GCAGATGGAAAAGCTTTTGGTGG + Intergenic
1123804974 15:23861170-23861192 TGGGGTGGGAGAGCTTGTGGTGG + Intergenic
1124668943 15:31620126-31620148 CATGGTGGACAAGCTTTTTGAGG + Intronic
1124669909 15:31629452-31629474 CATGGTGGATAAGCTTTTTGAGG + Intronic
1124682045 15:31740213-31740235 GAGGCTGGAACAGCTTCTGGTGG + Intronic
1126058610 15:44756606-44756628 TAGGGTGGAAAGGAATATGGTGG + Intronic
1126127381 15:45308219-45308241 TGGGGAGGAAGAGGTTTTGGAGG + Intergenic
1128352645 15:66901309-66901331 GAAGGAGGAAAAGATTTTGGTGG + Intergenic
1129966028 15:79736491-79736513 TAGGGTGAAACACCTTTGGGAGG - Intergenic
1131579600 15:93629474-93629496 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1132326639 15:100975383-100975405 GAGGGTGGAAAAGCTGTTAAAGG + Intronic
1133651745 16:7819410-7819432 TAGGGATGACAAGTTTTTGGGGG - Intergenic
1134851519 16:17482746-17482768 TGATATGGAAAAGCTTTTGGTGG - Intergenic
1138209901 16:55154822-55154844 GAGGGTGAAAGAGCTCTTGGGGG + Intergenic
1138428161 16:56950360-56950382 TGGAGTGGGAAAGCTTTAGGAGG - Intergenic
1138664968 16:58558535-58558557 AGGGGTGGAAATGCTTTTGCTGG + Exonic
1139850501 16:69949288-69949310 TAGGGTGGAGCAACTTTTGAAGG - Intergenic
1139879485 16:70172200-70172222 TAGGGTGGAGCAACTTTTGAAGG - Intergenic
1139996086 16:70981116-70981138 GGGGGAGGAAAAGCTTTTGGAGG + Intronic
1140050392 16:71475696-71475718 GAGTGTGGCAAAGCTTTTGTTGG - Exonic
1140290511 16:73650597-73650619 AAGGGTGGAAGTGATTTTGGAGG - Intergenic
1140373039 16:74423348-74423370 TAGGGTGGAGCAACTTTTGAAGG + Intergenic
1140958798 16:79892836-79892858 TGGGGTACAAGAGCTTTTGGAGG - Intergenic
1144264471 17:13554907-13554929 TAGGGTGGAATAGAGTTAGGGGG - Intronic
1146320574 17:31843392-31843414 TTGGGTGGAAAATCTTTTCTGGG + Intergenic
1148536426 17:48442799-48442821 TAGGGTGGAAAATGGGTTGGTGG - Intergenic
1149140476 17:53427428-53427450 GAGGGCGGAGAAGATTTTGGAGG - Intergenic
1151048990 17:70955341-70955363 TTGGAGGGAAAAGCTTATGGAGG + Intergenic
1155040107 18:22057963-22057985 CAGGGTGGAAAGTATTTTGGGGG - Intergenic
1155982315 18:32194300-32194322 CAGGGTGGAAAAGATTATAGGGG - Intronic
1156038833 18:32796137-32796159 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1157615161 18:48982525-48982547 TAGGGAGCAAAAGGTTCTGGGGG - Intergenic
1158992513 18:62884267-62884289 TAAGGAGGAAAAGCTTTGGAAGG + Intronic
1159293918 18:66456203-66456225 TAGTGAGGATAAGGTTTTGGAGG - Intergenic
1159594638 18:70371026-70371048 GAGGATGGAAATGCCTTTGGGGG - Intergenic
1159819144 18:73117763-73117785 TAGGGTAGAAGAGATTTGGGAGG + Intergenic
1165133117 19:33645599-33645621 GTGGGTGGAACAGCTGTTGGAGG + Intronic
1167633131 19:50638288-50638310 TAGGGTAGGAAAGCAGTTGGAGG + Intronic
1167956513 19:53069479-53069501 GAGTGTGGAAAAGCCTTTAGAGG - Exonic
1168211680 19:54895268-54895290 TAGGGATGACAAGTTTTTGGGGG + Intergenic
925544908 2:5005698-5005720 TAGGGATGACAAGTTTTTGGGGG - Intergenic
928867280 2:35932157-35932179 TAGAGTGGAAAAGCTTTTTTAGG - Intergenic
929384255 2:41385212-41385234 TGGGGTGGCAAAAATTTTGGGGG - Intergenic
931121040 2:59220017-59220039 TAGATTGGAAAAGCATTTGAAGG + Intergenic
931872804 2:66479401-66479423 TATGCTGGAAAAGCTTTTTATGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932624923 2:73289952-73289974 AAGAGTGGAAAAGCTTTGGGTGG + Intergenic
933679715 2:85089094-85089116 TAAGGTGGAAATGCCTTTGCGGG - Intergenic
936367879 2:111876847-111876869 TAGGGTTGACGAGGTTTTGGAGG - Intronic
936871071 2:117134637-117134659 TGGGGTGGCAAAAATTTTGGGGG - Intergenic
937159673 2:119748100-119748122 TAGGGCGTAAAAACTTATGGAGG + Intergenic
938677417 2:133652491-133652513 TTGAGTGGAAAAGCTTTTAATGG - Intergenic
938921557 2:135999970-135999992 TAGGGTGGGGAAGTGTTTGGTGG + Intergenic
939093735 2:137808415-137808437 TAAAGTGGAAAAGCCTTGGGAGG + Intergenic
940183459 2:150958777-150958799 TAGGGATGACAAGTTTTTGGGGG - Intergenic
940508260 2:154583101-154583123 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
940637605 2:156318365-156318387 GAGGAAGCAAAAGCTTTTGGGGG - Intergenic
942729905 2:179052544-179052566 TAGGGATGACAAGATTTTGGGGG + Intergenic
943266088 2:185734845-185734867 TAGGTTGGAAAAGTTTCTGATGG + Intergenic
943592376 2:189814429-189814451 TTGGGGGGAAAAGATTTTTGTGG - Intronic
943791091 2:191933434-191933456 GAAGGTGGAACAGCTGTTGGAGG + Intergenic
943791102 2:191933471-191933493 GAAGGTGGAACAGCTGTTGGAGG + Intergenic
945376525 2:209083346-209083368 TAGGGTTGACAAGTTTTTTGGGG - Intergenic
1173432939 20:43007642-43007664 TACGGTAGAAAAGCTTTGGGTGG - Intronic
1176947112 21:14995818-14995840 TAGTGTGGAAAATGTGTTGGAGG - Intronic
1177036611 21:16051555-16051577 AAGGGTGGCAAAGCTACTGGGGG + Intergenic
1178672307 21:34602712-34602734 TAAGAAGGAAAAGCTTTTGCTGG - Intronic
1181033957 22:20161119-20161141 TGGGGTGGAACAGCTTTCAGGGG - Intergenic
1181960092 22:26616570-26616592 GAGGGTGGAACAGCTAGTGGAGG - Intronic
950525581 3:13520917-13520939 AGGGGTGGAAAGGCCTTTGGGGG - Intergenic
951298459 3:20968504-20968526 TAGGGATGACAAGTTTTTGGGGG + Intergenic
952310084 3:32180780-32180802 TAAGGTGGCAAAGCCTTTTGTGG - Intergenic
952967514 3:38630457-38630479 TTGTGTAGAAAGGCTTTTGGGGG + Intronic
953036566 3:39216811-39216833 GAAGGTGGAAATGCTTTTTGTGG - Intergenic
953164227 3:40450215-40450237 TAGGGTGGATTTGCTTTAGGGGG - Intergenic
954588291 3:51756320-51756342 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
956795264 3:72712696-72712718 CATGGTGGATAAGCTTTTAGAGG + Intergenic
957394324 3:79619754-79619776 TAGGGTGGTAAAGCTTCTAAGGG - Intronic
957721750 3:84011382-84011404 CATGGTGGATAAGCTTTTTGAGG - Intergenic
957768615 3:84658777-84658799 GAGGGTGCAAAAGCTGCTGGTGG - Intergenic
961892057 3:130138587-130138609 TAGGGATGACAAGCTTTTTGGGG + Intergenic
963109397 3:141673958-141673980 CATGGTGGAAAAGCTTTCTGAGG - Intergenic
963215050 3:142736389-142736411 TATGGTTAAAAAGATTTTGGAGG + Exonic
967496579 3:190149218-190149240 TAGGGATGACAAGTTTTTGGGGG - Intergenic
968416814 4:444700-444722 TGGGGAGGAAGAGCTGTTGGTGG - Intronic
969819189 4:9707690-9707712 TATGCTGGAAATGCTTCTGGTGG + Intergenic
969969717 4:11033103-11033125 TAGGTTGAAATAGATTTTGGAGG + Intergenic
970042417 4:11810999-11811021 TAGGGATGACAAGATTTTGGGGG - Intergenic
970543702 4:17105505-17105527 TAAGATGGAAAAGCTCTGGGAGG - Intergenic
971556444 4:28018149-28018171 GAGGGTGAAAAAACTTTTGGAGG - Intergenic
974600524 4:64073911-64073933 CACGGTGGATAAGCTTTTTGAGG - Intergenic
974802799 4:66840448-66840470 TAGGGAAGTAAATCTTTTGGAGG + Intergenic
976719132 4:88153286-88153308 TAGGGATGACAAGTTTTTGGGGG + Intronic
976884211 4:89965754-89965776 TAGGGATGACAAGTTTTTGGGGG + Intergenic
977224910 4:94383907-94383929 TAGGGATGACAAGTTTTTGGGGG + Intergenic
977358675 4:95978331-95978353 CAGGGTGGAAAACCTTTTAAAGG + Intergenic
977434173 4:96972287-96972309 TAGGTTGGATAAGCTTTTGTTGG - Intergenic
978464876 4:108997756-108997778 CATGGTGGATAAGCTTTTTGAGG - Intronic
979461275 4:120987074-120987096 TGTGGTGGATAAGCTTTTTGAGG + Intergenic
979725762 4:123958994-123959016 CATGGTGGATAAGCTTTTTGAGG - Intergenic
980012920 4:127616670-127616692 TAGGGTAGAATGTCTTTTGGGGG + Intergenic
980727754 4:136787165-136787187 GAGGGAGGAACAGTTTTTGGAGG + Intergenic
980849079 4:138358513-138358535 TGTGGTGGATAAGCTTTTTGAGG - Intergenic
981372830 4:143979769-143979791 TAGGGAGGAAAAAGTTTTCGAGG - Intergenic
981470826 4:145132540-145132562 TAGGGTGCAAAAGTTTATGAAGG + Intronic
981514596 4:145593678-145593700 CATGGTGGATAAGCTTTTTGAGG + Intergenic
983659930 4:170121168-170121190 TAGGGATGAAAAGTTTTTTGGGG - Intergenic
983746103 4:171202364-171202386 AAGAGTGGAAGAGCTTTTGAAGG - Intergenic
983805436 4:171987024-171987046 TAGGGATGACAAGTTTTTGGGGG + Intronic
984916864 4:184733256-184733278 TAGGGTGGAAAAGCTGGAGCAGG - Intronic
987220963 5:15790039-15790061 CAGTGTGGAAATGATTTTGGAGG - Intronic
987750520 5:22032973-22032995 TATTTTAGAAAAGCTTTTGGGGG - Intronic
988630275 5:32922538-32922560 CACGGTGGATAAGCTTTTTGAGG - Intergenic
989987220 5:50714883-50714905 CAGTGTGGAAAAGCTAGTGGTGG - Intronic
993262091 5:85670736-85670758 TAAGTTGGAAAATCTTTTGTGGG + Intergenic
994805247 5:104438505-104438527 TAGGTTGGAAATGCTTTTATAGG + Intergenic
995905131 5:117114154-117114176 CAGGGTGGATAAGCGTTTTGAGG + Intergenic
996139256 5:119885717-119885739 AATGGTAGAACAGCTTTTGGGGG + Intergenic
996213057 5:120835199-120835221 CATGGTGGATAAGCTTTTTGAGG - Intergenic
996668587 5:126089733-126089755 TGTGGTGGATAAGCTTTTTGAGG - Intergenic
997668224 5:135649243-135649265 TAGGGTGGAAAAGAGTTCTGTGG + Intergenic
998319398 5:141215310-141215332 TAGGGTGTAAAAGTTTTCCGCGG - Exonic
998884331 5:146678174-146678196 CATGGTGGATAAGCTTTTTGAGG - Intronic
1000675913 5:164122283-164122305 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1000935278 5:167298917-167298939 TAGGGATGACAAGTTTTTGGGGG + Intronic
1001763147 5:174223914-174223936 TAGGGCAGAAAAGCTAGTGGAGG - Intronic
1001801133 5:174545131-174545153 TAGGGCTGAAAAGCCCTTGGAGG + Intergenic
1003519037 6:6841984-6842006 TTGGGAGGAAAAGCTTAGGGAGG - Intergenic
1004130475 6:12914613-12914635 GAAGGAGGAAAATCTTTTGGTGG - Intronic
1004436155 6:15596231-15596253 TAAGAAGGAAAAGATTTTGGAGG + Intronic
1005524990 6:26637973-26637995 GAGTGTGAAAAAGCTTTTAGTGG - Exonic
1007508752 6:42359099-42359121 ACAGGTGGTAAAGCTTTTGGAGG + Intronic
1008819344 6:55611595-55611617 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1010091978 6:71993341-71993363 TAGAGAGGAAAAGCTTCAGGTGG + Intronic
1010789669 6:80050441-80050463 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1011014017 6:82735341-82735363 TAGGGTAAAAAGGTTTTTGGCGG + Intergenic
1012587562 6:100942549-100942571 TGTGGTGGACAAGCTTTTTGAGG + Intergenic
1014614315 6:123583290-123583312 TAGGGATGACAAGTTTTTGGGGG + Intronic
1015022710 6:128495670-128495692 TAGTGTGAAAAAGGGTTTGGAGG - Intronic
1017080934 6:150667881-150667903 TGGGCTGGAAAAGCTTTTAAAGG - Intronic
1017653893 6:156608456-156608478 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1018353892 6:162992099-162992121 CATGGTGGATAAGCTTTTTGAGG + Intronic
1019083024 6:169448935-169448957 AAGGGTGGAAGAGATTTTGGAGG - Intergenic
1023017850 7:35984291-35984313 TAGGTTGCTAAAGCTTTGGGAGG + Intergenic
1024738437 7:52330519-52330541 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1027852309 7:83464375-83464397 TAGGGATGACAAGTTTTTGGGGG - Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1028508231 7:91593426-91593448 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1029641857 7:101826080-101826102 TGGGATGGAAAAGGTTTAGGTGG - Intronic
1030510388 7:110475990-110476012 CATGGTGGATAAGCTTTTTGAGG - Intergenic
1031354773 7:120777583-120777605 TAGGGATGACAAGTTTTTGGGGG + Intergenic
1033557672 7:142502729-142502751 TGGAGTGGAAAGGCCTTTGGTGG - Intergenic
1036847820 8:12181672-12181694 TCTGGTGGAAAAGCTAGTGGGGG + Intergenic
1036869188 8:12423987-12424009 TCTGGTGGAAAAGCTAGTGGGGG + Intergenic
1038839389 8:31167493-31167515 TAGCCTGGAAAATCTTTCGGAGG + Intronic
1038867521 8:31455986-31456008 TAGGGTAGAAATGTGTTTGGTGG - Intergenic
1040458615 8:47625019-47625041 CATGGTGGATAAGCTTTTTGAGG - Intronic
1041175507 8:55192857-55192879 TAGGGTGGAAGAGGCTGTGGGGG + Intronic
1041323911 8:56644593-56644615 TAGGATGGAAAAGCCTTTTTGGG + Intergenic
1041955896 8:63558041-63558063 CACTGTGGAAAAGATTTTGGAGG + Intergenic
1042996378 8:74704024-74704046 TAGGGTGGTAACTCTTTTGAGGG + Intronic
1044030113 8:87225599-87225621 CATGGTGGATAAGCTTTTTGAGG + Intronic
1044882714 8:96740822-96740844 CATGGTGGATAAGCTTTTTGAGG + Intronic
1044967978 8:97591940-97591962 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1045238717 8:100379066-100379088 GAGGGTGGGTAAGATTTTGGAGG - Intronic
1045309077 8:100984928-100984950 AAGGCTGAAAAAGCTTTTTGCGG - Intergenic
1045950929 8:107850831-107850853 TATGGTGGAAAAGATGCTGGAGG + Intergenic
1050257676 9:3811857-3811879 TAGGGATGACAAGTTTTTGGGGG + Intergenic
1050373812 9:4950068-4950090 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1050416192 9:5419793-5419815 CATGGTGGAAAAGAGTTTGGTGG + Intronic
1051049614 9:12915556-12915578 CAGGGTGGAAAAAATTTTGGAGG - Intergenic
1053252813 9:36589104-36589126 TAGTGTTGAACAGTTTTTGGGGG + Intronic
1057682181 9:97198931-97198953 GAGTGTGAAAAAGCTTTTAGTGG - Intergenic
1057741229 9:97713323-97713345 GAGGGTCCAAAAGATTTTGGGGG - Intergenic
1058177396 9:101752802-101752824 TAGGATTGAAAGGATTTTGGAGG + Intergenic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1186079102 X:5911348-5911370 TAGGGAGGAAGAGTTTATGGTGG - Intronic
1187208507 X:17206124-17206146 GTGGGTGGAAAAGCATGTGGAGG - Intergenic
1191581785 X:62770616-62770638 CAGGTTGGAAAAGCTTCTTGTGG - Intergenic
1191826069 X:65365587-65365609 TGGGGTGGCAAAAATTTTGGGGG - Intergenic
1191917854 X:66221665-66221687 TAGGGTGTAAAGGGTTTTGTCGG + Intronic
1192837366 X:74815472-74815494 CAGTGTGGAAAATGTTTTGGAGG - Intronic
1192914178 X:75636034-75636056 TAGGGTGGTAAAGCATTTAAGGG + Intergenic
1193267711 X:79493103-79493125 TCAGTTGGAATAGCTTTTGGAGG - Intergenic
1193595093 X:83435903-83435925 CATGGTGGATAAGCTTTTTGAGG + Intergenic
1194185823 X:90773816-90773838 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
1195016516 X:100786839-100786861 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
1196497324 X:116336368-116336390 TCGGGTGGCAAAAATTTTGGGGG - Intergenic
1196754111 X:119143101-119143123 TGGGGAGGAAAACCTTCTGGTGG - Intronic
1197101784 X:122664790-122664812 TAGGGAGGAAAACTTTTTGGAGG - Intergenic
1197865779 X:131015211-131015233 TAGAGTGCAGAAGATTTTGGGGG - Intergenic
1198966396 X:142232041-142232063 TAGGGATGACAAGCTTTTGGGGG - Intergenic
1198983293 X:142423841-142423863 TGGGGTGGTGAAGATTTTGGGGG + Intergenic
1199946838 X:152676844-152676866 GATGGTGGATAAGCTTTTTGAGG + Intergenic
1200532443 Y:4355897-4355919 TGGGGTGGCAAAAATTTTGGGGG + Intergenic
1202190899 Y:22243392-22243414 TGTGGTGGATAAGCTTTTTGAGG + Intergenic
1202607025 Y:26647914-26647936 TAGGGTGGAAAAGAATTTAATGG + Intergenic