ID: 1121137303

View in Genome Browser
Species Human (GRCh38)
Location 14:91510294-91510316
Sequence CCCCGCGCGCCGCTTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121137303_1121137312 1 Left 1121137303 14:91510294-91510316 CCCCTCAAAAGCGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1121137312 14:91510318-91510340 CACCCAGGGAGCAGCTGCAGGGG 0: 1
1: 0
2: 6
3: 66
4: 591
1121137303_1121137311 0 Left 1121137303 14:91510294-91510316 CCCCTCAAAAGCGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1121137311 14:91510317-91510339 CCACCCAGGGAGCAGCTGCAGGG 0: 1
1: 0
2: 3
3: 67
4: 401
1121137303_1121137309 -1 Left 1121137303 14:91510294-91510316 CCCCTCAAAAGCGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1121137309 14:91510316-91510338 GCCACCCAGGGAGCAGCTGCAGG 0: 1
1: 0
2: 3
3: 63
4: 479
1121137303_1121137315 4 Left 1121137303 14:91510294-91510316 CCCCTCAAAAGCGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1121137315 14:91510321-91510343 CCAGGGAGCAGCTGCAGGGGCGG 0: 1
1: 0
2: 11
3: 83
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121137303 Original CRISPR CCCCGCGCGCCGCTTTTGAG GGG (reversed) Intronic
904755324 1:32765707-32765729 CCCCGCGCTCTGCTCTGGAGAGG + Intronic
924957688 1:248945022-248945044 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
1076963536 10:133786536-133786558 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
1077152443 11:1078307-1078329 CCCAGCGCGCCGAGTGTGAGAGG + Intergenic
1094767348 12:33612289-33612311 ACCCGCGCACTGCTGTTGAGAGG - Intergenic
1098893371 12:76031607-76031629 CCCCTCGCGGCGCTTTTGAATGG + Exonic
1101037292 12:100717677-100717699 CCGTGCGCGCCGCTCCTGAGGGG + Intronic
1113989972 13:114353415-114353437 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
1121137303 14:91510294-91510316 CCCCGCGCGCCGCTTTTGAGGGG - Intronic
1129385788 15:75195629-75195651 CCCAGCGGGCCGCTAATGAGGGG + Intronic
1132683838 16:1154122-1154144 CCCCGCGCGCCCCTGTTGGTGGG + Intronic
1132953250 16:2576873-2576895 GCCCGTGGGCCGCTTCTGAGTGG - Intronic
1132961102 16:2623295-2623317 GCCCGTGGGCCGCTTCTGAGTGG + Intergenic
1142178555 16:88656245-88656267 CCCGGCGAGCCACTTCTGAGAGG + Exonic
1144171838 17:12665790-12665812 CCCCGCTCGCCGCTCCTGATTGG + Intergenic
1153515144 18:5895382-5895404 GCCCTCGCGCCTCTTTTGTGTGG + Exonic
1161038063 19:2096403-2096425 CCCTGCACGCCGCTTCTGCGCGG - Intronic
1161560190 19:4968938-4968960 CACCGCGCGCCGCGATTGGGCGG - Intergenic
1168728747 19:58607247-58607269 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
936569831 2:113603708-113603730 GCCGGCGCGCCGCCTTTGCGAGG - Intergenic
937134877 2:119544198-119544220 TCCCGCGCTCCGCTCTTGAAGGG + Intergenic
949088966 2:242182777-242182799 CGCCCCGCGCCGCCTTTGCGAGG + Intergenic
1175465891 20:59191236-59191258 CCCCGCGCCCCGCTAGTGACGGG + Exonic
1180264222 21:46699315-46699337 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
1185430383 22:50807261-50807283 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
961234852 3:125357409-125357431 CCCCGCACGCCTCTTTTTGGGGG - Intronic
967965623 3:194957934-194957956 CACCCCGCCCCACTTTTGAGGGG + Intergenic
983090250 4:163494312-163494334 CACCGAGCGGCCCTTTTGAGAGG + Intergenic
983247343 4:165303495-165303517 CCCCCCCCGCCGTTTTTGGGTGG + Intronic
984585101 4:181554254-181554276 CACCGCCCGCAGCTTTTCAGTGG - Intergenic
985466790 4:190203979-190204001 GCCGGCGCGCCGCCTTTGCGAGG + Intergenic
1006177018 6:32128568-32128590 CACAGTGCGCCCCTTTTGAGGGG - Intergenic
1028373286 7:90118969-90118991 CCCCGCGCGCCGCCTCTGCACGG - Intergenic
1029863739 7:103603183-103603205 CCACGTTCCCCGCTTTTGAGTGG - Intronic
1057226986 9:93297697-93297719 CCCTGTGTGCCGCTTTAGAGTGG + Intronic
1188416703 X:29944187-29944209 CCCTGCCCCCCGCTTTTTAGGGG - Intronic