ID: 1121137803

View in Genome Browser
Species Human (GRCh38)
Location 14:91513973-91513995
Sequence TGTGCTACTGCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 518413
Summary {0: 871, 1: 29296, 2: 92969, 3: 183618, 4: 211659}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121137803_1121137804 10 Left 1121137803 14:91513973-91513995 CCAGGCTGGAGTGCAGTAGCACA 0: 871
1: 29296
2: 92969
3: 183618
4: 211659
Right 1121137804 14:91514006-91514028 ACTGCAACCTCTGTCTCCCCAGG No data
1121137803_1121137806 17 Left 1121137803 14:91513973-91513995 CCAGGCTGGAGTGCAGTAGCACA 0: 871
1: 29296
2: 92969
3: 183618
4: 211659
Right 1121137806 14:91514013-91514035 CCTCTGTCTCCCCAGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121137803 Original CRISPR TGTGCTACTGCACTCCAGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr