ID: 1121137806

View in Genome Browser
Species Human (GRCh38)
Location 14:91514013-91514035
Sequence CCTCTGTCTCCCCAGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121137803_1121137806 17 Left 1121137803 14:91513973-91513995 CCAGGCTGGAGTGCAGTAGCACA 0: 871
1: 29296
2: 92969
3: 183618
4: 211659
Right 1121137806 14:91514013-91514035 CCTCTGTCTCCCCAGGTTCAAGG No data
1121137802_1121137806 18 Left 1121137802 14:91513972-91513994 CCCAGGCTGGAGTGCAGTAGCAC 0: 1535
1: 57576
2: 157039
3: 215405
4: 181973
Right 1121137806 14:91514013-91514035 CCTCTGTCTCCCCAGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121137806 Original CRISPR CCTCTGTCTCCCCAGGTTCA AGG Intergenic
No off target data available for this crispr