ID: 1121139308

View in Genome Browser
Species Human (GRCh38)
Location 14:91526960-91526982
Sequence TTGATTTGTCAAGTATAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121139308 Original CRISPR TTGATTTGTCAAGTATAGAT CGG (reversed) Intergenic
No off target data available for this crispr