ID: 1121145994

View in Genome Browser
Species Human (GRCh38)
Location 14:91582867-91582889
Sequence TTGGATGCAGGACAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 0, 2: 21, 3: 151, 4: 1074}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121145989_1121145994 13 Left 1121145989 14:91582831-91582853 CCTCACTCTTCAATTGTTAGTGT 0: 1
1: 1
2: 13
3: 30
4: 191
Right 1121145994 14:91582867-91582889 TTGGATGCAGGACAGGAACATGG 0: 1
1: 0
2: 21
3: 151
4: 1074
1121145988_1121145994 16 Left 1121145988 14:91582828-91582850 CCTCCTCACTCTTCAATTGTTAG 0: 1
1: 3
2: 17
3: 59
4: 242
Right 1121145994 14:91582867-91582889 TTGGATGCAGGACAGGAACATGG 0: 1
1: 0
2: 21
3: 151
4: 1074
1121145987_1121145994 17 Left 1121145987 14:91582827-91582849 CCCTCCTCACTCTTCAATTGTTA 0: 1
1: 4
2: 32
3: 85
4: 331
Right 1121145994 14:91582867-91582889 TTGGATGCAGGACAGGAACATGG 0: 1
1: 0
2: 21
3: 151
4: 1074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121145994 Original CRISPR TTGGATGCAGGACAGGAACA TGG Intronic
900241188 1:1618352-1618374 ATGGATGCTGGACAGGTCCAGGG + Intronic
900465402 1:2822788-2822810 GTGGTTGCAGGACAGGAAGGGGG + Intergenic
900487930 1:2932300-2932322 GGGGATGCAGGACAGAGACAGGG + Intergenic
902285031 1:15402413-15402435 TTGGGTGCAGCACACCAACATGG - Intergenic
902295756 1:15465897-15465919 ATGGATGGAAGACAGGAACAGGG + Intronic
902749763 1:18499557-18499579 CTGGATGCTGGACAAGAACCCGG + Intergenic
902924997 1:19690203-19690225 TTGGATGCTGGACAAGAGCTTGG + Intronic
903182843 1:21613737-21613759 TGGGCAGCAGGACAGGAAAATGG + Intronic
903647445 1:24903753-24903775 TTTGAGGCAGCACAGGATCAAGG + Intronic
904443845 1:30551567-30551589 CTGGATGCAGGACAAGAACAGGG + Intergenic
904496199 1:30888236-30888258 TGGGATTCAGGACTGGAGCAGGG + Intronic
904551837 1:31325307-31325329 CTGGATGCAAGACAAGAACTTGG + Intronic
904673760 1:32184854-32184876 TTGGACTCAGGCCAGGAACAAGG - Intronic
904732648 1:32606536-32606558 TCGGATGCAGGAAAAGAACTCGG - Intronic
905707185 1:40069649-40069671 TGGTATGAAGGACAGGAACAAGG + Intronic
905839537 1:41162926-41162948 CTGGTTGCAGGACAAGAACTCGG + Intronic
905927487 1:41762311-41762333 TTGGATGTGGGACAAGAACTTGG + Intronic
906051764 1:42880382-42880404 CTGGATGCAGGACAAGAACTCGG - Intergenic
906132388 1:43468458-43468480 CTGGACGCAGGACAAGAACTTGG - Intergenic
906351669 1:45065940-45065962 ATGGATGCAGCACAGCAACATGG - Intronic
906448189 1:45921892-45921914 TTGGATGCAGGACAAGAACTCGG - Intronic
906605966 1:47171968-47171990 ATGGGTGCAGCACACGAACATGG + Intergenic
907153021 1:52306510-52306532 CTGGATGCAGGACAAGAACTCGG + Intronic
907227428 1:52961156-52961178 ATGGATGCAGCACACCAACATGG - Intronic
907252981 1:53155410-53155432 CTGGATGCAGGACAAGAACTCGG + Intergenic
907603747 1:55794907-55794929 CTGGATGCAGGACAAGAACACGG + Intergenic
907614857 1:55913313-55913335 CTGGGTGCAGGACAAGAACTCGG + Intergenic
907616283 1:55930097-55930119 TTGGATGCTGGACAAGAGCTCGG - Intergenic
907991409 1:59586570-59586592 ATGGATGCAGCACACCAACATGG + Intronic
908102244 1:60803597-60803619 ATGGATGCAGCACACCAACATGG - Intergenic
908678000 1:66627827-66627849 ATGGATGCAGCACACCAACATGG - Intronic
909344682 1:74571767-74571789 AGCGATGCAGGACAGGAACTCGG - Exonic
909870835 1:80736141-80736163 ATGGGTGCAGCACAGCAACATGG + Intergenic
909880424 1:80869400-80869422 TTGGGTGCAGCACACCAACATGG - Intergenic
910744362 1:90557219-90557241 ATGGATGCAGCACACCAACATGG + Intergenic
911021044 1:93388076-93388098 TTGGGTGCAGCACACCAACATGG - Intergenic
911025715 1:93434108-93434130 CTGGATGTGGGACAGGAACTTGG - Intergenic
911186548 1:94910247-94910269 TTAGATGAAGGACAGAAAGAAGG - Intronic
911608606 1:99936211-99936233 TTGGATGCAGGAGAAGAGCTCGG + Intergenic
911643647 1:100315887-100315909 TTGGACGCAGGACAAGAACCTGG - Intergenic
911728977 1:101272129-101272151 ATGGGTGCAGGACACCAACATGG - Intergenic
911791352 1:102019326-102019348 ATGGATGCAGCACACCAACATGG + Intergenic
911839444 1:102661288-102661310 TTGGTCGCAGGACAAGAACCTGG + Intergenic
911865741 1:103019666-103019688 GTGGATGCAGCACACCAACATGG - Intronic
912041449 1:105396587-105396609 CTGGATGCTGGACAAGAACATGG - Intergenic
912064335 1:105718436-105718458 ATGGGTGCAGCACAGCAACATGG - Intergenic
912081516 1:105943386-105943408 ATGGATGCAGCACACCAACATGG - Intergenic
912098029 1:106169312-106169334 ATGGATGCAGCACACCAACACGG + Intergenic
912495361 1:110088256-110088278 CAGGGTGCAGGACAGAAACATGG + Intergenic
912752564 1:112297921-112297943 TTTGAAGCAGGACCAGAACATGG + Intergenic
913018367 1:114762661-114762683 ATGGGTGCAGGACACCAACATGG + Intergenic
913400667 1:118429255-118429277 ATGGATGCAGCACACTAACATGG + Intergenic
913401356 1:118438082-118438104 ATGGATGCAGCACACGAACATGG - Intergenic
913710986 1:121483175-121483197 ATGGATGCAGCACACCAACATGG + Intergenic
913995407 1:143648321-143648343 ATGGGTGCAGCACACGAACATGG + Intergenic
914961031 1:152207734-152207756 ATGGATGCAGCACAGTAACATGG - Intergenic
914967544 1:152273956-152273978 ATGGGTGCAGCACAGCAACATGG + Intergenic
915015034 1:152725104-152725126 ATGGATGCAGCACACTAACATGG - Intergenic
915185049 1:154098408-154098430 CTGGATGCAGGACAAGAACTTGG - Intronic
915499031 1:156301785-156301807 TTGGATGCATGACAAGAACTCGG + Intergenic
915701345 1:157799704-157799726 ATGGGTGCAGCACACGAACATGG + Intronic
915763793 1:158342137-158342159 ATGGATGCAGCACACTAACATGG + Intergenic
915854936 1:159373047-159373069 ATGGATGCAGCACACCAACATGG + Intergenic
916337766 1:163692560-163692582 CTGGATGCTGGACAAGAACCCGG - Intergenic
916565260 1:165970116-165970138 CTGGGTGCAGCACACGAACATGG + Intergenic
917072353 1:171165953-171165975 TGGAATGCAGGAGAGGAAAAGGG + Intergenic
917365742 1:174230310-174230332 ATGGATGCAGCACACCAACATGG + Intronic
917442553 1:175080140-175080162 CTGCAGGCAGAACAGGAACAGGG - Intronic
917637536 1:176951361-176951383 ATGGATGCAGGATAGAAACCTGG + Intronic
918834747 1:189446853-189446875 TTGGGTGCAGCACACCAACATGG + Intergenic
918943996 1:191037883-191037905 TTGGTTGCAGCACACCAACATGG - Intergenic
919010829 1:191960727-191960749 ATGGGTGCAGCACAGCAACATGG - Intergenic
919048788 1:192487023-192487045 ATGGATGCAGCACACCAACATGG - Intergenic
919165234 1:193884530-193884552 CTGGATGCAGGACAAGAACTTGG - Intergenic
919234093 1:194814888-194814910 ATGGGTGCAGCACAGCAACATGG + Intergenic
919299654 1:195744064-195744086 TTGGAGGCAGGACAAGAGCTAGG + Intergenic
919656338 1:200200825-200200847 CTGGATGCTGGACAAGAACCTGG + Intergenic
920088779 1:203437555-203437577 ATGGATGCAGCACACCAACATGG + Intergenic
920937118 1:210445953-210445975 ATGGATGCAGCACACCAACATGG - Intronic
920986154 1:210891452-210891474 ATGGGTGCAGCACACGAACATGG + Intronic
921090206 1:211834923-211834945 ATGGGTGCAGCACAGCAACATGG + Intergenic
921117146 1:212103375-212103397 TTGGAGGCAGAACAGAACCAGGG - Exonic
921686351 1:218093385-218093407 TTGATTGTAGGACAAGAACAAGG + Intergenic
921705929 1:218323269-218323291 CTGGATGCAGCACAAGAACTCGG - Intronic
921846910 1:219892741-219892763 ATGGGTGCAGCACAGCAACATGG + Intronic
921902390 1:220463963-220463985 CTGGATGCAGGACAAGAGCTTGG + Intergenic
922286783 1:224177194-224177216 ATGGGTGCAGGACACCAACATGG + Intronic
923213250 1:231825636-231825658 TTGGATGCAGGCAATGACCAGGG - Intronic
923670884 1:236040301-236040323 TTGGTGGCAGGACAAGGACAGGG - Intronic
923870555 1:237988848-237988870 TTGGGTGCAGCACACCAACATGG + Intergenic
923926532 1:238635078-238635100 ATGGGTGCAGCACAGCAACATGG - Intergenic
1063276885 10:4578909-4578931 ATGGATGCAGCACACCAACATGG + Intergenic
1063331878 10:5167692-5167714 CTGGATGCAGCACACCAACATGG + Intergenic
1063481072 10:6377052-6377074 TTTGATGATGGACAGGATCAGGG + Intergenic
1063537675 10:6900922-6900944 TTGGATGCTGGACAAGAGCTCGG - Intergenic
1064612856 10:17121609-17121631 ATGGATGCAGCACACCAACATGG + Intronic
1065304341 10:24354521-24354543 CTGGATGCAGGACAAGGACTTGG - Intronic
1065613041 10:27491349-27491371 TTGGATGTGGGACAAGAACTCGG - Intergenic
1066021576 10:31309149-31309171 ATGGGTGCAGCACAGCAACATGG - Intergenic
1066594178 10:37030665-37030687 ATGGATGCAGCACACCAACATGG + Intergenic
1066647848 10:37628197-37628219 ATGGGTGCAGGACACCAACATGG - Intergenic
1066724151 10:38372732-38372754 TTGGGTGCAGCACACCAACATGG - Intergenic
1067053558 10:43038723-43038745 TTGGAAGCTGGAGAGGAGCAGGG - Intergenic
1067567597 10:47349953-47349975 CTGGAAGTAGGACAGGAGCAGGG - Exonic
1067893739 10:50157731-50157753 ATGGATGCAGCACACCAACATGG + Intergenic
1068018149 10:51544132-51544154 ATGGATGCAGCACACCAACATGG - Intronic
1068046152 10:51889138-51889160 ATGGGTGCAGCACAGCAACATGG - Intronic
1068130548 10:52890080-52890102 CTGGACGCAGGACAAGAACTTGG + Intergenic
1068137457 10:52964993-52965015 CTGGATGCAGGACAAGAACATGG - Intergenic
1068138377 10:52973678-52973700 TTGGTTGCAGGACAAGAACCTGG - Intergenic
1068157630 10:53222342-53222364 CTGGATGCAGGACAAGAACTTGG - Intergenic
1068348518 10:55814127-55814149 CTGGAGGCAGGACAAGAACTTGG + Intergenic
1068397754 10:56486101-56486123 TTGGGTGCAGCACACCAACATGG + Intergenic
1069255198 10:66323786-66323808 TGGGATACAGGATAGGGACATGG - Intronic
1069255741 10:66330146-66330168 ATGGATGCAGCACACCAACATGG - Intronic
1069408559 10:68128215-68128237 TGGGATACAGGAAAGGATCACGG - Intronic
1069732091 10:70623456-70623478 TTGGATACAGGACAAGAACTTGG + Intergenic
1070240287 10:74673718-74673740 CTGGATGCCGGACAAGAACTCGG - Intronic
1070420563 10:76232687-76232709 TTGGGTGCAAGACAAGAACTCGG - Intronic
1070454956 10:76603724-76603746 ATGGATGCAGCACACCAACATGG + Intergenic
1070673835 10:78398322-78398344 TTGGAGGCAGAATAGAAACATGG + Intergenic
1071052984 10:81473714-81473736 TTGGATGCGGGACAAGAACTCGG + Intergenic
1071099337 10:82017013-82017035 ATGGATGCAGCACACCAACATGG - Intronic
1071740248 10:88350310-88350332 ATGGATGCAGCACATCAACATGG - Intronic
1071744089 10:88395106-88395128 ATGGATGCAGCACACCAACATGG + Intronic
1072034185 10:91549533-91549555 TTGTATGCAGGCCAGGCACTGGG + Intergenic
1072095420 10:92173761-92173783 TTGGATGCTGCACATGAACATGG - Intronic
1072220012 10:93318892-93318914 GTGGAGGCAGGAATGGAACAGGG + Intronic
1072408073 10:95173326-95173348 TTGGGTGCAGCACACCAACATGG - Intergenic
1073227998 10:101940530-101940552 TTGGGTGCAGCACACCAACATGG - Intronic
1073322614 10:102624850-102624872 GTGGAGGGAGGACAGGAAGAGGG - Intronic
1073697954 10:105892059-105892081 ATGGATGCAGCACAACAACATGG + Intergenic
1073792519 10:106954902-106954924 TTGGATGCAGGACAAGAACCTGG + Intronic
1074301748 10:112239914-112239936 CTGGATGCAGGATAAGAACTTGG - Intergenic
1074731163 10:116377096-116377118 TTGGGTGCAGCACACCAACATGG + Intronic
1074808391 10:117077556-117077578 ATGGGTGCAGCACAGCAACATGG - Intronic
1074811403 10:117108619-117108641 ATGGGTGCAGCACAGCAACATGG + Intronic
1075125422 10:119695191-119695213 CTGGATGCATGACAAGAACTTGG - Intergenic
1078124606 11:8548074-8548096 ATGGATGCAGCACACCAACATGG + Intronic
1078780562 11:14434983-14435005 TTGGGTGCAGTACACCAACATGG + Intergenic
1078794193 11:14575338-14575360 ATGGATGCAGCACACCAACATGG - Intronic
1078803176 11:14667751-14667773 ATGGGTGCAGCACAGCAACATGG + Intronic
1078904589 11:15671958-15671980 CTGGTTCCAGGAAAGGAACATGG + Intergenic
1079355066 11:19723785-19723807 GTGGCAGGAGGACAGGAACAAGG - Intronic
1079472244 11:20789628-20789650 CTGGTTGCAGGACAAGAACTTGG - Intronic
1079958188 11:26889693-26889715 TTGGGTGCAGCACACCAACATGG + Intergenic
1080080821 11:28216640-28216662 ATGGGTGCAGCACAGCAACATGG - Intronic
1080420151 11:32102695-32102717 CTGGAGGCTGCACAGGAACATGG - Intronic
1080435909 11:32244106-32244128 TTGGAGCCAGGCTAGGAACAGGG + Intergenic
1080851935 11:36077900-36077922 CCGGATGCAGGACAAGAACTAGG - Intronic
1081153716 11:39663829-39663851 TTGGATGTGGGACAAGAACTTGG + Intergenic
1081179158 11:39966154-39966176 CTGGATGCTGGACAAGAACCCGG + Intergenic
1081344370 11:41965024-41965046 ATGGATGCAGCACAACAACATGG - Intergenic
1081378080 11:42382862-42382884 TTGGGTGCAGCACACCAACATGG + Intergenic
1081405618 11:42694069-42694091 ATGGGTGCAGGACAGCAACATGG + Intergenic
1081492122 11:43577253-43577275 CTGGATGCAGGAGAGGGATACGG + Intronic
1081495261 11:43602794-43602816 TGGGAAACAGCACAGGAACATGG + Intronic
1082222934 11:49663606-49663628 TTGGGACAAGGACAGGAACAAGG + Intergenic
1082661728 11:55920336-55920358 CTGGAGGCAGGACAAGAACTTGG + Intergenic
1082743669 11:56939138-56939160 ATGGGTGCAGGACACCAACATGG - Intergenic
1083054198 11:59804015-59804037 TTGGGCGGAGGACAGGGACAGGG + Intergenic
1084449066 11:69222058-69222080 TTGGAAGCAGGAAAGGAAATAGG - Intergenic
1084740980 11:71139415-71139437 ATGGGTGCAGCACAGCAACATGG + Intronic
1085100668 11:73797303-73797325 CTGGTTGCAGGACAAGAACTTGG + Intronic
1085749042 11:79143589-79143611 ATGGGTGCAGCACAGCAACATGG + Intronic
1086030281 11:82346192-82346214 ATGGGTGCAGCACACGAACATGG + Intergenic
1086638323 11:89118922-89118944 ATGGATGCAGCACACCAACATGG + Intergenic
1086779489 11:90884525-90884547 TTGGAGGGAGGTCAGCAACAAGG - Intergenic
1087037839 11:93772612-93772634 CTGGTTGCAGGACAAGAACTTGG - Intronic
1087102195 11:94376421-94376443 ATGGATGCAGCACACCAACATGG + Intergenic
1087210999 11:95446506-95446528 CTGGAATCAGGACAGGAACTTGG - Intergenic
1087231901 11:95675612-95675634 TGGGATGGAGGAAAGGAACTGGG + Intergenic
1087243911 11:95811492-95811514 ATGGGTGCAGCACAGCAACATGG + Intronic
1087391192 11:97537362-97537384 CTGAATGCAGGACAAGAACTCGG + Intergenic
1087398408 11:97633047-97633069 ATGGGTGCAGCACATGAACATGG - Intergenic
1087451688 11:98331631-98331653 ATGGGTGCAGCACAGCAACATGG - Intergenic
1087499689 11:98933956-98933978 CTGGAAGCAGGGCAAGAACATGG + Intergenic
1088328773 11:108628860-108628882 TTGGACACAGGACAAGAACTTGG - Intergenic
1088651199 11:111959108-111959130 CTGGATGCAGGGCAGGAACTTGG + Intronic
1088655132 11:111991817-111991839 TTGGAAGCAGGATAGCAGCAAGG + Intronic
1088704210 11:112447388-112447410 TTGGATGCAGGAAAAGAACTCGG - Intergenic
1090079496 11:123602450-123602472 TTGGGTGCAGCACACCAACATGG - Intronic
1090215755 11:124962727-124962749 ATGGATGCAGCACACCAACATGG - Intronic
1091925727 12:4346667-4346689 ATGGATGCAGCACACCAACATGG + Intronic
1092085477 12:5755484-5755506 ATGGGTGCAGCACACGAACATGG - Intronic
1092492234 12:8956128-8956150 TTGGACGCAGGACAAGAACTCGG + Intronic
1092518827 12:9244939-9244961 TTGCATTCAGGGCAGGAACATGG + Intergenic
1092550487 12:9494086-9494108 ATGGGTGCAGCACAGCAACATGG - Intergenic
1092707045 12:11296271-11296293 ATGGATGCAGCACACCAACATGG + Intergenic
1092795637 12:12107912-12107934 TTGGATGCAGGACAAGAGCTTGG - Intronic
1092910174 12:13139573-13139595 TTGGATGTAGGACAGGATGAGGG - Intronic
1092910180 12:13139597-13139619 TTGGATGCAGGACCAGATGAGGG - Intronic
1092910190 12:13139645-13139667 TTGGATGTGGGACAGGATGAGGG - Intronic
1092910226 12:13139813-13139835 TTGGATGTGGGACAGGATGAGGG - Intronic
1092910243 12:13139885-13139907 TTGGATGTAGGACTGGATGAGGG - Intronic
1092910248 12:13139909-13139931 TTGGATGCTGGACAGGATGAGGG - Intronic
1092910253 12:13139933-13139955 TTGGATGTGGGACAGGATGAGGG - Intronic
1092910259 12:13139957-13139979 TTGGATGTAGGACGGGATGAGGG - Intronic
1092910274 12:13140029-13140051 TTGGATGCTGGACAGGATGAGGG - Intronic
1092910279 12:13140053-13140075 TTGGATGTGGGACAGGATGAGGG - Intronic
1092910317 12:13140221-13140243 TTGGATGTGGGACAGGATGAGGG - Intronic
1092910323 12:13140245-13140267 TTGGATGTAGGACGGGATAAGGG - Intronic
1092910329 12:13140269-13140291 TTGGATGTAGGACGGGATAAGGG - Intronic
1092910341 12:13140316-13140338 TTGGATGTAGGACTGGATGAGGG - Intronic
1092910363 12:13140393-13140415 TTGGATGTAGGACGGGATGAGGG - Intronic
1092910381 12:13140464-13140486 TTGGATGTAGGACGGGATGAGGG - Intronic
1092910393 12:13140512-13140534 TTGGATGTAGGACGGGATGAGGG - Intronic
1092910417 12:13140608-13140630 TTGGATGTAGGACCGGATGAGGG - Intronic
1092910474 12:13140896-13140918 TTGGATGTAGGACAGGATGAGGG - Intronic
1092910480 12:13140920-13140942 TTGGATGTAGGACCAGAAGAGGG - Intronic
1092910507 12:13141064-13141086 TTGGATGTAGGACGGGATGAGGG - Intronic
1092910517 12:13141112-13141134 TTGGATGTAGGACGGGATGAGGG - Intronic
1093059534 12:14588759-14588781 TTGGATGCAGGACAAGAACTCGG - Intergenic
1093758709 12:22881223-22881245 TTGGATGCTGGACAAGAGCTCGG - Intergenic
1093782804 12:23156187-23156209 ATGGATGCAGCACAGCAACATGG - Intergenic
1094234811 12:28151626-28151648 ATGGATGCAGCACACCAACATGG - Intronic
1094313513 12:29112835-29112857 CTGCATGCAGGAAATGAACATGG + Intergenic
1094521860 12:31199445-31199467 ATGGGTGCAGCACAGAAACATGG - Intergenic
1094526230 12:31233140-31233162 CTGGCTGTAGGGCAGGAACAGGG - Intergenic
1095042386 12:37456454-37456476 CTGGATGCAGGACAAGAACTCGG + Intergenic
1095713583 12:45317200-45317222 CTGGATGCAGCACACCAACATGG - Intronic
1095804772 12:46307112-46307134 ATGGGTGCAGCACACGAACATGG - Intergenic
1096764643 12:53874508-53874530 ATGGATGCAGCACACCAACATGG - Intergenic
1096961037 12:55577944-55577966 ATGGGTGCAGGACACCAACATGG - Intergenic
1097140691 12:56900404-56900426 CTGGTTGCAGGACAAGAACTTGG + Intergenic
1097363472 12:58684353-58684375 GTGAATGCAGGACAAGAACATGG + Intronic
1097453663 12:59768005-59768027 ATGGATGCAGCACACCAACATGG + Intronic
1098008805 12:66028284-66028306 TTGGGTGCAGCACACCAACATGG - Intergenic
1098057877 12:66527587-66527609 ATGGATGCAGCACACCAACATGG + Intronic
1098222911 12:68289241-68289263 ATGGGTGCAGGACACCAACATGG + Intronic
1098331300 12:69356573-69356595 TTGGAAGCAAGGAAGGAACAAGG - Intergenic
1098488357 12:71047350-71047372 TTGGATGCCGGACAAGAGCTGGG - Intergenic
1099261834 12:80391853-80391875 GTGGGTGCAGCACAGCAACATGG + Intergenic
1099402420 12:82216236-82216258 TTGGATGCGGGATAAGAACTCGG + Intergenic
1099434675 12:82629204-82629226 ATGGGTGCAGGACACCAACATGG - Intergenic
1099566490 12:84254432-84254454 TTGGGTGCAGCACACCAACATGG + Intergenic
1100354848 12:93819221-93819243 CTGGATGAAGGGCAGGAACCAGG - Intronic
1100933083 12:99632838-99632860 CTGGGTGCAGGACACCAACATGG - Intronic
1101217328 12:102597165-102597187 CTGGATGCCGGACAAGAACTTGG - Intergenic
1101378017 12:104187749-104187771 CTGGATGCTGGACAAGAACCCGG - Intergenic
1101459682 12:104878391-104878413 ATGGGTGCAGCACAGCAACATGG - Intronic
1101524294 12:105513943-105513965 ATGGGTGCAGCACACGAACATGG - Intergenic
1102328489 12:112010371-112010393 CTGGATGCAGGACAAGAACTCGG - Intronic
1102970324 12:117161320-117161342 GTGGGTGCAGGAGAGGACCAAGG + Intronic
1103106714 12:118233315-118233337 ATGGATGCAGCACACCAACATGG + Intronic
1103238716 12:119396471-119396493 ATGGATGCAGCAGTGGAACAGGG + Intronic
1104307410 12:127621871-127621893 TTGGATGCTGGACAAGAGCTTGG - Intergenic
1104348869 12:128027546-128027568 TTGCATCCAGGACAGGACAATGG + Intergenic
1104365694 12:128174593-128174615 TTGAATGCAGGACTAGAACTTGG - Intergenic
1105234350 13:18533030-18533052 ATGGGTGCAGCACAGCAACATGG + Intergenic
1105424526 13:20283242-20283264 CTGGATGCAGGACAAGAACCTGG + Intergenic
1105621942 13:22076563-22076585 TCCCAAGCAGGACAGGAACATGG + Intergenic
1106576266 13:30978702-30978724 CTGGATGCAGGACAAGAATTTGG - Intergenic
1106614056 13:31310361-31310383 TTGGATGTGGGACAAGAACCTGG + Intronic
1107218152 13:37947004-37947026 TTGGGTGCAGCACACCAACATGG - Intergenic
1107407046 13:40124346-40124368 TTGGATGCATGTCAGAGACAAGG - Intergenic
1108145658 13:47473704-47473726 ATGGATGCAGCACACCAACATGG + Intergenic
1108464056 13:50696566-50696588 TTGGTTGCAGGACAAGAACCTGG - Intronic
1108746939 13:53405600-53405622 TTGGATGCTGGACAAGAGCTTGG + Intergenic
1108776853 13:53776124-53776146 CTGGCTGAAGGACAGGAAAAAGG + Intergenic
1108826309 13:54416370-54416392 TTGGATGCAGGATAAGAACTCGG - Intergenic
1109003802 13:56842626-56842648 ATGGATGCAGCACACCAACATGG - Intergenic
1109074785 13:57821231-57821253 TTGGATGCAGAACAAGAACTTGG - Intergenic
1109116759 13:58398363-58398385 TTGGATGTGGGACAAGAACTTGG - Intergenic
1109407872 13:61924556-61924578 TGGAGTGCAGGACAGGATCATGG + Intergenic
1109458855 13:62627498-62627520 CTGGATGCCGGACAAGAACCTGG - Intergenic
1109565784 13:64114971-64114993 ATGGATGCAGCACACCAACATGG - Intergenic
1109593729 13:64522595-64522617 TTGGATGTGGGACAAGAACTTGG - Intergenic
1109855980 13:68128733-68128755 TTGGATGCTGGACAAGAGCTCGG - Intergenic
1109962836 13:69655164-69655186 ATGGGTGCAGGACACCAACATGG - Intergenic
1110004998 13:70255328-70255350 TTGGATGCAGGACAAGAACCCGG + Intergenic
1110184244 13:72654825-72654847 TTGGATCCATGATAGGAAGAGGG - Intergenic
1110250050 13:73371308-73371330 TGGGATGCAGGACACAGACATGG - Intergenic
1110472371 13:75874551-75874573 TTGGATGTAGGACAGTGACTTGG + Intronic
1110789754 13:79574740-79574762 TTGGGTGCAGCACACCAACATGG + Intergenic
1110810725 13:79808320-79808342 TTGGTTGCAGGACAAGAACTTGG + Intergenic
1110968049 13:81726022-81726044 TTGGAAGCGGGACAAGAACCTGG + Intergenic
1111019019 13:82421450-82421472 ATGGGTGCAGCACAGCAACATGG + Intergenic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1111103976 13:83622103-83622125 CTGGATGCTGGACAAGAACTTGG + Intergenic
1111213797 13:85116500-85116522 ATGGGTGCAGGACACCAACATGG + Intergenic
1111408391 13:87841242-87841264 TTGGATGTGGGACAAGAACCTGG - Intergenic
1111423769 13:88052390-88052412 TTGGATGTGGGACAAGAACTCGG - Intergenic
1111512609 13:89286852-89286874 CTGGATGCAGGACAAGAACTCGG - Intergenic
1111519309 13:89379309-89379331 TTGGTTGCAGGACAAGAACCTGG + Intergenic
1111782127 13:92741665-92741687 ATGGGTGCAGCACAGCAACATGG - Intronic
1111782857 13:92751659-92751681 ATGGGTGCAGCACAGCAACATGG + Intronic
1111904733 13:94241997-94242019 ATGGGTGCAGCACAGCAACATGG - Intronic
1112049813 13:95634122-95634144 ATGGCTGCAGGACAGAAAGAAGG - Intronic
1112247103 13:97745329-97745351 CTAGATGCTGGACAAGAACACGG + Intergenic
1112699457 13:101988769-101988791 ATGGGTGCAGCACACGAACATGG + Intronic
1112724509 13:102287040-102287062 ATGGATGCAGCACACCAACATGG + Intronic
1113453262 13:110428353-110428375 TTGGATTCATGCCGGGAACATGG + Intronic
1113516023 13:110899452-110899474 ATGGATGTAGGAGAGGACCAAGG - Intronic
1113970755 13:114186434-114186456 CTGGATGCAGGACAAGAACTTGG + Intergenic
1114044255 14:18708183-18708205 ATGGATGCAGCACACCAACATGG + Intergenic
1114048534 14:18898633-18898655 ATGGATGCAGCACACCAACATGG + Intergenic
1114113978 14:19503013-19503035 ATGGATGCAGCACACCAACATGG - Intergenic
1114115677 14:19620765-19620787 ATGGATGCAGCACACCAACATGG - Intergenic
1114168687 14:20248933-20248955 ATGGATGCAGCACACCAACATGG - Intergenic
1114349514 14:21835186-21835208 CTGGTTGCAGGACAAGAACTTGG - Intergenic
1114676895 14:24447656-24447678 ATGGATGCAGCACACCAACATGG - Intergenic
1114992267 14:28301233-28301255 TTGGACACAGGACAAGAACCTGG + Intergenic
1115656297 14:35446911-35446933 GTGGATGAAGGACAGGGTCAGGG - Intergenic
1116143913 14:41038547-41038569 ATGGGTGCAGCACAGCAACATGG - Intergenic
1116167326 14:41350286-41350308 CTGGATGCTGGACAAGAACTCGG + Intergenic
1116379003 14:44240840-44240862 ATGGATGCAGCACACCAACATGG + Intergenic
1116526369 14:45910687-45910709 CTGGATGCTGGACAAGAACCTGG + Intergenic
1116591769 14:46786462-46786484 ATGGGTGCAGGACACCAACATGG - Intergenic
1116617324 14:47155251-47155273 CTGGATGCGGGACAAGAACTCGG + Intronic
1116789940 14:49329577-49329599 CTGGATGCAAGACAAGAACTTGG - Intergenic
1116961709 14:50973815-50973837 CTGGATACAGGACAAGAACTTGG + Intergenic
1117311420 14:54527374-54527396 ATGGGTGCAGGACACCAACATGG + Intronic
1117311588 14:54529941-54529963 TTGGATGCTGGCCAGGATGATGG - Intronic
1117414263 14:55479253-55479275 CTGGATGCAGGATAGCAGCAAGG - Intergenic
1117822910 14:59669518-59669540 ATGGATGCAGCAAATGAACATGG + Intronic
1118240025 14:64047076-64047098 TTGGATGCTGGACAAGAGCTTGG - Intronic
1118245034 14:64101979-64102001 TTGGAAGCATGACAAGGACATGG + Exonic
1118511219 14:66475481-66475503 ATGGATGCAGCACACCAACATGG + Intergenic
1118527880 14:66666163-66666185 ATGGGTGCAGCACAGCAACATGG + Intronic
1118841664 14:69517884-69517906 TGATATGCAGGACAGGGACATGG - Intronic
1118968465 14:70610694-70610716 TTAGAGGCAGAACAGGAAAATGG - Intergenic
1119093952 14:71811595-71811617 ATGGGTGCAGCACAGCAACATGG + Intergenic
1119253582 14:73179096-73179118 TTGGCTGCAGGAATGGAAAAGGG - Intronic
1119257112 14:73208273-73208295 CTGGATGCAGGACAAGAACTTGG - Intronic
1119358300 14:74025804-74025826 TTGATTTCAGGACTGGAACAGGG + Intronic
1120128212 14:80772520-80772542 CTGGATGCCGGACAGGACCTGGG + Intronic
1120804947 14:88737104-88737126 TTGGATGTGGGACAAGAACTTGG + Intronic
1121145994 14:91582867-91582889 TTGGATGCAGGACAGGAACATGG + Intronic
1121695284 14:95907540-95907562 CTGGATGCCGGACAAGAACTTGG - Intergenic
1121974108 14:98386335-98386357 TTGGATGCAGGACAAGAACTGGG + Intergenic
1122979646 14:105185743-105185765 CTGGAGGCAGGGCAGGTACAAGG + Intergenic
1202940912 14_KI270725v1_random:144179-144201 CTGGAAGCAGGACAAGAACTCGG + Intergenic
1123877055 15:24634004-24634026 ATGGATGCAGCACACCAACATGG - Intergenic
1123953713 15:25311927-25311949 ATGGATGCAGCACACCAACATGG - Intergenic
1124142125 15:27086908-27086930 CTGGATGCAGGACAAGGGCAGGG + Intronic
1124158528 15:27249307-27249329 TGGGATGCATGTGAGGAACAGGG - Intronic
1124405602 15:29389026-29389048 ATGGATGCAGCACACCAACATGG + Intronic
1125054266 15:35339095-35339117 ATGGGTGCAGCACAGCAACATGG + Intronic
1125415551 15:39448522-39448544 CTGGATGCAGGAGAGAAAGAAGG - Intergenic
1125436095 15:39646323-39646345 CTGGATGCAGGACAAGAACTCGG + Intronic
1125718222 15:41831818-41831840 CTGGATGCAGGACAAGAATTGGG + Intronic
1125733287 15:41906487-41906509 TTGGATGCAGGACAAAAGCTTGG + Intronic
1125862126 15:43009017-43009039 CTGGATGCAGGACAAGAACTCGG + Intronic
1126084241 15:44996235-44996257 TTGGGTGCAGCACACCAACATGG + Intergenic
1126130108 15:45332754-45332776 TTGGATGCAGGACAAGAGTTCGG + Intergenic
1126292550 15:47099064-47099086 CTGGATGCAGGACAAGAACTGGG - Intergenic
1126315031 15:47361124-47361146 TAGGATGCAAGAAAGGAAGAAGG - Intronic
1126803608 15:52322909-52322931 ATGGATGCAGCACACCAACATGG - Intronic
1127728873 15:61779687-61779709 TTTGATGCAAGGCAAGAACAGGG - Intergenic
1128368306 15:67020583-67020605 ATGGGTGCAGCACAGCAACATGG - Intergenic
1128421290 15:67493737-67493759 ATGGGTGCAGGACACTAACATGG - Intronic
1128843464 15:70869746-70869768 TTGGAAGCATAACAGGGACAAGG - Intronic
1129377685 15:75144500-75144522 CTGGATGCAGGACAAGAACTTGG - Intergenic
1129393397 15:75231782-75231804 TTGGAGGCAGCAGAGGCACAGGG - Intergenic
1129801865 15:78421046-78421068 CTGGATGCTGGACAAGAACCTGG - Intergenic
1130264688 15:82389760-82389782 ATGGGTGCAGGACACCAACATGG - Intergenic
1130769589 15:86911215-86911237 CTGCATGCAGGACTGGAACTGGG + Intronic
1130805014 15:87311324-87311346 ATGGATGCAGCACACCAACATGG - Intergenic
1130856062 15:87841066-87841088 CTGGATGCAGGACAAGAACTTGG - Intergenic
1130972679 15:88746366-88746388 ATGGATGCAGCACACCAACATGG - Intergenic
1131478333 15:92760674-92760696 ATGGGTGCAGCACAGCAACATGG + Intronic
1131633791 15:94208360-94208382 ATGGGTGCAGCACACGAACATGG - Intergenic
1131696519 15:94882656-94882678 TTGGATGCAGGACAAGAACTCGG - Intergenic
1131834788 15:96379589-96379611 ATGGGTGCAGGACACCAACATGG - Intergenic
1131885493 15:96907694-96907716 TTGGACGCCGGACAAGAACCCGG - Intergenic
1131978965 15:97977120-97977142 TTGGGTGCAGCACACCAACATGG - Intergenic
1132335677 15:101046873-101046895 TTTCATGCAGGGCAGGAACATGG + Intronic
1132971669 16:2692260-2692282 CTGGACGCAGAACAGGAACTTGG - Intronic
1133026107 16:2989605-2989627 GGGGAGGCAGGACAGGAACAGGG + Intergenic
1133215309 16:4288608-4288630 GTGGATGCCGAGCAGGAACACGG + Intergenic
1134078375 16:11308208-11308230 TTGGAAGCAAGACAAGAACTCGG - Intronic
1134813924 16:17190373-17190395 ATGGATGCAGCACACCAACATGG - Intronic
1135175072 16:20220869-20220891 TTGGATCCAGGACAGGGTTATGG + Intergenic
1135225715 16:20655310-20655332 ATGGGTGCAGCACAGCAACATGG + Intronic
1135232530 16:20722969-20722991 ATGGGTGCAGCACAGCAACATGG - Intronic
1135458568 16:22620517-22620539 ATGGATGCAGCACACCAACATGG + Intergenic
1135754330 16:25083806-25083828 TTGCCTGCAGGAGAGGAAGAGGG - Intergenic
1135780399 16:25294892-25294914 ATGGAGGCAGGACTTGAACAAGG + Intergenic
1135811932 16:25595628-25595650 ATGGATGCAGCACACCAACATGG - Intergenic
1135991342 16:27220615-27220637 CAGGATGCAGGACAGGAATGGGG - Exonic
1136451297 16:30355638-30355660 TTGAACCCAGGACAGGAAAACGG - Intergenic
1136679733 16:31951611-31951633 ATGGATCCAGGACAGAACCAAGG + Intergenic
1136890328 16:33966490-33966512 ATGGATCCAGGACAGAACCACGG - Intergenic
1137497792 16:48984087-48984109 TTGTATGCAGGAGATGAGCAAGG + Intergenic
1137692989 16:50442088-50442110 TTGGATGTGGGACAAGAACTTGG + Intergenic
1138689514 16:58754186-58754208 TTGGATGCAGGACAAGAATTTGG - Intergenic
1138891908 16:61153976-61153998 ATGGGTGCAGCACAGCAACACGG - Intergenic
1139559282 16:67731316-67731338 TTGAAGGTGGGACAGGAACATGG + Intronic
1139682422 16:68575316-68575338 TTGGATGCAGGACAAGAACTTGG - Intronic
1139800427 16:69518347-69518369 ATGGGTGCAGCACAGCAACATGG + Intergenic
1140103553 16:71938870-71938892 CTGGATGCAGGACAAGAACTCGG + Intronic
1140267183 16:73430704-73430726 TTTGCTGCAGGTCATGAACAGGG + Intergenic
1140278078 16:73528895-73528917 CTGGATGCAGGACAGGCATCTGG + Intergenic
1140419497 16:74806975-74806997 CTGGATGCAGGACAAAAACTCGG - Intergenic
1140469122 16:75204903-75204925 TTGGCTGCAGGACAGGAGGAGGG + Exonic
1140472662 16:75224036-75224058 TTGGCTGCAGGACAGGAGGAGGG - Exonic
1140550109 16:75856368-75856390 TTGGACGCTGGACAAGAACTTGG + Intergenic
1140589434 16:76334094-76334116 ATGGATGCAGCACACCAACATGG + Intronic
1141762614 16:86038703-86038725 TGGGAAGCAGGACAGGAAGCTGG - Intergenic
1142281343 16:89149561-89149583 TTGGACGCGGGACAAGAACTTGG - Intronic
1203082703 16_KI270728v1_random:1157124-1157146 ATGGATCCAGGACAGAACCACGG + Intergenic
1142759374 17:2034383-2034405 CTGGAACCAGCACAGGAACAGGG + Intronic
1142915171 17:3130588-3130610 ATGGGTGCAGGACACCAACATGG + Intergenic
1143888324 17:10083568-10083590 TTGGATGTGGGACAAGAACTTGG - Intronic
1144066487 17:11629176-11629198 ATGGGTGCAGGACACCAACATGG - Intronic
1144229384 17:13185146-13185168 TGGGATGCCTGACGGGAACAGGG + Intergenic
1144695546 17:17301714-17301736 CTGGATGCAGGACAAGAACTCGG + Intergenic
1145125333 17:20295099-20295121 ATGGGTGCAGGACACCAACATGG - Intronic
1145223082 17:21105182-21105204 TTGGATGCAGGACAAGAGCTTGG + Intergenic
1146143194 17:30387858-30387880 CTGGATGCAGGACAAGAACTTGG - Intronic
1146359239 17:32160402-32160424 CTGGATGCAGGACAAGAACTCGG + Intronic
1146365599 17:32223900-32223922 TAGTATGCATGACAAGAACAGGG - Intronic
1146837704 17:36125607-36125629 TTGGATGTGGGACAAGAACTTGG - Intergenic
1147462036 17:40579005-40579027 ATGGGTGCAGCACAGCAACATGG + Intergenic
1147507302 17:41032172-41032194 TTGGGTGCAGCACACCAACATGG + Intergenic
1148520997 17:48274870-48274892 TTGGAAACAGGACTGGAAGAGGG - Intronic
1148957599 17:51366444-51366466 TTGGACGCTGGACAAGAACCTGG + Intergenic
1149102925 17:52927906-52927928 TTGGATGCTGGACAAGGACCTGG - Intergenic
1149631934 17:58133122-58133144 ATGGATGCAGCACACCAACATGG + Intergenic
1150090366 17:62318970-62318992 TTGGATGCAGGAGAAGACTATGG + Intergenic
1150096513 17:62381076-62381098 ATGGATGCAGCACACCAACATGG - Intronic
1150932097 17:69596104-69596126 TTGGATGCCAGACAGGAGCTTGG + Intergenic
1151504935 17:74521544-74521566 TTGGCTGAAGGACAAGAAGAGGG + Exonic
1151659229 17:75509891-75509913 TGACAGGCAGGACAGGAACAGGG + Intronic
1152286716 17:79416929-79416951 TCGGATGCGGGTAAGGAACATGG - Intronic
1152442551 17:80317870-80317892 TTGGATGCTGGACAAGAGCTTGG - Intronic
1152530525 17:80916068-80916090 CTGGATGCAGGACAAGAACTTGG + Intronic
1152741578 17:82020713-82020735 ATGGATGGAGGACGGGGACAAGG + Intronic
1152989724 18:351813-351835 ATGGGTGCAGCACACGAACATGG - Intronic
1153139300 18:1954121-1954143 CTGGATGCAGGACAAGAACCCGG - Intergenic
1153857546 18:9165797-9165819 ATGGATGCAGCACACCAACATGG - Intronic
1153890590 18:9510824-9510846 ATGGATGCAGCACACCAACATGG - Intronic
1155414934 18:25587534-25587556 ATGGATGCAGCACACCAACATGG + Intergenic
1155786107 18:29901390-29901412 TTGGGTGCAGCACACCAACATGG + Intergenic
1155813943 18:30279461-30279483 TAGGATGAAGTACATGAACAGGG - Intergenic
1155924586 18:31641884-31641906 TTGAAAGCAGGACAGAAACTTGG - Intronic
1156728259 18:40157349-40157371 TTGGGTGCAGCACACCAACATGG - Intergenic
1157010832 18:43646266-43646288 ATGGATGCAGCACACCAACATGG + Intergenic
1157122868 18:44928009-44928031 ATGGATGCAGCACACCAACATGG - Intronic
1157169651 18:45391007-45391029 ATGGATGCAGCACACCAACATGG - Intronic
1157413771 18:47485376-47485398 TTGGAGGCAGAATAGGAAAAGGG + Intergenic
1158012857 18:52748679-52748701 TTGGATGCAGGACAAGAACCTGG - Intronic
1158083763 18:53626025-53626047 TTGGATGCAGGACAAAAGCTTGG + Intergenic
1158213141 18:55072217-55072239 TGGGATATAGGACAGGAAAAGGG + Intergenic
1158633056 18:59132753-59132775 CTGGACGCAGGACAAGAACTTGG + Intergenic
1158919302 18:62172278-62172300 TGGACTGCAGGACAGGAAAAAGG - Intronic
1159227523 18:65558198-65558220 ATGGGTGCAGCACAGCAACATGG + Intergenic
1159349330 18:67251672-67251694 ATGGGTGCAGCACAGCAACATGG - Intergenic
1159431909 18:68362996-68363018 TTGGATGCAGGACAGGAGTCTGG + Intergenic
1159458600 18:68694095-68694117 CTGGATGCGGGACAAGAACTTGG + Intronic
1159635559 18:70800568-70800590 CTGGATGCAGCACACCAACATGG + Intergenic
1160035142 18:75293929-75293951 GTGGATGCGGGACTAGAACAGGG + Intergenic
1161173146 19:2823393-2823415 TTGGATGCAGGACAAGAACTTGG - Intronic
1161668359 19:5590410-5590432 TGGAAGGCAGGAGAGGAACAGGG + Intronic
1164323181 19:24168803-24168825 TGGGATGCAGGATCAGAACATGG - Intergenic
1164327315 19:24207362-24207384 ATGGGTGCAGCACAGCAACATGG + Intergenic
1165202147 19:34153838-34153860 CTGGATGCCGGACAAGAACCTGG - Intergenic
1165647781 19:37457749-37457771 ATGGGTGCAGCACACGAACATGG + Intronic
1166070588 19:40385113-40385135 AAGGATGCAGGATAGGACCAGGG - Intronic
1166076930 19:40419167-40419189 CTGAATGAAGGACAGGAAGAAGG + Intergenic
1166203883 19:41256425-41256447 TTGGATTGGGGAAAGGAACAGGG - Intronic
1166834758 19:45660576-45660598 TTGGATGAAAGAGAGAAACAAGG + Intergenic
1168118029 19:54235988-54236010 TGGGATGAAGGACACCAACATGG - Intronic
1168379066 19:55905046-55905068 TTGGATGCTGGTGAGAAACAAGG + Exonic
925031798 2:655609-655631 TGGGACCCAGGACAGGGACACGG - Intergenic
925116474 2:1382806-1382828 ATGGATGCAGCACACCAACATGG - Intronic
925909129 2:8561153-8561175 CTGGGTGCAGCACAGCAACATGG - Intergenic
925922720 2:8648003-8648025 CTGGATACAGGACAAGAACTTGG + Intergenic
926265629 2:11317694-11317716 ATGGGTGCAGCACACGAACATGG - Intronic
926469457 2:13236171-13236193 ATGGGTGCAGCACATGAACATGG - Intergenic
926498347 2:13619541-13619563 ATGGATGCAGCACACCAACATGG + Intergenic
926506473 2:13721979-13722001 CTGGATGCCGGACAAGAACCTGG + Intergenic
928381131 2:30819729-30819751 ATGGATGCAGTACACCAACATGG + Intronic
928676206 2:33654326-33654348 TTGGATGCAGGACAAAAATTTGG + Intergenic
928718758 2:34095005-34095027 ATGGATGCAGCACACCAACAAGG - Intergenic
928765586 2:34641379-34641401 ATGGGTGCAGGACACCAACATGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929322649 2:40563787-40563809 ATGGATGCAGCACACCAACATGG - Intronic
929343908 2:40857090-40857112 ATGGATGCAGGAAATCAACATGG + Intergenic
930092957 2:47544675-47544697 TTGTCTGCAGGATAGGAAAAGGG - Intronic
930432738 2:51301482-51301504 TGGGATGCATGAAAGGACCAGGG - Intergenic
930442664 2:51428583-51428605 TTGGGTGCAGCACACCAACATGG + Intergenic
930569786 2:53070772-53070794 CTGGATGCAGCACACCAACATGG + Intergenic
930647277 2:53924702-53924724 ATGGGTGCAGCACAGGAACATGG - Intronic
930971133 2:57397271-57397293 TTGGATGTGGGACAAGAACTTGG - Intergenic
931005761 2:57849279-57849301 TTGGATGCAGGACAGGGACTTGG - Intergenic
931102244 2:59015312-59015334 TTGGACACAGGACAAGAACTCGG - Intergenic
931921805 2:67024947-67024969 ATGGGTGCAGGACACCAACATGG + Intergenic
931992438 2:67803877-67803899 GTGGATGCATGACATGACCAAGG + Intergenic
932066643 2:68570371-68570393 ATGGATGCAGCACACCAACATGG - Intronic
932098445 2:68873657-68873679 TTGGATGCAGGACATGATACAGG - Intergenic
932438520 2:71717271-71717293 CTGGAGCCAGGACAGGAACTGGG - Intergenic
932485367 2:72081310-72081332 CTGGATGCGGGACAAGAACTTGG + Intergenic
932662117 2:73664578-73664600 ATGGATGCAGCACACCAACATGG - Intergenic
932671297 2:73739981-73740003 AGGGATACAGGACAGGACCAAGG - Intergenic
932873318 2:75425478-75425500 TTGGATGCAGGACAAGAATTTGG - Intergenic
933074600 2:77907351-77907373 TTGGATGCTGGACAAGAATTTGG + Intergenic
933219217 2:79669441-79669463 CTGTATGCAGGACAAGAACTCGG - Intronic
933268718 2:80210292-80210314 ATGGGTGCAGGACAACAACATGG - Intronic
933470354 2:82715085-82715107 ATGGATGCAGCACACCAACATGG + Intergenic
933544691 2:83695344-83695366 CTGGATGCTGGACAAGAACCTGG - Intergenic
934156872 2:89210295-89210317 ATGGATGCAGCACACCAACATGG + Intergenic
934259034 2:91452984-91453006 ATGGGTGCAGCACAGCAACATGG + Intergenic
934634772 2:95974731-95974753 TTGGGTGCAGCACACCAACATGG - Intronic
934969382 2:98750693-98750715 CTGGATGCCGGACAAGAACCTGG + Intergenic
935000288 2:99007204-99007226 ATGGGTGCAGCACAGCAACATGG + Intronic
935378372 2:102423248-102423270 TTGGAGTGATGACAGGAACACGG + Exonic
935984382 2:108658623-108658645 TTGGAAGAAGGAAAGCAACATGG - Intronic
936136820 2:109902271-109902293 TTGGAAGAAGGAAAGCAACATGG - Intergenic
936207877 2:110469214-110469236 TTGGAAGAAGGAAAGCAACATGG + Intronic
936655700 2:114484172-114484194 TTCGATCCAGGACATGAACCTGG - Intronic
937514126 2:122632787-122632809 TTGCATGTAGGTCAGAAACAGGG + Intergenic
937966305 2:127514304-127514326 TTGGATGCAGGAAAAGCACTTGG + Intronic
937990996 2:127662279-127662301 TTGGAAGGAGGACAGAAGCATGG - Intronic
938074152 2:128322920-128322942 TGGGAGGCAGGACAGGGACCTGG + Intergenic
938108225 2:128547518-128547540 TGGGATGCTGGACAGGAGGATGG - Intergenic
938166941 2:129038217-129038239 ATGGATGCAGCACACCAACATGG - Intergenic
938180595 2:129178855-129178877 CTGGTTGCAGGACAAGAACTTGG - Intergenic
938425900 2:131187139-131187161 ATGGATGCAGCACACCAACATGG + Intronic
938485541 2:131703343-131703365 ATGGATGCAGCACACCAACATGG + Intergenic
938624389 2:133092286-133092308 TTGGATACAGCAGAGGAAGATGG + Intronic
938839370 2:135144185-135144207 TTGGATGTGGGACAAGAACTCGG - Intronic
939113398 2:138033739-138033761 TTAGATGCAGGACAAGAACTTGG + Intergenic
939393945 2:141604877-141604899 TTGGATGCGAGACAAGAACTTGG + Intronic
939466437 2:142562467-142562489 CTGGATGCAGGACAAGAACTTGG + Intergenic
939700681 2:145386947-145386969 CTGGATGCTGGACAAGAACTTGG + Intergenic
939743931 2:145946265-145946287 ATGGATGCAGCAAAGCAACATGG - Intergenic
939781088 2:146448946-146448968 TTGGGTGCAGCACACCAACATGG + Intergenic
940012187 2:149066255-149066277 ATGGATGCAGCACACCAACATGG - Intronic
940054712 2:149501305-149501327 ATGGGTGCAGCACAGCAACATGG - Intergenic
940319970 2:152366351-152366373 ATGGGTGCAGCACAGCAACATGG + Intronic
940623551 2:156144416-156144438 ATGGGTGCAGCACATGAACATGG + Intergenic
940878504 2:158922299-158922321 TTGGGTGTAGGACAAGAACTTGG - Intergenic
941053032 2:160756996-160757018 ATGGGTGCAGGACACCAACATGG - Intergenic
941144574 2:161828092-161828114 TTGGTTGCAAGACAGGAATATGG - Intronic
941151464 2:161919702-161919724 CTGGATGTAGGACAAGAACTTGG + Intronic
941458800 2:165742452-165742474 TTGGGTGTAGGAGAGGAACGAGG - Intergenic
941463693 2:165800549-165800571 TTGGATGTAGGAAAGGAGTATGG - Intergenic
941569574 2:167153486-167153508 ATGGATGCAGCACAGCAGCACGG - Intronic
941717550 2:168779819-168779841 CTGGATGCCGGACAAGAACCAGG + Intergenic
942320026 2:174728674-174728696 TCGGAAGCTTGACAGGAACAGGG + Intergenic
942364953 2:175215691-175215713 ATGGATGCAGCACACCAACATGG - Intergenic
942572549 2:177328555-177328577 TTGGGTGCAGCACACCAACATGG + Intronic
942790147 2:179752014-179752036 ATGGGTGCAGCACACGAACATGG - Intronic
942834780 2:180281009-180281031 ATGGGTGCAGCACAGCAACATGG - Intergenic
942885729 2:180921286-180921308 ATGGGTGCAGCACAGCAACATGG - Intergenic
942927251 2:181448816-181448838 ATGGATGCAGCACACCAACATGG - Intergenic
943224031 2:185145268-185145290 TAGGATGCAAGACAAGAACTTGG + Intergenic
943291567 2:186078703-186078725 ATGGGTGCAGGACAGCAACATGG + Intergenic
943384488 2:187184642-187184664 CTGGATGCTGGACAAGAACTTGG - Intergenic
943506572 2:188768208-188768230 ATGGGTGCAGCACAGCAACATGG - Intronic
943524641 2:189001498-189001520 TTGGATGCAAGACAGTGACATGG + Intronic
943628913 2:190228463-190228485 ATGGGTGCAGCACAGCAACATGG + Intronic
944146807 2:196514861-196514883 CTGGATGCAGGACAAGAACTTGG + Intronic
944293398 2:198034074-198034096 ATGGGTGCAGGACACCAACATGG - Intronic
944438267 2:199715006-199715028 CTGGATGCAGCACACCAACATGG + Intergenic
944483887 2:200182925-200182947 CTGGATGCAGGACAAGAACTTGG + Intergenic
944843630 2:203646810-203646832 TTGGACACAGGACAAGAACTTGG - Intergenic
945001355 2:205354372-205354394 TTGGGTGCAGCACACCAACATGG + Intronic
945014947 2:205505303-205505325 CTGGGTGCAGCACACGAACATGG + Intronic
945320770 2:208420198-208420220 ATGGGTGCAGCACAGCAACATGG + Intronic
945516957 2:210774258-210774280 ATGGGTGCAGCACAGCAACATGG + Intergenic
945656725 2:212633268-212633290 ATGGGTGCAGCACATGAACATGG - Intergenic
945776249 2:214110218-214110240 ATGGATGCAGGAAACCAACATGG - Intronic
945868593 2:215203169-215203191 TTGGATGCTGGACAAGAGCTTGG - Intergenic
945874100 2:215259018-215259040 ATGGGTGCAGGACACCAACATGG + Intergenic
945994628 2:216425606-216425628 TTGGACGCAGGACAAGAATCTGG - Intronic
946406013 2:219492496-219492518 TGGGATCCAGGACTGGGACATGG + Intronic
946490461 2:220144479-220144501 TAGGATGCAGGACTCTAACAGGG + Intergenic
946817291 2:223592346-223592368 ATGGGTGCAGCACACGAACATGG - Intergenic
947214093 2:227734574-227734596 ATGGATGCAGCACACCAACATGG + Intergenic
947316743 2:228866867-228866889 CTGGGTGCAGGACATGAACTTGG + Intronic
948261124 2:236605200-236605222 GTGGACGAAGGACAGGAACGGGG - Intergenic
1168731000 20:80568-80590 ATGGGTGCAGCACATGAACATGG - Intergenic
1169257879 20:4112415-4112437 TGGTATGGAGGTCAGGAACATGG + Intergenic
1169506977 20:6221915-6221937 TTGGGTGCAGCACACCAACATGG - Intergenic
1169788665 20:9386737-9386759 ATGGGTGCAGGACACCAACATGG - Intronic
1169821501 20:9715958-9715980 ATGGATGCAGTACACCAACATGG + Intronic
1170221619 20:13947538-13947560 CTGGATGCAGGACAAGAACTTGG + Intronic
1170458429 20:16554560-16554582 CTGGACACAGGACAGGAACTTGG + Intronic
1170745607 20:19095927-19095949 TGGAATGCGGGACAGGGACAAGG - Intergenic
1171073036 20:22093966-22093988 ATGGGTGCAGCACAGCAACATGG - Intergenic
1171275886 20:23856124-23856146 CTGGGTGCTGGACAGGAAGATGG - Intergenic
1171738841 20:28833992-28834014 ATGGATGCAGGACACCAACATGG + Intergenic
1171804292 20:29661630-29661652 CTGGATGCAGGACAAGAACTCGG - Intergenic
1171839760 20:30194792-30194814 CTGGATGCAGGACAAGAACTCGG + Intergenic
1171934669 20:31263122-31263144 ATGGGTGCAGCACAGCAACATGG - Intergenic
1171980961 20:31628501-31628523 TTGGGTGCAGCACACCAACATGG + Intergenic
1172347082 20:34210133-34210155 CTGGACGCAGGACAAGAACTCGG + Intronic
1172630495 20:36375125-36375147 TTGGAGGCAGGGCTGGGACATGG + Intronic
1172834771 20:37866101-37866123 TTGGAGGCAGGAAAGGATCATGG + Intronic
1173269620 20:41520733-41520755 ATGGATGCAGCACACCAACATGG + Intronic
1173481257 20:43401507-43401529 ATGGATGCAGCACACCAACATGG - Intergenic
1173516071 20:43666667-43666689 TTGGAGGCAGGAGAGGAAGCAGG + Intergenic
1173893887 20:46534884-46534906 CTGGATGCAAGACAAGAACTTGG + Intergenic
1174542963 20:51304119-51304141 TTGGATGTGGGACAAGAACTTGG - Intergenic
1174671773 20:52314794-52314816 ATGGGTGCAGCACACGAACATGG - Intergenic
1176323222 21:5354674-5354696 ATGGATGCAGCACACCAACATGG + Intergenic
1176480876 21:7286294-7286316 ATGGATGCAGCACACCAACATGG + Intergenic
1176523744 21:7848966-7848988 ATGGATGCAGCACACCAACATGG + Intergenic
1176582247 21:8542762-8542784 CTGGATGCAGGACAAGAACTCGG - Intergenic
1176588236 21:8611180-8611202 ATGGGTGCAGCACACGAACATGG + Intergenic
1176778336 21:13161310-13161332 ATGGGTGCAGCACAGCAACATGG + Intergenic
1176854624 21:13955900-13955922 ATGGGTGCAGCACAGCAACATGG + Intergenic
1176928995 21:14784976-14784998 ATGGGTGCAGCACAGCAACATGG + Intergenic
1176966252 21:15215730-15215752 ATGGGTGCAGCACAGCAACATGG - Intergenic
1177266361 21:18789409-18789431 ATGGGTGCAGCACAGCAACATGG + Intergenic
1177560851 21:22751275-22751297 ATGGATGCAGCACACCAACATGG + Intergenic
1177573968 21:22926799-22926821 ATGGATGCAGCACACCAACATGG - Intergenic
1177632149 21:23742585-23742607 TTGGTTGCAGAACAAGAACCTGG + Intergenic
1178010626 21:28281697-28281719 ATGGGTGCAGTACATGAACATGG + Intergenic
1178156447 21:29859274-29859296 ATGGATGCAGCACACCAACATGG + Intronic
1178164857 21:29962016-29962038 CTGGATGCCGGACAAGAACCTGG - Intergenic
1178170357 21:30033685-30033707 TTGGAGGCGGGACAAGAACGTGG - Intergenic
1178414266 21:32391281-32391303 ATGGGTGCAGGACACCAACATGG + Intronic
1178627133 21:34227553-34227575 TTGGCTGGAGGACAAGAACTGGG + Intergenic
1178657764 21:34478978-34479000 ATGGATGCAGCACACCAACATGG + Intergenic
1178937478 21:36875730-36875752 CTGGATGCAGGACAAGAACTTGG + Intronic
1178965703 21:37115092-37115114 ATGGGTGCAGCACAGCAACATGG + Intronic
1178968168 21:37144155-37144177 ATGGGTGCAGCACAGCAACATGG + Intronic
1179661489 21:42878892-42878914 GTGGATGCAGGCCGGGAAGAGGG + Intronic
1180251702 21:46594484-46594506 TTGGACGCGGGACAAGAACCTGG + Intergenic
1180265082 22:10519810-10519832 CTGGATGCAGGACAAGAACTCGG - Intergenic
1180271068 22:10588179-10588201 ATGGGTGCAGCACACGAACATGG + Intergenic
1180467074 22:15621295-15621317 ATGGATGCAGCACACCAACATGG + Intergenic
1180522388 22:16221786-16221808 ATGGATGCAGCACACCAACATGG - Intergenic
1181485128 22:23225727-23225749 TGGGATGCAGGAGAAGCACAGGG - Intronic
1182238311 22:28894475-28894497 TTGTATTCTGGGCAGGAACACGG + Intronic
1182953444 22:34398617-34398639 TTGGGTGCAGCACACCAACATGG + Intergenic
1183109982 22:35641853-35641875 TTGGGTGCAGGACAAGAACTCGG + Intergenic
1183597227 22:38819899-38819921 GGTGATGCAGCACAGGAACAAGG + Exonic
1183763655 22:39849059-39849081 ATGGATGCAGGATAGGTGCATGG - Intronic
1183872877 22:40753746-40753768 TTGGTTGCAGGACAAGAACCTGG - Intergenic
1184201980 22:42976098-42976120 TTGCATGTAGGAGAGGAAAAGGG + Intronic
1184269445 22:43370481-43370503 GGGGGTGAAGGACAGGAACAGGG - Intergenic
949268317 3:2186009-2186031 ATGGGTGCAGCACAGCAACATGG - Intronic
949458909 3:4269250-4269272 ATGGGTGCAGCACAGCAACATGG - Intronic
949471435 3:4400893-4400915 ATGGATGCAGCACACCAACATGG - Intronic
949771503 3:7583995-7584017 AAGAATGAAGGACAGGAACATGG + Intronic
949996234 3:9619545-9619567 TTGGATGCAGGACAAGAACCTGG + Intergenic
950130443 3:10540781-10540803 ATGGGTGCAGCACAGCAACATGG + Intronic
950576702 3:13836535-13836557 GTGGATGGAGGACATGACCAGGG - Intronic
950780904 3:15390781-15390803 CTGGATGCTGGACAAGAACCTGG - Intronic
950979623 3:17288781-17288803 TTGGATGCAGGACCAGAAGTAGG + Intronic
950994541 3:17480885-17480907 CTGGATGCAGGACAAGAACTTGG + Intronic
951562364 3:23981676-23981698 CTGGTTGCAGGACAAGAACTTGG - Intergenic
951685052 3:25334591-25334613 TTGGATGCAGCACACCAACGTGG + Intronic
951733121 3:25833184-25833206 ATGGGTGCAGCACAGCAACATGG - Intergenic
951916571 3:27807133-27807155 ATGGGTGCAGCACAGCAACATGG - Intergenic
952320067 3:32268506-32268528 ATGGATGCAGCACACCAACATGG + Intronic
952977004 3:38705056-38705078 TTGGATGCTGGTCAGGAGCTAGG + Intronic
953052061 3:39353532-39353554 TTGGGTGCAGCACACCAACATGG + Intergenic
953114336 3:39976959-39976981 ATGGGTGCAGGACACCAACATGG + Intronic
953147407 3:40291215-40291237 TTGGACACAGGACATGAACCTGG - Intergenic
953715055 3:45310377-45310399 CTGGAGGCAGGAGAGGAGCAGGG + Intergenic
953884836 3:46709341-46709363 TTGGTTGGAGCAGAGGAACAGGG - Intronic
955000527 3:54923308-54923330 TTGGCTGCAGGACAAAAAGAGGG - Intronic
955014765 3:55059678-55059700 TCGGATGCTGGACAAGAACCCGG - Intronic
955702845 3:61699083-61699105 ATGGGTGCAGCACAGCAACATGG + Intronic
955846615 3:63169826-63169848 ATGGATGCAGCACACCAACATGG + Intergenic
955979041 3:64506163-64506185 ATGGGTGCAGCACAGCAACATGG + Intergenic
956070822 3:65449186-65449208 ATGGATGCAGCACACCAACATGG + Intronic
956099127 3:65748935-65748957 TTGGAGGCAGGAGAGTAATAGGG + Intronic
956448640 3:69350893-69350915 ATGGGTGCAGCACAGCAACATGG + Intronic
957095309 3:75772294-75772316 CTGGATGCAGGAGAAGAACTCGG + Intronic
957223748 3:77416031-77416053 TTGGTTGTGGGACAAGAACACGG - Intronic
957308889 3:78493067-78493089 ATGGATGCAGCACAGCAGCATGG + Intergenic
957638257 3:82815232-82815254 CTGGGTGCAGGACAAGAACTCGG - Intergenic
957737723 3:84224601-84224623 TTGGATGCAGGACAAGAGCTTGG - Intergenic
957744056 3:84315872-84315894 ATGGGTGCAGCACACGAACATGG + Intergenic
957942570 3:87023131-87023153 ATGGATGCAGCACACCAACATGG + Intergenic
958170478 3:89933394-89933416 TTGGATGTGGGACAAGAACTCGG - Intergenic
958449871 3:94259827-94259849 TTGGGTGCAGGACAAGAACTTGG + Intergenic
958464886 3:94444937-94444959 ATGGATGCAGCACACCAACATGG + Intergenic
958498342 3:94874409-94874431 TTGGACACAGGACAAGAACTCGG - Intergenic
958591827 3:96169193-96169215 TTGGATGTAGGACAAGAACTCGG + Intergenic
958636318 3:96751035-96751057 CTGGATGCAGGACAAGAACTTGG + Intergenic
958678032 3:97292390-97292412 TTGTATGCAGGACAAGAACTTGG - Intronic
958825789 3:99028792-99028814 ATGGATGCAGCACACCAACATGG + Intergenic
958977460 3:100683189-100683211 CTGGATGCAGGACAAGAACTAGG + Intronic
959264426 3:104119549-104119571 TTGGGTGCAGCACACCAACATGG - Intergenic
959393958 3:105812636-105812658 ATGGATGCAGCAAAGAAACAAGG + Intronic
959724387 3:109527401-109527423 ATGGATGCAGCACACCAACATGG + Intergenic
960480998 3:118190104-118190126 ATGGATGCAGCACACCAACATGG + Intergenic
960690663 3:120342714-120342736 CTGGATGCAGGACAAGAACTTGG + Intronic
960729980 3:120716528-120716550 TTGGGTGCAGCACACCAACATGG + Intronic
961003858 3:123391568-123391590 GTGGAGGCTGGACTGGAACAAGG - Intronic
961525862 3:127496955-127496977 CTGGATGCAGGACAAGGACTTGG + Intergenic
962089819 3:132231179-132231201 TTGGCTGTAGGAAATGAACAGGG + Intronic
962287109 3:134095868-134095890 ATGGGTGCAGTACATGAACATGG - Intronic
962673300 3:137731634-137731656 ATGGGTGCAGCACAGCAACATGG - Intergenic
962854233 3:139329666-139329688 TTGGGTGCAGGTAAGGAGCAGGG - Intronic
963216506 3:142754445-142754467 ATGGATGCAGCACACCAACATGG + Intronic
963386513 3:144602061-144602083 ATGGATGCAGCACACCAACATGG - Intergenic
963643375 3:147883918-147883940 TTGGTTGCAGGACAAGAACTTGG - Intergenic
963681942 3:148389147-148389169 GTGGATGCAGGTTAGGAACTGGG - Intergenic
963945882 3:151145173-151145195 TTGGAGCCAGGGCAGGAACCAGG + Intronic
964214920 3:154268630-154268652 ATGGATGCAGCACACCAACATGG + Intergenic
964254989 3:154766142-154766164 TTGGTTGCAGGACAAGAACTAGG - Intergenic
964725366 3:159809065-159809087 ATGGATGCAGAAAAGCAACATGG - Intronic
964808036 3:160633024-160633046 TTGGGTGCAGGAAAGGAAGCAGG - Intergenic
965005697 3:163019605-163019627 CTAGATGCAGGACAAGAACTCGG + Intergenic
965056407 3:163722245-163722267 TTGGAGACAGGACAAGAACTTGG - Intergenic
965073098 3:163941131-163941153 ATGGATGCAGCACACCAACATGG - Intergenic
965205155 3:165712846-165712868 CTGGATGCAGGAAAAGAACTTGG - Intergenic
965229132 3:166028651-166028673 CTGGATGCAGGACAAGAACTCGG - Intergenic
965532664 3:169789975-169789997 ATGGGTGCAGCACAGCAACATGG - Intergenic
965800689 3:172490900-172490922 ATGGGTGCAGCACACGAACATGG - Intergenic
965813332 3:172613826-172613848 CTGGTTGCAGGACAAGAACTTGG - Intergenic
966463748 3:180205369-180205391 ATGGATGCAGCACACCAACATGG + Intergenic
966480984 3:180408119-180408141 ATGGGTGCAGCACAGCAACATGG + Intergenic
966749868 3:183311719-183311741 TTGGATGCATGACAGCAATGTGG + Exonic
966958417 3:184908685-184908707 TTGGATGCTGGACAAGAGCTGGG - Intronic
967065280 3:185909855-185909877 ATGGATGCAGTACACCAACATGG - Intergenic
967444760 3:189554322-189554344 CTGGATGCAGGACAAGAGCTCGG - Intergenic
967553531 3:190827959-190827981 TTGTATTCACGAAAGGAACAAGG - Intergenic
968621257 4:1604404-1604426 TTGGACCCTGGACAGGAACGTGG + Intergenic
969069763 4:4526397-4526419 CTGGATAGAGGACAGGAAAAGGG + Intronic
969168789 4:5341924-5341946 ATGGATGCAGCACACCAACATGG - Intronic
969194232 4:5547727-5547749 TTGGACGCAGGATAAGAACTTGG + Intronic
969198111 4:5579202-5579224 TTGAGTTTAGGACAGGAACATGG + Intronic
969691375 4:8705928-8705950 TGGCAGGCTGGACAGGAACAGGG - Intergenic
970079440 4:12264085-12264107 ATGGGTGCAGCACAGCAACATGG - Intergenic
970612111 4:17735244-17735266 ATGGATGCAGCACACCAACATGG + Intronic
970796125 4:19915753-19915775 TTGGGTGCAGCACACCAACATGG - Intergenic
971427314 4:26529407-26529429 CTGGATGCAGGACAAGAATTTGG - Intergenic
971586718 4:28413319-28413341 ATGGATGCAGCACACCAACATGG + Intergenic
972072624 4:35039370-35039392 CTGGACGCAGGACAAGAACTTGG + Intergenic
972176974 4:36420023-36420045 TTGGACGCAGGTCAAGAACTTGG + Intergenic
972372908 4:38442866-38442888 ATGGATGCAGCACACCAACATGG - Intergenic
972395289 4:38654094-38654116 ATGGATGCAGCACACCAACATGG - Intergenic
972972928 4:44599132-44599154 TTGGGTGTAGCACAGCAACATGG + Intergenic
972973099 4:44601797-44601819 ATGGGTGCAGCACAGCAACATGG - Intergenic
973022434 4:45220305-45220327 TTGGATGCTGGACAAGAGCTTGG - Intergenic
973782177 4:54298919-54298941 TTGGAAACAGGACAGGGACAGGG - Intergenic
974110594 4:57520969-57520991 ATGGATGCAGCACACCAACATGG + Intergenic
974254019 4:59425693-59425715 TTGGGTGCAGCACACCAACATGG + Intergenic
974568402 4:63609849-63609871 TTGGGTGCAGCACACCAACATGG - Intergenic
974611323 4:64220994-64221016 AGGGATGCAGTACATGAACATGG + Intergenic
974651558 4:64759774-64759796 TTGGATGGAGGACAAGAACTTGG + Intergenic
974770308 4:66403402-66403424 ATGGGTGCAGCACACGAACATGG + Intergenic
974782837 4:66575445-66575467 TTGGAAGTAGGACAAGAACTCGG + Intergenic
975039378 4:69725934-69725956 ATGGATGCAGCACACCAACATGG + Exonic
975213990 4:71733099-71733121 CTGGGTGCAGCACAGCAACATGG - Intergenic
975321382 4:73012511-73012533 CTGGTTGCAGGACAAGAACTTGG + Intergenic
975543042 4:75533840-75533862 ATGGATGCAGCACACCAACATGG - Intronic
975807467 4:78127830-78127852 TTGGGTGCAGCACACCAACATGG - Intronic
976037591 4:80843159-80843181 ATGGGTGCAGCACAGCAACATGG - Intronic
976107082 4:81630642-81630664 TAGGATGCAGGTGAGGAACTGGG - Intronic
976202297 4:82591372-82591394 TGGGAAGCAGGACAGGGAAATGG - Intergenic
976419444 4:84823132-84823154 TTGGCTTAAGGACAGGTACATGG + Intronic
976462467 4:85328191-85328213 ATGGGTGCAGCACACGAACATGG + Intergenic
976511055 4:85910375-85910397 TTGGTCGCAGGACAAGAACTTGG - Intronic
976595018 4:86887175-86887197 CTGGATGCAGCACACCAACATGG + Exonic
976734470 4:88296214-88296236 CTGGGTGCAGGACAAGAACTTGG - Intergenic
976921399 4:90448898-90448920 CTGGATGCAGGACAAGAACTCGG - Intronic
977298169 4:95234455-95234477 TTGGGTGCAGCACACGAACGTGG - Intronic
977357864 4:95969427-95969449 CTGGATGCTGGACAAGAACTTGG + Intergenic
977391931 4:96422005-96422027 TTGGGTGCAGCACACCAACATGG - Intergenic
977497366 4:97795275-97795297 TTGGGTGCAGCACACCAACATGG - Intronic
977522546 4:98103077-98103099 AGGAATGCAGGACAAGAACAAGG - Intronic
977695359 4:99958599-99958621 ATGGATGCAGCACACCAACATGG + Intergenic
977788368 4:101067728-101067750 ATGGGTGCAGCACAGCAACATGG + Intronic
977933873 4:102779034-102779056 CTGGATGCTGGACAAGAACCTGG - Intergenic
978013309 4:103713534-103713556 ATGGGTGCAGCACAGCAACATGG + Intronic
978219658 4:106255773-106255795 TTGGATGCAGGACAAGAATTTGG - Intronic
978249327 4:106611067-106611089 CTGGATGCAGGACACGAACTTGG + Intergenic
978301002 4:107269752-107269774 TTGGATACAGGACAAGAATTCGG - Intronic
978458609 4:108924866-108924888 ATGGATGCAGGAGAGGACCGGGG - Intronic
978476768 4:109139751-109139773 ATGGATGCAGCACACCAACATGG - Intronic
979386168 4:120067493-120067515 TAGGGGGCAGGACAGGAATAAGG + Intergenic
979418952 4:120479399-120479421 ATGGGTGCAGCACAGCAACATGG + Intergenic
979725534 4:123956218-123956240 TTGGATGCTGGACAAGAGCTTGG + Intergenic
979752657 4:124298547-124298569 ATGGGTGCAGCACAGCAACATGG + Intergenic
979896442 4:126163992-126164014 ATGGATGCAGCACAGCCACATGG - Intergenic
979946819 4:126843225-126843247 TTGGATGCGGGACAAGAACCCGG + Intergenic
980024811 4:127752480-127752502 ATGGGTGCAGGACACCAACATGG + Intronic
980457139 4:133059177-133059199 TTTGTTGCAGGACAAGAACTTGG + Intergenic
980674510 4:136058045-136058067 ATGGATGCAGCACACCAACATGG - Intergenic
980745013 4:137001452-137001474 CTGGATGCAAGACAGGAACTTGG + Intergenic
980750013 4:137076625-137076647 CTGGATGCAGGACAGAAACTTGG - Intergenic
981157637 4:141458591-141458613 TTCCAGGCAGGACAAGAACACGG - Intergenic
981727297 4:147861521-147861543 TTGGATGTGGGACAAGAACTTGG - Intronic
981736589 4:147959446-147959468 ATGGATGCAGCACACCAACATGG - Intronic
981883814 4:149648810-149648832 ATGGATGCAGCACACCAACATGG + Intergenic
982693629 4:158575058-158575080 CTGGAAGCAGGAAAGGAACGTGG + Intronic
982895177 4:160911512-160911534 ATGGGTGCAGCACACGAACATGG + Intergenic
983347609 4:166546579-166546601 TTGGATGCAGGACAAGAAATTGG - Intergenic
983618948 4:169739051-169739073 ATGGATGCAGCACACCAACATGG + Intronic
983722595 4:170874713-170874735 ATGGGTGCAGCACAGCAACATGG + Intergenic
983879622 4:172918299-172918321 ATGGGTGCAGCACATGAACACGG + Intronic
983975725 4:173931655-173931677 ATGGATGCAGCACACCAACATGG - Intergenic
984243872 4:177251294-177251316 TTGGGTGCAGGGCAGGGAAAAGG - Intergenic
984296707 4:177862482-177862504 CTGGATACAGGACAAGAACTCGG + Intronic
984373353 4:178894719-178894741 TTGGATGCAGAACAAGAACCTGG - Intergenic
984400397 4:179257069-179257091 TTGGATGCAGGACAAGAACCTGG - Intergenic
984403329 4:179295065-179295087 TTAGATGCTGGACAGGAACTTGG - Intergenic
984648221 4:182242137-182242159 TTGGGTGCAGCACACCAACATGG - Intronic
985066142 4:186124341-186124363 ATGGGTGCAGCACAGCAACATGG - Intronic
986114976 5:4764522-4764544 ATGGATGCAGCACACCAACATGG + Intergenic
986265541 5:6187087-6187109 TTGGATGGAAGAAAGGCACAGGG - Intergenic
986344018 5:6817730-6817752 ATGGATGCAGCACACCAACATGG - Intergenic
986528835 5:8712550-8712572 ATGGGTGCAGCACACGAACATGG - Intergenic
987537759 5:19209397-19209419 CTGCATGCAGGACAAGAACTAGG + Intergenic
987582270 5:19809441-19809463 ATGGGTGCAGCACAGCAACAGGG + Intronic
987872359 5:23637091-23637113 ATGGGTGCAGGACACCAACATGG + Intergenic
988072350 5:26308485-26308507 ATGGGTGCAGCACAGCAACATGG + Intergenic
988191248 5:27938224-27938246 TTGGATGTAGGACAGGGCAAGGG + Intergenic
988565854 5:32319747-32319769 CCGGATGCAGGACAAGAACCTGG - Intergenic
988603570 5:32661559-32661581 TTGGATGCTGGACAAGAGCCTGG - Intergenic
988850277 5:35173911-35173933 ATGGATGCAGCACACCAACATGG - Intronic
989371301 5:40710989-40711011 ATGGGTGCAGCACAGCAACATGG + Intergenic
989447704 5:41549994-41550016 ATGGGTGCAGCACAGCAACATGG + Intergenic
989520147 5:42392027-42392049 ATGGGTGCAGCACACGAACATGG - Intergenic
989585466 5:43071157-43071179 TTGGATGCAGGACAACAACTCGG + Intronic
989694324 5:44182288-44182310 ATGGATGCAGCACACCAACATGG - Intergenic
989729087 5:44626152-44626174 ATGGGTGCAGCACACGAACATGG + Intergenic
989785506 5:45323643-45323665 ATGGGTGCAGCACAGCAACATGG - Intronic
989789404 5:45378701-45378723 ATGGGTGCAGCACAGCAACATGG - Intronic
989798416 5:45504179-45504201 ATGGATGCAGCACACCAACATGG - Intronic
989813265 5:45704250-45704272 ATGGATGCAGCACACAAACATGG - Intergenic
989948830 5:50272772-50272794 ATGGGTGCAGCACAGCAACATGG + Intergenic
989958424 5:50381551-50381573 ATGGGTGCAGCACAGCAACATGG + Intergenic
990021725 5:51135957-51135979 ATGGGTGCAGCACAGCAACATGG - Intergenic
990038838 5:51354724-51354746 ATGGGTGCAGCACAGCAACATGG + Intergenic
990090231 5:52036241-52036263 TTGGGTGCAGCACACCAACATGG + Intronic
990192430 5:53274055-53274077 ATGGATGCAGCACACCAACATGG + Intergenic
990199133 5:53351612-53351634 TGGGAAGCAGGACAGGAAGTAGG - Intergenic
990738645 5:58890459-58890481 TCGGAGGCAGGACAGGACCGAGG - Intergenic
991074951 5:62525160-62525182 TTAGATACAGGAAAGGAAAAAGG - Intronic
991553185 5:67866074-67866096 ATGGGTGCAGGACACCAACATGG - Intergenic
991668936 5:69027616-69027638 TTGGATGGAGGAAAGGAAGTTGG + Intergenic
991942095 5:71863093-71863115 ATGGAAGGAGGAAAGGAACAGGG - Intergenic
992029621 5:72708665-72708687 TTGGATGAGGGACAAGAACTTGG - Intergenic
992355318 5:75976117-75976139 TTGTATGCAAGAAAGGAAAATGG + Intergenic
992631725 5:78687978-78688000 ATGGGTGCAGGACACCAACATGG + Intronic
992651328 5:78863669-78863691 ATGGGTGCAGGACACCAACATGG + Intronic
992803351 5:80313271-80313293 ATGGATGCAGCACACCAACATGG - Intergenic
992838865 5:80667952-80667974 CTGGAAGCAGGACAAGAACCTGG - Intronic
993068276 5:83128052-83128074 ATGGGTGCAGCACAGCAACATGG - Intronic
993211804 5:84961744-84961766 ATGGATGCAGGACAAGAACTTGG - Intergenic
993256664 5:85600093-85600115 ATGGATGCAGCACACCAACATGG + Intergenic
993370865 5:87090465-87090487 TTGGGTGCAGCACACCAACATGG + Intergenic
993839641 5:92862030-92862052 TAAGATGCAGGCCAGGAGCAAGG + Intergenic
994037185 5:95214927-95214949 ATGGATGCAGCACACCAACATGG + Intronic
994161454 5:96561268-96561290 ATGGATGCAGCACACCAACATGG + Intronic
994229762 5:97299720-97299742 ATGGGTGCAGGACACCAACATGG - Intergenic
994288408 5:97997357-97997379 ATGGATGCAGCACACCAACATGG + Intergenic
994345880 5:98685528-98685550 ATGGGTGCAGCACAGCAACATGG + Intergenic
994414180 5:99447508-99447530 ATGGGTGCAGGACACCAACATGG - Intergenic
994472171 5:100220841-100220863 ATGGATGCAGCACACGAACATGG + Intergenic
994497671 5:100534683-100534705 ATGGGTGCAGCACAGCAACATGG - Intergenic
994578598 5:101611379-101611401 TTGGATGCAGGACAAGAACCTGG - Intergenic
995117381 5:108496467-108496489 ATGGGTGCAGCACAGCAACATGG + Intergenic
995159880 5:108967190-108967212 TTGGACGCAGGACAAGAACTTGG - Intronic
995195999 5:109369056-109369078 TGGAATGCAGAGCAGGAACAAGG - Intronic
995270301 5:110212946-110212968 ATGGGTGCAGCACAGCAACATGG - Intergenic
996132044 5:119793739-119793761 ATGGATGCAGCACAGCAACATGG - Intergenic
996147457 5:119993279-119993301 TTGAATCCAGGAAAGGAGCAGGG - Intergenic
996253957 5:121374868-121374890 ATGGGTGCAGCACAGCAACATGG + Intergenic
996318995 5:122192716-122192738 AGGGATGAAGGGCAGGAACAGGG + Intergenic
996472591 5:123877707-123877729 TTGGAGGCAGCCCAGGAGCAGGG - Intergenic
996650615 5:125872114-125872136 TTGGGTGCAGCACACCAACATGG - Intergenic
996669530 5:126100892-126100914 CTGGATGCTGGACAAGAACTTGG - Intergenic
996964925 5:129296943-129296965 CTGGGTGCAGCACAGCAACATGG - Intergenic
996981871 5:129506513-129506535 CTGGGTGCAGGACACCAACATGG - Intronic
996985011 5:129549089-129549111 ATGGGTGCAGCACAGCAACATGG + Intronic
997797177 5:136821965-136821987 TTAGATGAAGTGCAGGAACAAGG - Intergenic
997808295 5:136941730-136941752 ATGGATGCAGCACACCAACATGG - Intergenic
997851613 5:137338097-137338119 TTGGGTGCAGCACACCAACATGG - Intronic
998643963 5:144042077-144042099 TTGGATGCTGGACAAGAACTCGG - Intergenic
998664689 5:144283127-144283149 ATGGATGCAGCACACCAACATGG - Intronic
998734685 5:145123139-145123161 TTGGGGGCAGGGCAGGATCATGG - Intergenic
998750728 5:145318816-145318838 CTGGATGCCAGACAGGAACCTGG - Intergenic
999572532 5:152936923-152936945 ATGGGTGCAGGACACCAACATGG + Intergenic
999797821 5:155004608-155004630 TTGGATGCTGGACAAGAGCTTGG - Intergenic
999851250 5:155541810-155541832 CTGGATGCCGGACAAGAACTTGG + Intergenic
1000128320 5:158269550-158269572 ATGGGTGCAGCACAGCAACATGG - Intergenic
1000254348 5:159523781-159523803 ATGGATGCAGCACACCAACATGG - Intergenic
1000554885 5:162714293-162714315 ATGGGTGCAGCACAGCAACATGG + Intergenic
1000610132 5:163365029-163365051 TTGGATGTGGGACAAGAACTCGG + Intergenic
1000631059 5:163591380-163591402 ATGGATGCAGCACACCAACATGG - Intergenic
1000664584 5:163979486-163979508 TTGGGTGCAGCACACCAACACGG - Intergenic
1000704183 5:164490394-164490416 ATGGATGCAGCACACCAACATGG - Intergenic
1000749899 5:165081996-165082018 TTGGGTGCAGCACACCAACATGG - Intergenic
1002071606 5:176681709-176681731 TGGGAGGCGGGACAGGAAGAGGG - Intergenic
1003166430 6:3682990-3683012 TTGGATGCTGGAATGGAAAAAGG - Intergenic
1003313936 6:4994309-4994331 ATGGATGCAGCACACCAACATGG + Intergenic
1003649222 6:7943263-7943285 ATGGATGCAGCACACCAACATGG - Intronic
1003794855 6:9589737-9589759 ATGGATGCAGCACACCAACATGG + Intergenic
1004127838 6:12890512-12890534 GTGGATGAAGGACAGAAATATGG - Intronic
1004558911 6:16728459-16728481 TGGGATGTAGGACAGAAACCAGG + Intronic
1004738824 6:18435935-18435957 ATGGATGCAGCACACCAACATGG + Intronic
1004955377 6:20723023-20723045 TTGGATGCTGGACAAGAGCTTGG + Intronic
1005312877 6:24575404-24575426 TTGGATACAAAACAGGAAGATGG - Intronic
1005351807 6:24943404-24943426 TTGGGTGCAGCACACCAACATGG + Intronic
1005363354 6:25053570-25053592 CTGGATGCCGGACAAGAACTTGG - Intergenic
1005702317 6:28414461-28414483 TTGGATGCAGCCCTGGAAAAGGG + Intergenic
1005775910 6:29130468-29130490 CTGGGTGCAGGACAAGAACTTGG + Intergenic
1005779629 6:29176684-29176706 ATGGGTGCAGCACAGCAACATGG - Intergenic
1006225946 6:32536043-32536065 CTGGATGCAGGACAAGAACTGGG + Intergenic
1006348033 6:33498721-33498743 CTGGACACAGGACAAGAACATGG + Intergenic
1006766195 6:36509143-36509165 CTGAATGCAGGACAAGAACCTGG - Intronic
1007134975 6:39512006-39512028 ATGGGTGCAGCACACGAACATGG + Intronic
1007339896 6:41184632-41184654 ATGGGTGCAGCACAGCAACATGG + Intergenic
1007803452 6:44418073-44418095 ATGGGTGCAGCACAGCAACATGG - Intronic
1007932692 6:45706728-45706750 GTAGATGCAGGACAGGAAGTGGG + Intergenic
1008080737 6:47192037-47192059 ATGGGTGCAGTACAGCAACATGG + Intergenic
1008188259 6:48422483-48422505 TTGGATCCAGGGCAAGAACTTGG - Intergenic
1008716672 6:54297001-54297023 ATGGATGCAGCACACCAACATGG - Intergenic
1008799319 6:55346604-55346626 ATGGATGCAGCACACCAACATGG + Intronic
1008852085 6:56034457-56034479 ATGGGTGCAGCACAGCAACATGG + Intergenic
1009058264 6:58365230-58365252 ATGGGTGCAGCACAGCAACATGG + Intergenic
1009274932 6:61663313-61663335 ATGGATGCAGCACACCAACATGG + Intergenic
1009809575 6:68643551-68643573 TGGGATCCAGCACAGGGACAGGG - Intronic
1009846271 6:69139220-69139242 TTGAAAGCAGGAGAGGAAAATGG - Intronic
1010104404 6:72149973-72149995 TTGGATGCAGAAAAAGAACTTGG - Intronic
1010344040 6:74790526-74790548 ATGGATGCAGCACACCAACACGG + Intergenic
1010502862 6:76622922-76622944 ATGGATGCAGCACACGAACATGG - Intergenic
1010546713 6:77167159-77167181 ATGGGTGCAGCACAGCAACATGG - Intergenic
1010556144 6:77281855-77281877 TTGGATGCCGGACAAGAGCCTGG - Intergenic
1010572177 6:77489844-77489866 ATGGATGCAGCACACCAACATGG + Intergenic
1010661223 6:78572690-78572712 ATGGATGCAGGAAACCAACATGG + Intergenic
1010764651 6:79765256-79765278 TTGGATGCGAGACAAGAACCCGG + Intergenic
1011179599 6:84604874-84604896 ATGGGTGCAGCACACGAACATGG + Intergenic
1011200073 6:84826507-84826529 TTGGGTGCAGCACACCAACATGG - Intergenic
1011320830 6:86091333-86091355 ATGGGTGCAGCACACGAACATGG - Intergenic
1011348588 6:86398641-86398663 ATGGGTGCAGCACAGCAACATGG + Intergenic
1011349810 6:86410180-86410202 ATGGGTGCAGCACAGCAACATGG - Intergenic
1011530080 6:88312100-88312122 CTGGTTGCAGGACAAGAACTCGG - Intergenic
1011563523 6:88648386-88648408 ATGGATGCAGTACACCAACATGG + Intronic
1011709130 6:90033270-90033292 CTGGATGCAGCACACCAACATGG + Intronic
1012161776 6:95894117-95894139 ATGGGTGCAGCACAGCAACATGG - Intergenic
1012169509 6:96001696-96001718 CTGGATGCAGGAGAAGAACTTGG - Intergenic
1012369233 6:98482422-98482444 ATGGATGCAGCACACCAACATGG + Intergenic
1012590285 6:100971672-100971694 ATGGATGCAGCACACCAACATGG + Intergenic
1012652340 6:101771611-101771633 ATGGATGCAGCACACCAACATGG - Intronic
1012749478 6:103139945-103139967 CTGGATGTAGGACAAGAACTTGG - Intergenic
1012904250 6:105046095-105046117 ATGGATGCAGCACACCAACATGG - Intronic
1013123882 6:107164245-107164267 GTGGATGCAGCACACCAACATGG - Intronic
1013375606 6:109510729-109510751 CTGGATGCAGGACAAGAATTTGG + Intronic
1013492323 6:110660499-110660521 CTGGATGCTGGACAAGAACTCGG - Intronic
1013708251 6:112865183-112865205 TTTGATGCAGGACAGGTTCTTGG + Intergenic
1013709367 6:112879706-112879728 CTGGATGCAGGACAAGAACTCGG - Intergenic
1013950642 6:115777556-115777578 ATGGGTGCAGCACAGCAACATGG - Intergenic
1014277806 6:119406010-119406032 TTGGGTGCAGCACACCAACATGG + Intergenic
1014391937 6:120873971-120873993 CTGGATGCAGGACAAGAACTTGG + Intergenic
1014501982 6:122202983-122203005 TTGGTTGCAGGACAAGAACCCGG - Intergenic
1014812392 6:125901750-125901772 CTGGATGCTGGACAAGAACCCGG - Intronic
1014968933 6:127791140-127791162 CTGGATGCAGTACAAGAACTTGG - Intronic
1015002314 6:128233354-128233376 TTGCATGGAGTACAGGAACAAGG + Intronic
1015070052 6:129081305-129081327 ATGGATGCAGCACACCAACATGG + Intronic
1015080685 6:129222421-129222443 ATGGATGCAGCACACCAACATGG - Intronic
1015455592 6:133423876-133423898 CTGGATGCAGGACAAGAACCTGG - Intronic
1015699251 6:136017420-136017442 ATGGATGCAACACAGCAACATGG - Intronic
1016006951 6:139099080-139099102 TTGGATGCTGGACAAGAGCTTGG + Intergenic
1016076700 6:139804729-139804751 CTGGACGCAGGACAAGAACTCGG - Intergenic
1016310461 6:142728019-142728041 TTGGATGCAAGCCAGTAAGAGGG + Intergenic
1016325840 6:142900185-142900207 TAAGATGCAGGACAGGAACGTGG + Intronic
1016548933 6:145255438-145255460 CTGGATGCCGGACAAGAACTCGG - Intergenic
1016610219 6:145980740-145980762 ATGGGTGCAGGACACCAACATGG - Intergenic
1016648748 6:146439828-146439850 ATGGAGGCATGACAGGAACCAGG + Intergenic
1016805548 6:148208431-148208453 CTGGATGGTGGACAGGAAGAGGG + Intergenic
1017268533 6:152479169-152479191 TTGGGTGTAGGACAGGATCCTGG + Intronic
1017286901 6:152686085-152686107 CTGGATGCTAGACAGGAACCCGG - Intergenic
1017394954 6:153987964-153987986 TTGGAAGCAGAGCAGGAAGAAGG - Intergenic
1018445375 6:163853367-163853389 ATGGATGCAGCACACCAACATGG + Intergenic
1018516634 6:164587091-164587113 TTGCAAGCAGGAAAGGAAAAAGG - Intergenic
1018659918 6:166076519-166076541 CTGGATGCAGGGCAAGAACTTGG - Intergenic
1019336081 7:483496-483518 ATGGATGGATGACAGGAACTAGG + Intergenic
1019660942 7:2223702-2223724 TGTGATGCAGGACAAGAACTGGG + Intronic
1019898235 7:3999602-3999624 TTGGATGCAGGGCAGCAAAATGG + Intronic
1020564547 7:9778778-9778800 TTGGATGCTGGACAAGAGCTCGG - Intergenic
1020621688 7:10527338-10527360 ATGGATGCAGCACACCAACATGG + Intergenic
1020649320 7:10855421-10855443 CTGGATGCAGGACAAGAATTCGG + Intergenic
1020761304 7:12270396-12270418 TTGGATGCAAGACAAGAACTAGG + Intergenic
1020761909 7:12278294-12278316 TTGGACCCAGCAAAGGAACAGGG - Intergenic
1021343066 7:19488614-19488636 CTGGATGCAGGAAAGGAACTCGG - Intergenic
1021391044 7:20092954-20092976 ATGGGTGCAGCACAGCAACATGG + Intergenic
1021554268 7:21903816-21903838 TTTGCTGAAGGACAGGTACAGGG + Intronic
1021787420 7:24165417-24165439 CTGGATGCAGGACAAGAACTCGG - Intergenic
1022340436 7:29462843-29462865 TTGGGTGCAGCACACCAACATGG - Intronic
1022361131 7:29659146-29659168 ATGGATGCAGCACACCAACATGG - Intergenic
1022934467 7:35157857-35157879 TTGGGTGCAGCACACCAACATGG + Intergenic
1023011944 7:35932030-35932052 ATGGGTGCAGCACACGAACATGG - Intergenic
1023076764 7:36490950-36490972 TAGGATGCAAAAAAGGAACATGG - Intergenic
1023076780 7:36491097-36491119 TAGGATGCAAAAAAGGAACATGG - Intergenic
1023599282 7:41865401-41865423 TTGGATGTGGGACAAGAACTCGG - Intergenic
1023803095 7:43851856-43851878 TTGGTTGCAGGACAAGAACCCGG + Intergenic
1024079182 7:45841830-45841852 ATGGGTGCAGTACACGAACATGG + Intergenic
1024119321 7:46221073-46221095 TTGGATACAGCACAGAAACCTGG - Intergenic
1024696444 7:51861193-51861215 ATGGATGCAGCACACCAACATGG - Intergenic
1024899792 7:54306106-54306128 ATGGGTGCAGCACAGCAACATGG - Intergenic
1025125594 7:56342120-56342142 ATGGGTGCAGCACACGAACATGG - Intergenic
1025288281 7:57686234-57686256 CTGGATGCAGGACAAGAACTCGG + Intergenic
1025479701 7:60966520-60966542 ATGGGTGCAGCACAGCAACATGG + Intergenic
1025552263 7:62265808-62265830 ATGGGTGCAGCACAGCAACATGG - Intergenic
1025572505 7:62594042-62594064 ATGGGTGCAGCACACGAACATGG - Intergenic
1026299175 7:69082384-69082406 GTGGACGCAGGATAGGAAAATGG - Intergenic
1026627070 7:72004168-72004190 TTGGCAGCAGGACAGACACATGG + Intronic
1026800370 7:73396468-73396490 TGGGAGGCAGGACAGGGTCAAGG - Intergenic
1027333658 7:77126371-77126393 CTGGATGCAGGACAAGAATTCGG - Intronic
1027708536 7:81567267-81567289 CTGGATGCTGGACAAGAACTTGG + Intergenic
1027730397 7:81864573-81864595 ATGGATGCAGCACACCAACATGG - Intergenic
1027922267 7:84408957-84408979 TTGGGTGCAGCACACCAACATGG + Intronic
1027934999 7:84590528-84590550 ATGGGTGCAGGACACCAACATGG - Intergenic
1027994140 7:85402407-85402429 TTGTTTCCAGGACTGGAACAGGG - Intergenic
1028035072 7:85972108-85972130 CTGGATGCGGGACAAGAACTTGG - Intergenic
1028527345 7:91800945-91800967 CTAGATGCAGGACAAGAACTTGG - Intronic
1028640835 7:93040185-93040207 CTGGATGCAAGACAAGAACTCGG + Intergenic
1028998812 7:97130675-97130697 CTGGATGCGGGACAAGAACCTGG - Intronic
1029060390 7:97791634-97791656 ATGGATGCAGCACACCAACATGG + Intergenic
1029782135 7:102744961-102744983 CTGGATGCAGGACAAGAATTCGG + Intergenic
1029830403 7:103250640-103250662 TTGGGTGCAGCACACCAACATGG + Intergenic
1029973708 7:104813995-104814017 CTGGTTGCAGGACAAGAACTTGG - Intronic
1030100418 7:105940739-105940761 TTGGGTGGAGGCCATGAACAGGG - Intronic
1030249605 7:107427790-107427812 TTGGATGCAGGACAAGAACTTGG - Intronic
1030756390 7:113292015-113292037 CTGGACACAGGACAAGAACATGG + Intergenic
1031173923 7:118325131-118325153 TTGGAGGCAGGACAAGAACTTGG - Intergenic
1031240325 7:119230184-119230206 ATGGATGCAGCACACCAACATGG - Intergenic
1031246204 7:119316177-119316199 ATGGATGCAGCACACCAACATGG - Intergenic
1031575329 7:123409453-123409475 TTGGATGCAGGAAAGTAACAAGG - Intergenic
1031760848 7:125711319-125711341 ATGGGTGCAGCACAGCAACATGG + Intergenic
1031778481 7:125932782-125932804 ATGGGTGCAGCACAGCAACATGG - Intergenic
1032046701 7:128616742-128616764 ATGGATGCAGCACACCAACATGG - Intergenic
1032725800 7:134589192-134589214 TGGGATGCAGAATAAGAACATGG + Intergenic
1033094432 7:138418332-138418354 ATGGGTGCAGCACAGCAACATGG - Intergenic
1033106517 7:138531296-138531318 ATGGGTGCAGCACACGAACATGG - Intronic
1033371064 7:140708692-140708714 ATGGGTGCAGCACAGCAACATGG - Intronic
1033893826 7:146046733-146046755 ATGGATGCAGCACACCAACATGG + Intergenic
1034215869 7:149405158-149405180 CTGGACACAGGACAGGAACTTGG - Intergenic
1034317971 7:150151792-150151814 TTGGGTGCAGCACACCAACATGG + Intergenic
1034571323 7:151958756-151958778 TTGGACGCAGGACAAGGACCTGG - Intronic
1034722589 7:153308244-153308266 ATGGGTGCAGCACAGCAACATGG + Intergenic
1035032757 7:155872401-155872423 ATGGGTGCAGCACAGCAACATGG + Intergenic
1035468581 7:159095721-159095743 TTGGAGCCTGGACAGGAGCAGGG - Intronic
1035657880 8:1324756-1324778 TAGGAAGAAAGACAGGAACATGG - Intergenic
1035776634 8:2192417-2192439 TTGGAGGAAAGACAGGCACATGG - Intergenic
1036712785 8:11092610-11092632 TTGTTTGCAGGGCAGGACCATGG - Intronic
1036756289 8:11473354-11473376 TTGGAGGCAGGAGTGAAACAAGG + Intronic
1037150303 8:15627441-15627463 CTGGATGCTGGACAAGAACTTGG + Intronic
1037392886 8:18413139-18413161 CTGCAGGCTGGACAGGAACATGG - Intergenic
1037456433 8:19068673-19068695 ATGGGTGCAGCACAGCAACATGG + Intronic
1037539624 8:19858332-19858354 TTGGATGCAGGACAAGGACATGG - Intergenic
1039228766 8:35419796-35419818 TTGGACACAGGACAAGAACCTGG - Intronic
1039352240 8:36775488-36775510 ATGGATGCAGCACACCAACATGG + Intergenic
1039494912 8:37973442-37973464 TTGGATGCAGGACAGGAGCTTGG - Intergenic
1039663189 8:39489240-39489262 ATGGATGCAGCACACCAACATGG + Intergenic
1040363511 8:46690608-46690630 ATGGATGCAGCACACCAACATGG - Intergenic
1040451170 8:47548848-47548870 ATGGGTGCAGCACAGCAACATGG - Intronic
1040458856 8:47627301-47627323 ATGGGTGCAGCACAGCAACATGG + Intronic
1040607991 8:48953983-48954005 ATGGATGCAGCACACCAACATGG - Intergenic
1041151957 8:54944307-54944329 TTGGATGCGAGACAAGAACTCGG - Intergenic
1041205446 8:55494466-55494488 CTGGATGCAGGACAAGAACTTGG - Intronic
1041218101 8:55621636-55621658 TTGGGTGCAGCACACCAACATGG + Intergenic
1041274471 8:56142906-56142928 CTGGATGCAGGATAAGAACTTGG + Intergenic
1041360632 8:57049756-57049778 TTGGGTGCAGGACAAGAACTTGG + Intergenic
1041574433 8:59377718-59377740 ATGGGTGCAGGACACGAACATGG + Intergenic
1041783077 8:61599382-61599404 ATGGGTGCAGCACAGCAACACGG + Intronic
1041829189 8:62133579-62133601 ATGGGTGCAGCACAGCAACATGG - Intergenic
1041973003 8:63765127-63765149 ATGGGTGCAGCACAGCAACATGG - Intergenic
1042157326 8:65858519-65858541 ATGGATGCAGCACACCAACATGG + Intergenic
1042368841 8:67967986-67968008 ATGGATGCAGCACACCAACACGG + Intronic
1042609064 8:70577606-70577628 CTGGATGCAGGACAAGAACTTGG + Intronic
1042715968 8:71773059-71773081 TTGGATGTAGGACAAGAACTTGG - Intergenic
1043087107 8:75849030-75849052 CTGGTTGCAGGACAAGAACTTGG - Intergenic
1043098520 8:76007979-76008001 TTGGGTGCAGCACACCAACATGG + Intergenic
1043618728 8:82160779-82160801 CTGGTTACAGGACAGGAACCTGG + Intergenic
1043662263 8:82758451-82758473 TTGGTCGCAGGACAAGAACTGGG - Intergenic
1043691044 8:83152324-83152346 TAGGAGGCAGGACAGAAAAATGG - Intergenic
1044149156 8:88752242-88752264 TTGGATGCACGACAAGAACCTGG - Intergenic
1044259088 8:90097480-90097502 CTGGGTGCAGGACAAGAACTTGG - Intergenic
1044286809 8:90419716-90419738 CTGGATGCCGGACAAGAACTTGG - Intergenic
1044493330 8:92846839-92846861 ATGGGTGCAGCACAGCAACATGG - Intergenic
1044547064 8:93471773-93471795 ATGGATGCAGCACACCAACATGG + Intergenic
1044576393 8:93774440-93774462 ATGGGTGCAGCACAGCAACATGG - Intronic
1044613945 8:94120356-94120378 CTGGATGCAGGACAAGAACTCGG + Intergenic
1045431150 8:102116170-102116192 ATGGGTGCAGCACAGCAACATGG + Intronic
1046009360 8:108527793-108527815 ATGGATGCAGCACACCAACATGG - Intergenic
1046287969 8:112120228-112120250 ATGGATGCAGCACACCAACATGG + Intergenic
1046468723 8:114640195-114640217 ATGGGTGCAGCACAGCAACATGG - Intergenic
1046664645 8:116987354-116987376 ATGGATGCAGCACACCAACATGG + Intronic
1046696885 8:117350798-117350820 ATGGCTGCAGCACAGCAACATGG + Intergenic
1047113806 8:121818623-121818645 CTGGATGCTGGACAAGAACCTGG + Intergenic
1047669319 8:127127197-127127219 TTGGGTACACGACAGGACCATGG + Intergenic
1048031014 8:130632264-130632286 TAGGATGCAGTATAGGAAAAGGG + Intergenic
1048410635 8:134168798-134168820 TTGGATGTAGGACAAGGACTTGG - Intergenic
1048712397 8:137226873-137226895 TTGGATGCAGGACAAGAACTTGG - Intergenic
1048792141 8:138114007-138114029 TTGGATACAAGAGAGGAGCATGG - Intergenic
1049021808 8:139962200-139962222 CTGGATGCAGGACAAGAACTCGG + Intronic
1049102204 8:140587941-140587963 TTGGATGCAGGCCAGGGATTTGG - Intronic
1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG + Intergenic
1049768717 8:144368883-144368905 GTGGGTGCAGGACAAGAACTTGG - Intergenic
1049824080 8:144655732-144655754 CTGGATGCAGGACAAGAACTTGG + Intergenic
1050088946 9:1996512-1996534 AAGGATGCTGGACAGGAACTAGG + Intergenic
1050395825 9:5195041-5195063 TTACATGCCGGACAGGCACAGGG - Intergenic
1050482069 9:6097626-6097648 TTGGGTGCAGGACAATAACTTGG + Intergenic
1050484022 9:6114963-6114985 CTGGGTGCAGGACAAGAACTTGG + Intergenic
1050589649 9:7148639-7148661 CTGGACGCAGGACAAGAACTTGG - Intergenic
1050753345 9:8967831-8967853 ATGGATGCAGCACACCAACATGG - Intronic
1050881795 9:10709253-10709275 ATGGGTGCAGGACACCAACATGG + Intergenic
1050931327 9:11330761-11330783 TTGGACACAGGACAAGAACCTGG - Intergenic
1050994107 9:12191710-12191732 TCAGATGCAGGACAAGAACTTGG + Intergenic
1051002961 9:12307464-12307486 ATGGATGCAGCACACCAACATGG + Intergenic
1051519677 9:17972241-17972263 ATGGATGCAGCACACCAACATGG - Intergenic
1051681280 9:19610510-19610532 TTGGATGGAAGAGAGGAACAAGG + Intronic
1051864298 9:21662153-21662175 ATGGGTGCAGCACAGCAACATGG - Intergenic
1051916979 9:22220414-22220436 ATGGATGCAGCACACCAACATGG - Intergenic
1053445111 9:38146673-38146695 CTGGATGCAGGACAAGAACTTGG + Intergenic
1055135485 9:72824400-72824422 TTGGATGCTGGACAAGAGCTTGG - Intronic
1055156145 9:73065512-73065534 CTGGATGCCGGACAAGAACCTGG + Intronic
1055165772 9:73190815-73190837 ATGGATGCAGCACACCAACATGG + Intergenic
1055645505 9:78358081-78358103 CTGGATGCAGGACAAGAACTTGG + Intergenic
1055852756 9:80652185-80652207 CTGGGTGCAGCACACGAACATGG - Intergenic
1056207779 9:84336786-84336808 TGGGATGGAGGAAGGGAACACGG - Intronic
1056429843 9:86516463-86516485 TTGGATGCTGGACAAGAGCTTGG + Intergenic
1056641558 9:88375896-88375918 ATGGGTGCAGCACAGCAACATGG + Intergenic
1057343272 9:94222791-94222813 TTGGGTGCAGCACACCAACATGG + Intergenic
1057531257 9:95848228-95848250 CTGGATCCAGGACAAGAACTCGG + Intergenic
1058104400 9:100954144-100954166 ATGGGTGCAGCACACGAACATGG + Intergenic
1058253708 9:102734964-102734986 ATGGATGCAGCACACCAACATGG - Intergenic
1058262169 9:102847973-102847995 ATGGGTGCAGCACACGAACATGG + Intergenic
1058270586 9:102967562-102967584 TTGGATGCAGGAAAATAACTTGG - Intergenic
1058271408 9:102976298-102976320 ATGGATGCAGCACACCAACATGG - Intergenic
1058280189 9:103103972-103103994 CTGGATGCAGGACAAGAACCTGG + Intergenic
1058294343 9:103286983-103287005 ATGGATGCAGCACACGAACATGG + Intergenic
1058296235 9:103311626-103311648 ATGGATGCAGCACACCAACATGG - Intergenic
1058321450 9:103636464-103636486 CTGGATGCTGGACATGAACTCGG + Intergenic
1058545714 9:106058996-106059018 CTGGATGCAGAACAAGAACTTGG - Intergenic
1058576794 9:106412587-106412609 TTGGATGCACCTCAGGAAAAGGG - Intergenic
1058749621 9:108026669-108026691 ATGGGTGCAGCACAGCAACATGG - Intergenic
1058754027 9:108067607-108067629 ATGGGTGCAGCACAGCAACATGG - Intergenic
1058791279 9:108448238-108448260 ATGGGTGCAGCACACGAACATGG + Intergenic
1058794017 9:108479832-108479854 TTGGATCCTGGAACGGAACAGGG - Intergenic
1058857382 9:109076443-109076465 TTGGGTGCAGCACACCAACATGG + Intronic
1059437740 9:114286654-114286676 ATGGGTGCAGCACAGCAACATGG + Intronic
1059719618 9:116946747-116946769 AAGGATGCAGGGCAGGAAAAGGG + Intronic
1060071481 9:120552756-120552778 ATGGGTGCAGCACAGCAACATGG + Intronic
1060147569 9:121266073-121266095 TTGGTGGCTGGAGAGGAACATGG - Intronic
1060168162 9:121437457-121437479 ATGGATGCAGCACACCAACATGG + Intergenic
1060324191 9:122596749-122596771 ATGGGTGCAGCACACGAACATGG - Intergenic
1060880914 9:127117455-127117477 CTGGAGGTAGAACAGGAACAAGG + Intronic
1062092079 9:134683673-134683695 TTGCATGCAGGGCAGGACCGGGG - Intronic
1062193083 9:135257605-135257627 CTGGGTGCAGGCAAGGAACATGG + Intergenic
1203612264 Un_KI270749v1:20776-20798 CTGGAAGCAGGACAAGAACTCGG - Intergenic
1203618250 Un_KI270749v1:89766-89788 ATGGGTGCAGCACACGAACATGG + Intergenic
1185769767 X:2756965-2756987 CTGGATGCTGGACAAGAACCCGG - Intronic
1186005172 X:5062310-5062332 TTGGGTGCAGCACACCAACATGG - Intergenic
1186128606 X:6442675-6442697 CTGGATGCCGGACAAGAACTCGG - Intergenic
1186534994 X:10337970-10337992 ATGGGTGCAGCACAGAAACATGG - Intergenic
1187521614 X:20019355-20019377 TTGGGTGAATGACAAGAACAAGG - Intronic
1188172102 X:26940005-26940027 ATGGATGCAGCACACCAACATGG + Intergenic
1188272468 X:28157424-28157446 ATGGATGCAGCACACCAACACGG + Intergenic
1188390749 X:29616407-29616429 ATGGGTGCAGCACACGAACACGG - Intronic
1188494360 X:30767845-30767867 ATGGGTGCAGCACACGAACATGG - Intergenic
1188527212 X:31099521-31099543 TTGAATGCAGGAAAGGGGCATGG + Intronic
1188554757 X:31399127-31399149 CTGGATGCTGGACAAGAACTTGG - Intronic
1188607778 X:32054271-32054293 ATGGGTGCAGGACACCAACATGG - Intronic
1188769479 X:34134405-34134427 ATGGGTGCAGCACAGCAACATGG - Intergenic
1188893897 X:35643306-35643328 TTGGATGCTGGACAAGAGCTTGG + Intergenic
1189360252 X:40344413-40344435 CTGGATGCAGGACAAGGACGTGG + Intergenic
1189485797 X:41430726-41430748 TGGGATGAAGGAGAGGAAGATGG - Intergenic
1190060663 X:47209712-47209734 TTGGCTGGTGGACAGGGACAGGG - Intronic
1190234460 X:48605044-48605066 TGGGATGGAGGACAGCAGCAGGG - Exonic
1190340286 X:49290662-49290684 TAGGAGGGTGGACAGGAACAGGG + Intronic
1190516198 X:51225799-51225821 TTGGAGGCAGGCCAGGAGCCAGG - Intergenic
1190686875 X:52882668-52882690 ATGGATGCAGCACACCAACATGG - Intergenic
1190699107 X:52973124-52973146 ATGGATGCAGCACACCAACATGG + Intronic
1190921161 X:54854008-54854030 ATGGGTGCAGGACACCAACATGG - Intergenic
1191075524 X:56449475-56449497 ATGGGTGCAGGACACCAACATGG - Intergenic
1191155135 X:57265868-57265890 TGTGATGAAGGACAGGATCAGGG - Intergenic
1191180991 X:57563431-57563453 ATGGGTGCAGCACACGAACAAGG + Intergenic
1191207697 X:57851800-57851822 GTGGATGCAGCACAGCAGCATGG + Intergenic
1191220180 X:57979704-57979726 ATGGGTGCAGCACAGCAACATGG - Intergenic
1191768685 X:64731937-64731959 TGGGATGCTGGAAAGAAACAGGG - Intergenic
1191776090 X:64814927-64814949 ATGGGTGCAGGACACCAACATGG + Intergenic
1192000961 X:67150999-67151021 TTGGGTGCAGCACACCAACATGG - Intergenic
1192007089 X:67227847-67227869 ATGGATGCAGCACACCAACATGG - Intergenic
1192025921 X:67451323-67451345 ATGGGTGCAGGACACCAACATGG + Intergenic
1192199763 X:69059422-69059444 TGGGATTCAGGACAGGATCCTGG + Intergenic
1192265272 X:69533396-69533418 CTGGATGCAGGACAAGAACTTGG - Intergenic
1192475799 X:71441746-71441768 ATGGATGCAGCACACCAACATGG - Intronic
1192695923 X:73416126-73416148 ATGGGTGCAGGACACCAACATGG - Intergenic
1192793892 X:74411029-74411051 TTGGATGCAGGAGGGGACAAAGG - Intergenic
1193019631 X:76777522-76777544 ATGGATGCAGCACACCAACATGG + Intergenic
1193047123 X:77065402-77065424 ATGGGTGCAGCACAGCAACATGG - Intergenic
1193108362 X:77703709-77703731 TTGGGTGCAGGACAAGAACTTGG - Intronic
1193123086 X:77843763-77843785 ATGGGTGCAGCACAGCAACATGG - Intronic
1193400174 X:81032887-81032909 ATGGATGCAGCACACCAACATGG + Intergenic
1193781788 X:85711996-85712018 ATGGATGCAGCACACCAACATGG - Intergenic
1194490162 X:94535712-94535734 ATGGATGCAGCACACCAACATGG + Intergenic
1194945049 X:100056827-100056849 ATGGGTGCAGCACAGCAACATGG + Intergenic
1195146069 X:102018507-102018529 TTGGATGCAGGACAAGAGCTTGG - Intergenic
1195171112 X:102269354-102269376 ATGGGTGCAGGACACCAACATGG + Intergenic
1195187748 X:102417745-102417767 ATGGGTGCAGGACACCAACATGG - Intronic
1195233125 X:102871255-102871277 TTGGGTGCAGCACACCAACATGG - Intergenic
1195340951 X:103905543-103905565 ATGGATGCAGCACACCAACATGG - Intergenic
1195484121 X:105383032-105383054 CTGGGTGCAGCACACGAACATGG + Intronic
1195589469 X:106607786-106607808 TTGGATGGAAGAAAGGAAAAGGG + Intergenic
1196138130 X:112231634-112231656 ATGGGTGCAGCACAGCAACATGG + Intergenic
1196149207 X:112353746-112353768 ATGGGTGCAGCACAGCAACATGG + Intergenic
1196166935 X:112545885-112545907 ATGGGTGCAGGACACCAACATGG - Intergenic
1196186438 X:112749496-112749518 ATGGGTGCAGCACAGCAACATGG - Intergenic
1196283202 X:113848491-113848513 ATGGGTGCAGCACAGCAACATGG - Intergenic
1196377843 X:115054232-115054254 TTGGGTGCAGCACACCAACATGG + Intergenic
1196651438 X:118172175-118172197 CAAGATGCAGGAGAGGAACATGG + Intergenic
1196716606 X:118817546-118817568 ATGGGTGCAGCACAGCAACATGG + Intergenic
1197120638 X:122886913-122886935 ATGGGTGCAGCACACGAACATGG + Intergenic
1197180940 X:123535900-123535922 ATGGGTGCAGCACAGCAACATGG + Intergenic
1197342277 X:125288141-125288163 CTGGATGCAGGACAAGAACTCGG + Intergenic
1197421337 X:126238920-126238942 CTGGATACAGGACAAGAACTCGG + Intergenic
1197469643 X:126851459-126851481 TTGGGTGCAGCACACCAACATGG + Intergenic
1197609486 X:128622830-128622852 CTGGACGCAGGACAAGAACTCGG - Intergenic
1197882838 X:131187441-131187463 TTGGAGGAAGGGCAAGAACATGG - Intergenic
1197994262 X:132355125-132355147 TAGAATACAGGCCAGGAACAAGG + Intergenic
1198607952 X:138364755-138364777 ATGGATGCAGCACACCAACATGG - Intergenic
1198918825 X:141702766-141702788 ATGGGTGCAGCACAGCAACATGG - Intergenic
1199022141 X:142893380-142893402 ATGGATGCAGCACACCAACATGG + Intergenic
1199035499 X:143045219-143045241 ATGGATGCAGCACACCAACATGG + Intergenic
1199103870 X:143838388-143838410 CTGGATGCAGGACAAGAACTTGG + Intergenic
1199273158 X:145909462-145909484 TAGCAAGCAGGACAGGAACATGG + Intergenic
1199861060 X:151800897-151800919 CTGGATGCAGGACAAGAACTTGG - Intergenic
1200582628 Y:4968809-4968831 GTGGATGGAGGACAGGAACCAGG + Intergenic
1200743323 Y:6878551-6878573 TTGGCTTCATGACAAGAACAGGG - Intergenic
1200791889 Y:7306516-7306538 ATGGGTGCAGCACAGCAACATGG - Intergenic
1200909396 Y:8516879-8516901 TTGGGTGCAGGGCAGGCAGAGGG + Intergenic
1201155386 Y:11127795-11127817 CTGGATGCTGGACAAGAACTTGG - Intergenic
1201344828 Y:12971564-12971586 ATGGGTGCAGCACAGGAACATGG - Intergenic
1201358298 Y:13119010-13119032 ATGGGTGCAGCACAGCAACATGG - Intergenic
1201392597 Y:13514505-13514527 ATGGATGCAGCACAGCAACATGG - Intergenic
1201521665 Y:14882300-14882322 ATGGGTGCAGCACAGCAACATGG - Intergenic
1201550098 Y:15210343-15210365 AGGGAGGGAGGACAGGAACAAGG + Intergenic
1201609334 Y:15823387-15823409 TTGGATGCTGGACAAGAACTTGG - Intergenic
1201750597 Y:17427774-17427796 TTGGGTGCAGCACACCAACAGGG - Intergenic
1201930349 Y:19338316-19338338 ATGGAGGCAGCACAGCAACATGG - Intergenic
1201984687 Y:19952956-19952978 ATGGGTGCAGCACAGCAACATGG + Intergenic
1202073459 Y:21016008-21016030 CTGGATGCAGGACAAGAACCTGG - Intergenic
1202078159 Y:21057862-21057884 CTGGATGCAGGACAAGAACCTGG - Intergenic
1202109656 Y:21406527-21406549 TTGGATGCAGCACTGGCAGAGGG - Intergenic
1202124637 Y:21557178-21557200 TTGGGTGCAGTACAGGCAGAAGG + Intergenic
1202154371 Y:21872202-21872224 TTGGGTGCAGTACAGGCAGAAGG - Intergenic
1202177358 Y:22110050-22110072 TTGGATGCAGGACAATGAAACGG + Intergenic
1202214003 Y:22476334-22476356 TTGGATGCAGGACAATGAAACGG - Intergenic
1202248731 Y:22847295-22847317 ATGGATGCAGCACACCAACATGG - Intergenic
1202401720 Y:24481043-24481065 ATGGATGCAGCACACCAACATGG - Intergenic
1202469061 Y:25189040-25189062 ATGGATGCAGCACACCAACATGG + Intergenic