ID: 1121148816

View in Genome Browser
Species Human (GRCh38)
Location 14:91611264-91611286
Sequence TATTCCAATCTAATTGGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121148813_1121148816 -10 Left 1121148813 14:91611251-91611273 CCAGGAAGAAATATATTCCAATC 0: 1
1: 0
2: 0
3: 19
4: 229
Right 1121148816 14:91611264-91611286 TATTCCAATCTAATTGGTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121148816 Original CRISPR TATTCCAATCTAATTGGTTC GGG Intronic
905876522 1:41435272-41435294 TCTTCCAATCGGATTGGTACAGG + Intergenic
908213475 1:61925615-61925637 CATCACAATTTAATTGGTTCTGG + Intronic
908997217 1:70169417-70169439 TATTTCCTTCTAATTGGTTTAGG - Intronic
910783703 1:90970573-90970595 AATTCCAATCTAAATGACTCTGG + Intronic
912427369 1:109606411-109606433 TAATTCGTTCTAATTGGTTCAGG + Exonic
912483315 1:110002583-110002605 CTTCCCAATATAATTGGTTCAGG + Intronic
914436672 1:147666689-147666711 GATTCTAATTTAATTGGTCCGGG - Intronic
915221995 1:154382132-154382154 TATTCCAATGTAAATTGTTTGGG - Intergenic
917517219 1:175718345-175718367 TCTTCTAATCTAGTTGTTTCTGG - Intronic
917796493 1:178536704-178536726 GATCTCAATCTAATTGGTCCAGG - Intronic
917852005 1:179072571-179072593 CATTCCAATGTAACTAGTTCTGG - Exonic
918988971 1:191672646-191672668 AATTCCAAACTAAATGATTCTGG - Intergenic
919698316 1:200603560-200603582 TAGTCCCAGCTACTTGGTTCAGG - Intronic
921277679 1:213535859-213535881 TATTCCACAGTGATTGGTTCAGG - Intergenic
1066627684 10:37425837-37425859 TAATCCAATCTAATTGGATAAGG - Intergenic
1067321559 10:45225469-45225491 TTTTTTAATCCAATTGGTTCAGG - Intergenic
1071803206 10:89087629-89087651 CATTCAAATCTAACAGGTTCTGG - Intergenic
1072558909 10:96551311-96551333 TTTTCCTCTCTGATTGGTTCTGG - Exonic
1073122271 10:101129999-101130021 TATTGCAATCTATTTGCTTTGGG - Intronic
1073556145 10:104453618-104453640 TTGTCCAATCTAATTGGTTTTGG + Intronic
1074683048 10:115929900-115929922 TAATCCAATCTAAATGTTTGAGG + Intronic
1079211638 11:18466086-18466108 TATTCCAAGCTAATTAATGCAGG - Intronic
1081032870 11:38108945-38108967 CATTCCAATCTTATTGTCTCCGG + Intergenic
1086496099 11:87405939-87405961 TATCCAAAACTACTTGGTTCAGG - Intergenic
1086915317 11:92523456-92523478 TATTCCAGCCTAACTGTTTCTGG + Intronic
1088841526 11:113631342-113631364 TTTTGCAATCTAGTTGGTTGGGG - Intergenic
1092571423 12:9726998-9727020 CATTCTAATATAATTGTTTCTGG + Intronic
1098043001 12:66371063-66371085 TATTCCAATCTCATTGGAAGGGG - Intronic
1099055022 12:77828824-77828846 TTTTTCAATCTAATTGTTCCAGG + Intergenic
1100184002 12:92118156-92118178 TATTCAAATTTAATTGGTGCTGG - Intronic
1103266919 12:119638510-119638532 GATTCTAATTTAATTGGTCCAGG - Intronic
1106407903 13:29489631-29489653 TATTCCAATTTAATTGCTCTGGG + Intronic
1110322946 13:74180940-74180962 TTTACCAATCTGATTGTTTCAGG + Intergenic
1110623998 13:77631149-77631171 TATTCTAATTTAACTGGTTTGGG - Intronic
1110771107 13:79347411-79347433 TATTTGAATCTATCTGGTTCTGG + Intronic
1110843913 13:80172426-80172448 GATTCTAATTTAATTGGTTTGGG + Intergenic
1111643245 13:90997164-90997186 GACACCAATTTAATTGGTTCGGG - Intergenic
1111811581 13:93098444-93098466 ACTTACAATCTAATTTGTTCTGG - Intergenic
1112874677 13:104021647-104021669 TATTCCTATTTTATTGGTTTGGG + Intergenic
1113299503 13:109002117-109002139 CACTCCAATTTAATTGGTTTGGG + Intronic
1113653122 13:112051774-112051796 CATTCCATTCTAATTGCATCTGG + Intergenic
1114033356 14:18596071-18596093 CATTTCATTCTAATTGGTTTCGG + Intergenic
1114078151 14:19175271-19175293 CATTTCATTCTAATTGGTTTCGG + Intergenic
1114125344 14:19719282-19719304 CATTTCATTCTAATTGGTTTCGG - Intronic
1115854378 14:37614379-37614401 TATCCCAGTCTTTTTGGTTCTGG + Intronic
1116412064 14:44636200-44636222 TATTACATACTAATTGTTTCAGG + Intergenic
1117059956 14:51951986-51952008 GATTCTAATTTAATTGGTTTGGG - Intronic
1117218651 14:53578942-53578964 TATTTTAATCTCATTGGTTGAGG - Intergenic
1121148816 14:91611264-91611286 TATTCCAATCTAATTGGTTCGGG + Intronic
1121185488 14:91964297-91964319 TATTCCAGTAGAATTGGTTAGGG + Intergenic
1121748635 14:96325669-96325691 AGTTCCAATTTAATTTGTTCTGG + Exonic
1124096079 15:26650079-26650101 TATTCCAAGCTCATTGTTGCTGG - Intronic
1127294454 15:57597311-57597333 TGTTCCCATTTAATTGGTTTGGG - Intronic
1128838249 15:70828787-70828809 TATTCTGATTTAATTGGTTCTGG - Intergenic
1130867201 15:87943110-87943132 GATTCCAATCTAGTAGGTCCAGG + Intronic
1131893051 15:96994656-96994678 TATTCTTATCAAATTGGTTGTGG + Intergenic
1140261155 16:73381416-73381438 TAATCAAATCTAAGTGGTTTGGG + Intergenic
1140778645 16:78273962-78273984 TATGCCAATATAATTGTGTCTGG - Intronic
1145331740 17:21878144-21878166 TATTCCAATCCAATCCATTCCGG - Intergenic
1145342061 17:21963501-21963523 TATTCCAGTCCATTCGGTTCCGG - Intergenic
1157820049 18:50760525-50760547 TCTACCAATCTAGTTGGTTCTGG + Intergenic
1164450613 19:28360456-28360478 TATTCCAATTTCCTTGGTGCAGG - Intergenic
1164450676 19:28361376-28361398 TATTCCAATTTCCTTGGTGCAGG - Intergenic
1164870808 19:31641109-31641131 TGTTTCAAACTAATTGGTTAAGG - Intergenic
1167949377 19:53014181-53014203 TTTTCCAAAATAATTGCTTCGGG + Exonic
1167953945 19:53049342-53049364 TTTTCCAAAATAATTGCTTCGGG + Exonic
925224443 2:2170976-2170998 TATTATTATCTAATTGGATCTGG + Intronic
925923220 2:8652097-8652119 TTTTCCAGTATATTTGGTTCAGG + Intergenic
926594802 2:14778522-14778544 TCTTCCAATCTCATTTCTTCTGG - Intergenic
926995231 2:18728120-18728142 TGTTTCACTCTAATTTGTTCAGG - Intergenic
927106072 2:19827425-19827447 GATTCCAATGTAATTTGTTGTGG - Intergenic
930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG + Intergenic
931677056 2:64707873-64707895 GATTCCAATTTAATTGGTCTTGG + Intronic
931811879 2:65862173-65862195 GATTCTGATCTAATTGGTCCAGG + Intergenic
933377367 2:81497150-81497172 TATTGCAATCTAGATGGTACGGG - Intergenic
936891786 2:117379057-117379079 TATAACAATCTGATTAGTTCAGG - Intergenic
936917981 2:117659620-117659642 TATTCTAATTAAATTGGTTTTGG - Intergenic
937683789 2:124672706-124672728 TATTCCATCCTGATTGGTACAGG - Intronic
938639116 2:133261901-133261923 AATGCCAATGTAATTGCTTCAGG + Intronic
939064421 2:137465422-137465444 TATTCTGATTTAATTGGTCCAGG - Intronic
939567282 2:143799943-143799965 CATTACAATCTAATTAGTTTGGG - Intergenic
939666112 2:144953384-144953406 TATTCTGATTTAATTGGTCCGGG - Intergenic
941857521 2:170245985-170246007 AATTTCAATTTAATTGGTTTGGG + Intronic
943326522 2:186505327-186505349 TATTCCAATGTAATATCTTCAGG + Intronic
946119055 2:217493157-217493179 TCTACCAATCTAATTTGTTTGGG - Intronic
1173058892 20:39642987-39643009 TATCCCAACCAAATAGGTTCTGG + Intergenic
1174162697 20:48563160-48563182 AATTCCAATTTAATTGGTATGGG + Intergenic
1177786477 21:25676716-25676738 TTTTCCTATTTAATTTGTTCTGG + Intronic
1178441609 21:32603037-32603059 TATTTTAATCTTATTGGCTCGGG - Intronic
1180457471 22:15523126-15523148 CATTTCATTCTAATTGGTTTCGG + Intergenic
950913519 3:16619054-16619076 TATTCCCATCTAATCAGTTGTGG - Intronic
951392385 3:22122332-22122354 TTTTCCACTGTAATTGATTCTGG + Intronic
952127961 3:30324316-30324338 TTTCCCAATCTAATTGTCTCTGG + Intergenic
953490073 3:43342186-43342208 TAGTGCAATTTAAATGGTTCAGG + Intronic
955021713 3:55127963-55127985 GATCCCAATTTAATTGGTTTAGG - Intergenic
956419433 3:69071031-69071053 TGTTCCATTCCAATTGGTTCTGG + Intronic
957368505 3:79258802-79258824 TCTTCCAATATTGTTGGTTCAGG + Intronic
957962865 3:87281010-87281032 TATTCAAATCTAATTATCTCTGG + Intergenic
958017633 3:87960121-87960143 AATTCCAATTTAATTGATTGGGG - Intergenic
958941102 3:100315591-100315613 AATTCCAATATGATTGGTTAAGG - Intronic
959247740 3:103896665-103896687 TATTCTATTCTAATTGATTAGGG + Intergenic
959548796 3:107630182-107630204 TATTCTGATTTAATTGGTTTAGG + Intronic
962559885 3:136594727-136594749 AATTCCAAGCTAATTGGGTTAGG - Intronic
969710106 4:8837962-8837984 TACTAAATTCTAATTGGTTCTGG + Intergenic
970780171 4:19728233-19728255 AATTCAATTTTAATTGGTTCAGG - Intergenic
970797523 4:19931330-19931352 TATCCCAAGCAAATTGGTGCAGG + Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG + Intergenic
980069219 4:128225332-128225354 TTTGCCAATATAATTGGTTCTGG + Intergenic
980319374 4:131249225-131249247 TTTTTAAAACTAATTGGTTCAGG + Intergenic
983112449 4:163769762-163769784 TATGCCATTCTAAGTGGTTATGG - Intronic
990358237 5:54991723-54991745 GATTCCAATCTGATGGGTTGGGG + Intronic
991375393 5:65960525-65960547 GATTCTAATTTAATTGGTTAAGG + Intronic
994129037 5:96203561-96203583 TATTGCATTTTAATTGTTTCAGG - Intergenic
996458267 5:123709970-123709992 TATTCCTATTTTTTTGGTTCAGG - Intergenic
999048153 5:148491919-148491941 GATTCCATTTTAATTGGGTCTGG - Intronic
1004630812 6:17419517-17419539 AAACCCAATCTAATTTGTTCAGG - Intronic
1007900850 6:45410801-45410823 TATGCCAAACTAATTGTTTCAGG - Intronic
1008055776 6:46944516-46944538 GGTTCCAATTTAATAGGTTCAGG + Intronic
1008472967 6:51904447-51904469 TATTCCAACCTCAGTGGTTTGGG - Intronic
1009584614 6:65582739-65582761 TATTCCAAACTACTTGGTTATGG - Intronic
1010375795 6:75168595-75168617 TATTCCAATTTAATTGATTTGGG - Intronic
1012140812 6:95624480-95624502 TCTTCCAATCTCTGTGGTTCAGG - Intergenic
1021442375 7:20690744-20690766 TATCCGAATCTAAATGGTGCAGG - Intronic
1025990919 7:66496192-66496214 TAAAACAATCTGATTGGTTCAGG + Intergenic
1031327455 7:120419426-120419448 TAGTCCAATCTCATTTGTACTGG + Intronic
1033048048 7:137980262-137980284 GATTCTGATTTAATTGGTTCTGG - Intronic
1035922930 8:3697688-3697710 TATTCCTATGTAATTGGATGAGG - Intronic
1036524580 8:9522795-9522817 TATTCGAATTTAATTTGTTGTGG - Intergenic
1037191391 8:16130072-16130094 TTTTTCCTTCTAATTGGTTCTGG + Intronic
1038125413 8:24668030-24668052 GATTTCAATGTAATTGGTTTTGG + Intergenic
1038635940 8:29287240-29287262 AATTCCAATCTAATTGGTCTGGG - Intergenic
1038885940 8:31663183-31663205 TTTTCCAATCCAATTTATTCTGG - Intronic
1042852514 8:73230202-73230224 GATTCTGATCTAATTGGTTTGGG - Intergenic
1045619736 8:103961307-103961329 CTATCCAATCTAATTGGTACAGG - Intronic
1050148465 9:2594872-2594894 AATTCTAATGTAATTGGTTTGGG + Intergenic
1054942964 9:70763837-70763859 TAATCTAATCTAAGGGGTTCAGG + Intronic
1055595027 9:77857430-77857452 TATTCCAATCTAAAAGGATGGGG + Intronic
1056101469 9:83304226-83304248 GATTCCACTTTAATTGGGTCTGG + Intronic
1060387479 9:123245322-123245344 GATTCTAATTTAATTGGTTTGGG - Intronic
1186816313 X:13241249-13241271 TATTACAATCAAATTGTTTGAGG + Intergenic
1187409395 X:19036230-19036252 TATTCAAATCTAATGGTTACGGG - Intronic
1190021398 X:46880894-46880916 TAATCTAAAGTAATTGGTTCAGG + Exonic
1191677790 X:63809844-63809866 TATTCTAATTTAATTGGTTTGGG + Intergenic
1193411740 X:81171795-81171817 CATTCCAATCACACTGGTTCAGG + Intronic
1195039477 X:101001193-101001215 CATTCCAATTTAATTGGTTTGGG - Intergenic
1198715835 X:139557322-139557344 TATTACAAACTACTTGGTTTTGG - Intronic
1199288682 X:146082261-146082283 TATTCTAATTTAATTGGTCTGGG - Intergenic
1201199560 Y:11527137-11527159 TATTCCAATCTATTCCATTCTGG - Intergenic
1201209890 Y:11670260-11670282 TATTCCAGTCTAATATCTTCTGG - Intergenic
1201481677 Y:14446424-14446446 TATTTCAACCTAATTTTTTCAGG - Intergenic