ID: 1121152864 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:91653547-91653569 |
| Sequence | CAATCATGGCAGAGGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9184 | |||
| Summary | {0: 1, 1: 52, 2: 1377, 3: 2632, 4: 5122} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121152859_1121152864 | 0 | Left | 1121152859 | 14:91653524-91653546 | CCACATGGCTGGGGAAGATCTCA | 0: 1 1: 6 2: 36 3: 71 4: 299 |
||
| Right | 1121152864 | 14:91653547-91653569 | CAATCATGGCAGAGGGTGGAAGG | 0: 1 1: 52 2: 1377 3: 2632 4: 5122 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121152864 | Original CRISPR | CAATCATGGCAGAGGGTGGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||