ID: 1121152864

View in Genome Browser
Species Human (GRCh38)
Location 14:91653547-91653569
Sequence CAATCATGGCAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9184
Summary {0: 1, 1: 52, 2: 1377, 3: 2632, 4: 5122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121152859_1121152864 0 Left 1121152859 14:91653524-91653546 CCACATGGCTGGGGAAGATCTCA 0: 1
1: 6
2: 36
3: 71
4: 299
Right 1121152864 14:91653547-91653569 CAATCATGGCAGAGGGTGGAAGG 0: 1
1: 52
2: 1377
3: 2632
4: 5122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121152864 Original CRISPR CAATCATGGCAGAGGGTGGA AGG Intronic
Too many off-targets to display for this crispr