ID: 1121155239

View in Genome Browser
Species Human (GRCh38)
Location 14:91677102-91677124
Sequence TCCAGGATTTTTATGGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24223
Summary {0: 1, 1: 44, 2: 1145, 3: 14779, 4: 8254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121155239_1121155244 3 Left 1121155239 14:91677102-91677124 CCCAAAGCCATAAAAATCCTGGA 0: 1
1: 44
2: 1145
3: 14779
4: 8254
Right 1121155244 14:91677128-91677150 AAACCTAGGCAATACCATTCAGG 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
1121155239_1121155247 15 Left 1121155239 14:91677102-91677124 CCCAAAGCCATAAAAATCCTGGA 0: 1
1: 44
2: 1145
3: 14779
4: 8254
Right 1121155247 14:91677140-91677162 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
1121155239_1121155246 10 Left 1121155239 14:91677102-91677124 CCCAAAGCCATAAAAATCCTGGA 0: 1
1: 44
2: 1145
3: 14779
4: 8254
Right 1121155246 14:91677135-91677157 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
1121155239_1121155248 16 Left 1121155239 14:91677102-91677124 CCCAAAGCCATAAAAATCCTGGA 0: 1
1: 44
2: 1145
3: 14779
4: 8254
Right 1121155248 14:91677141-91677163 ACCATTCAGGACATAGGCATGGG 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121155239 Original CRISPR TCCAGGATTTTTATGGCTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr