ID: 1121160315

View in Genome Browser
Species Human (GRCh38)
Location 14:91732783-91732805
Sequence TCAGGATATGAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121160315_1121160322 12 Left 1121160315 14:91732783-91732805 CCTGCTTTACCCTCATATCCTGA 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1121160322 14:91732818-91732840 ATCTGGGTTTAATCTATTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 131
1121160315_1121160320 -5 Left 1121160315 14:91732783-91732805 CCTGCTTTACCCTCATATCCTGA 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1121160320 14:91732801-91732823 CCTGAAATATGTCTGGTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 123
1121160315_1121160321 -4 Left 1121160315 14:91732783-91732805 CCTGCTTTACCCTCATATCCTGA 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1121160321 14:91732802-91732824 CTGAAATATGTCTGGTATCTGGG 0: 1
1: 0
2: 3
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121160315 Original CRISPR TCAGGATATGAGGGTAAAGC AGG (reversed) Intronic
900265170 1:1753643-1753665 GCATGATCTGAGGGTCAAGCAGG + Exonic
905271393 1:36790018-36790040 ACAGGATATAAGGGAAAAGATGG - Intergenic
906103473 1:43277703-43277725 GCAGGTCATGAGGGTAGAGCTGG - Intergenic
907827385 1:58031897-58031919 TTAGGAAATGAGGGTATAGAAGG - Intronic
907990687 1:59579382-59579404 TTAGGATATCAGGGTCAGGCTGG - Intronic
911092882 1:94031710-94031732 TCAGGAGAGGAGGGGAAGGCTGG + Intronic
914673383 1:149888930-149888952 TCAGGAAAAGAGGGCAAAGAGGG - Intronic
916218700 1:162421550-162421572 TCATGATAAGAGGATAAAACAGG - Intergenic
916819708 1:168386575-168386597 TCAGGCTAAGATGGCAAAGCAGG - Intergenic
917489026 1:175481769-175481791 TCAGGATACCAGAGTAAGGCTGG - Intronic
917605663 1:176626196-176626218 TTAGGATATGAGGGAAGAGAAGG - Intronic
917755064 1:178090756-178090778 TCAGGATAGGGAGGTGAAGCAGG + Intergenic
920782968 1:209012389-209012411 TTAGGATATGGGGATACAGCAGG + Intergenic
921490462 1:215769654-215769676 GCAGGATATGGGGGTAGGGCTGG + Intronic
923085232 1:230698254-230698276 TCAGGATGGGAGGGTCAATCAGG - Intergenic
923203857 1:231739305-231739327 TAAGGATATGAAGATAAAGAGGG - Intronic
1065522239 10:26584227-26584249 TCAGGGTATGGGGGTGATGCAGG + Intergenic
1065528495 10:26645945-26645967 TCAGGATATGGGGGTGAGGCAGG + Intergenic
1070844445 10:79510385-79510407 ACAGGAAATGATGGAAAAGCAGG - Intergenic
1070851585 10:79567128-79567150 TCAGGATATCAGGATAATGCTGG + Intergenic
1070929352 10:80249923-80249945 ACAGGAAATGATGGAAAAGCAGG + Intergenic
1075177911 10:120183141-120183163 TCAGGTGATGAGGGAAAACCAGG + Intergenic
1075209432 10:120478364-120478386 TTCAGCTATGAGGGTAAAGCAGG - Intronic
1087062894 11:93999422-93999444 TCAGGATATGAGGTAAATCCTGG + Intergenic
1088510149 11:110565649-110565671 TCTGGATAAGAGGGTAAACCTGG + Intergenic
1088530695 11:110806044-110806066 GCTGGATATGAGGGAAAAGGAGG + Intergenic
1088538512 11:110887498-110887520 TCTGGATAGGAGTGTGAAGCGGG + Intergenic
1089264239 11:117246826-117246848 TCAGGATGTGACAATAAAGCGGG + Exonic
1093108059 12:15113121-15113143 TCAGTATATCAGGGTGAAGATGG + Intronic
1094717485 12:33027609-33027631 TCAGGATATGATGGTAGTACAGG - Intergenic
1095650629 12:44604670-44604692 GAAGGACAAGAGGGTAAAGCTGG + Intronic
1096043522 12:48541822-48541844 TCCTGATCTGAGGGTGAAGCAGG + Intergenic
1096689335 12:53309795-53309817 TCAGGATAGGAGGTTTTAGCAGG - Intronic
1100134346 12:91537277-91537299 TTAGGATGCAAGGGTAAAGCAGG + Intergenic
1100577185 12:95903870-95903892 TTTTGATATGAGGGTAATGCTGG + Intronic
1102306997 12:111812505-111812527 TAATGAGATGAGGGTTAAGCTGG - Intergenic
1104179534 12:126365172-126365194 TCAAGACATGAGGCTATAGCTGG - Intergenic
1104282724 12:127392490-127392512 TGAGGATATCTGGGGAAAGCAGG + Intergenic
1106625366 13:31415579-31415601 TCAGGATAAGTGGGTAGATCTGG - Intergenic
1108136337 13:47366505-47366527 TCAGGGTACGTGGGTAAAGCTGG - Intergenic
1108815044 13:54280182-54280204 TCAGGGTATCAGGGTAATCCTGG + Intergenic
1108837623 13:54571854-54571876 ACAGGATATGAGGGTAAGATAGG - Intergenic
1109257263 13:60098225-60098247 TCAGGATAAGAAAGTAAAGGAGG + Intronic
1113300010 13:109007953-109007975 TCAGGAAATGAAGATAAAGCTGG - Intronic
1113921408 13:113915074-113915096 GCAGGAAAGGAGGGTAAACCCGG - Intergenic
1115507745 14:34109118-34109140 TCAGGAGTTGATGGTACAGCTGG + Intronic
1115667161 14:35563443-35563465 GTAGGAGATGAGGGTAAAGATGG + Intronic
1117286405 14:54289884-54289906 TAAGGATATGAGGGAAAAAATGG - Intergenic
1121160315 14:91732783-91732805 TCAGGATATGAGGGTAAAGCAGG - Intronic
1121402096 14:93688857-93688879 TCCGGGAATGAGGGTAAAGAAGG + Intronic
1126495252 15:49283000-49283022 TTAGGATAGAAGGGTAAAGCAGG - Intronic
1127653229 15:61029672-61029694 ACTGGATCTGAGGGTAAAGAAGG + Intronic
1127757577 15:62107868-62107890 GGAGGAAATGAGGGAAAAGCAGG - Intergenic
1129707226 15:77801705-77801727 TCAGGATACGAGGGTGGGGCTGG - Intronic
1131781735 15:95866976-95866998 ACATGATATGAGGGTTAAGGGGG + Intergenic
1132050123 15:98600666-98600688 TCAGGCTATCAGTGTAAATCAGG - Intergenic
1134886777 16:17800204-17800226 TCAGGATCTGATGGAAAAGCTGG + Intergenic
1135562989 16:23490914-23490936 TCAGGAAAAGAGGTTAAAGATGG + Intronic
1136137765 16:28267787-28267809 TCTGGAAATGAGAGTAAAGCTGG + Intergenic
1138170571 16:54845369-54845391 TCAGGATATGAGTGAAGATCTGG + Intergenic
1138546506 16:57722750-57722772 TCAGTACAAGAGGGCAAAGCTGG + Exonic
1138694457 16:58798856-58798878 TCAGAGTATCAGGGTAATGCTGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1141906447 16:87029783-87029805 TCAGGCTAAGAGGGGAAAACTGG + Intergenic
1142175256 16:88642326-88642348 TCAGGGGATGAGGGCAGAGCGGG + Intergenic
1144366692 17:14551355-14551377 GCACGATATGAGGTTTAAGCAGG + Intergenic
1144490855 17:15707554-15707576 TCAGGAAAGGAGGAAAAAGCGGG - Intronic
1144570761 17:16397128-16397150 TCAGGACATGACGGAAGAGCAGG + Intergenic
1144654631 17:17027754-17027776 TCAAGATATGAGCTTAAACCGGG + Intergenic
1145362896 17:22226902-22226924 TCAGGACATGACGGAAGAGCAGG + Intergenic
1147525994 17:41223921-41223943 TCACAATATTAGGGTCAAGCAGG + Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1148770761 17:50064645-50064667 TCTGGAGATGAGGGGAGAGCCGG - Intronic
1148913341 17:50954977-50954999 TCAGGAAATGACAGGAAAGCCGG - Intergenic
1150481870 17:65517046-65517068 TGAGGCTATAAGGGCAAAGCAGG - Intergenic
1153965952 18:10182210-10182232 TCAGGATAGTGGGGGAAAGCCGG + Intergenic
1154214088 18:12402714-12402736 TCAGGACAAGAGGCTGAAGCGGG + Intergenic
1159670493 18:71215219-71215241 TCAGGCTATGATGGAAAAGGGGG - Intergenic
1163218333 19:15897011-15897033 TCCTGTTATGAGGGTACAGCTGG - Intronic
1164608138 19:29614444-29614466 TCTGGATTTGTGGGTAAGGCGGG - Intronic
1166274102 19:41739543-41739565 ACAGGTTATGGGGGTAAATCAGG + Intronic
1166418223 19:42611467-42611489 ACAGGTTATGATGGTAAATCAGG - Intronic
1166562269 19:43740833-43740855 TGGGAATATGAGGGCAAAGCAGG + Intronic
925179117 2:1805449-1805471 TCAGGATATGAAAGAAAAGAAGG + Intronic
925448086 2:3945003-3945025 TCAGCATGTGAGGGCAAAGGAGG - Intergenic
925684222 2:6454870-6454892 GCAGGATATGAAGATTAAGCAGG + Intergenic
925844632 2:8024368-8024390 TCAGGACACCAGGGAAAAGCAGG + Intergenic
926173574 2:10569595-10569617 TCAGGACATCAGGGTAGAGGAGG - Intergenic
926724400 2:15986336-15986358 TCAGGACATGAGGGAAACGCTGG - Intergenic
927398100 2:22678714-22678736 ACAGGTTATGATGGTAAATCAGG - Intergenic
931467998 2:62508592-62508614 TGAGGATGTCAGGGAAAAGCTGG + Intronic
931909499 2:66882238-66882260 TCAGGATATGAGGTTCAAATTGG - Intergenic
931945819 2:67306144-67306166 TCACCACATGAGGATAAAGCAGG - Intergenic
936125827 2:109788541-109788563 TCAGGTTCTCAGGGTAAAACAGG - Intergenic
936218866 2:110582927-110582949 TCAGGTTCTCAGGGTAAAACAGG + Intergenic
936876324 2:117194064-117194086 TCAGATTCTGAGGGTAAAGGTGG + Intergenic
937641802 2:124220941-124220963 TCAGGATATCAGTGTCAACCCGG + Intronic
938884503 2:135629721-135629743 TCAGGAGATGAGGCTGGAGCTGG + Intronic
940894322 2:159065586-159065608 TAAGGTTATGAGGCTAAACCTGG - Intronic
941802512 2:169675947-169675969 TCAGGATATCAGAGTAAACAAGG - Intronic
942167460 2:173255683-173255705 TTAGGAGATGAGAGTGAAGCAGG + Intronic
942171875 2:173297512-173297534 TCAGGATCTGAGGTTACACCAGG + Intergenic
942228892 2:173841337-173841359 TCAGGACATGAAAGAAAAGCTGG - Intergenic
943690163 2:190861420-190861442 TCAGGACAGGAAAGTAAAGCAGG + Intergenic
943933469 2:193885172-193885194 TCATGATATGAGGTTAAAACCGG - Intergenic
944441802 2:199750740-199750762 TCAGAATTTGAGGGGAGAGCAGG - Intergenic
945008850 2:205440385-205440407 TCAGGAGCTAAGGGAAAAGCAGG + Exonic
945315749 2:208369208-208369230 TTAGGCTATGAGGGTAAAACAGG - Intronic
947226136 2:227842227-227842249 TCAGGCTATGAGGGGAAGGGAGG - Intergenic
948686889 2:239675557-239675579 TCAGGAGAAGAGGCCAAAGCTGG + Intergenic
1173862073 20:46290544-46290566 TCAGGATATGAGTGTTTAGGGGG + Intronic
1174535512 20:51248294-51248316 TCAGGACATGAGGGTGAGGGAGG - Intergenic
1175180669 20:57144602-57144624 CCAGGAGTTGAGGGTAAAGTGGG + Intergenic
1175407041 20:58741609-58741631 TCAGGATATGTGGGTGAAGAAGG + Intergenic
1175919504 20:62444022-62444044 TGTGGACATGAGGGTAAACCTGG + Intergenic
1177269945 21:18834628-18834650 TCCGGATATTAGAGCAAAGCTGG + Intergenic
1179570212 21:42274120-42274142 TGAGGCTGTGAGGATAAAGCAGG - Intronic
1180916165 22:19488927-19488949 TCAGGATGGGAGGCTAAGGCAGG + Intronic
1184596250 22:45516006-45516028 TGTGGCTATGAGGGTAAGGCAGG + Intronic
1184654962 22:45936466-45936488 TCTGGATTTGAGGGGACAGCTGG - Intronic
950670069 3:14520591-14520613 TCAGGATAGCAGGGTGAGGCTGG - Intronic
952300369 3:32099538-32099560 ACAGAATATGAGGGGAAAGGGGG - Intergenic
953731433 3:45452672-45452694 TTTGGATATCAGGGTAATGCTGG + Intronic
953894051 3:46780784-46780806 TTTGGATATTAGGGTAATGCTGG - Intronic
956368960 3:68537412-68537434 ACAGGTTATGATGGTAAATCAGG + Intronic
957016413 3:75069570-75069592 TCAGGGAATTAGGGGAAAGCTGG + Intergenic
957066856 3:75530782-75530804 ATTGGATATGAGGGTAATGCTGG - Intergenic
959155505 3:102662204-102662226 TCAGAATATGAAGGTCAAACTGG - Intergenic
963781579 3:149491968-149491990 TCAGGACATCAGGGCACAGCAGG + Intronic
964250569 3:154711528-154711550 TGTGGATCTGAGAGTAAAGCGGG + Intergenic
966776975 3:183551190-183551212 TCAGGGTAAGATGGTAAACCAGG + Intronic
967350158 3:188506054-188506076 TGAGGATATGAGGGTTCATCAGG - Intronic
968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG + Intergenic
970430203 4:15982249-15982271 TCAAGCTGTGAGGGTGAAGCAGG - Intronic
972437789 4:39050828-39050850 TCAGGATAAGAAGGTATAACTGG + Intronic
976052330 4:81024028-81024050 TAAGGAAATCAGGGGAAAGCAGG + Intergenic
976608005 4:87000725-87000747 TCAGGGTATTAGGGTAAGGAAGG + Intronic
976776713 4:88714637-88714659 TTTGGATATCAGGGTAATGCTGG + Intergenic
978171749 4:105679787-105679809 TCTGGATGCGTGGGTAAAGCTGG - Exonic
980996797 4:139786783-139786805 TCAGGAGGTGAGGTTAAAGTGGG + Intronic
983896890 4:173090697-173090719 TCAGTATATGTAGATAAAGCTGG + Intergenic
986777945 5:11036338-11036360 GCAAGATATGAGTGTAAATCTGG - Intronic
987900916 5:24010757-24010779 TAATGATATGAGGGTAAAATAGG + Intronic
988600068 5:32631553-32631575 TTAGGATATGTGGGTATAGCTGG - Intergenic
990712854 5:58604573-58604595 TCAGGAAAGTAGGGGAAAGCCGG + Intronic
991229097 5:64310069-64310091 TTTTGATATGAGGGTAATGCTGG - Intronic
994914379 5:105955125-105955147 TTATGATATGAGGATAATGCTGG + Intergenic
996050997 5:118933320-118933342 TTTTGATATGAGGGTAATGCTGG - Intronic
996942812 5:129029573-129029595 TCAGGTTATGAAGGAAGAGCAGG + Exonic
999174409 5:149621786-149621808 TCAGGTTCTGAGGGCCAAGCAGG - Exonic
1001411393 5:171514908-171514930 TCGGGATGTGGGGGTAAAGGAGG + Intergenic
1001591435 5:172867984-172868006 TCAGGATTTGAGCCGAAAGCTGG + Intronic
1002884908 6:1285037-1285059 ACAAGAGATGAGGGAAAAGCTGG + Intergenic
1004798760 6:19120638-19120660 ACAGGTTATGTGGGTAAATCAGG + Intergenic
1007940783 6:45779277-45779299 GCAGGAGATGATGGAAAAGCAGG - Intergenic
1008423978 6:51335056-51335078 TCCTGATATAAGAGTAAAGCAGG + Intergenic
1008492145 6:52097511-52097533 AGAGAATATGAGGGTATAGCTGG - Intergenic
1010492509 6:76492666-76492688 TCAGCATATGATGGAAAACCTGG - Intergenic
1011248232 6:85342198-85342220 TAATCATATCAGGGTAAAGCAGG + Intergenic
1013587952 6:111596147-111596169 GCTGGATAAGAAGGTAAAGCAGG - Intronic
1018783578 6:167091024-167091046 TGAGGATATGAGAGTATAGATGG - Intergenic
1019587009 7:1810589-1810611 TCAGGAGATGAGGGGAAGGGAGG + Intergenic
1022525372 7:31033726-31033748 TCAGGACATGAGGGGAGAGGTGG + Intergenic
1023130794 7:37000838-37000860 CCAGGGTATGTGGGTTAAGCAGG + Intronic
1023533774 7:41186656-41186678 TCAGGACATGAGGCTTAAGTTGG + Intergenic
1026830990 7:73610042-73610064 GCTGGATATGAGGCTAGAGCAGG - Intronic
1030541446 7:110835466-110835488 TCAGGATGTTTGGGGAAAGCAGG - Intronic
1031368042 7:120927355-120927377 GCAGGAAATGAGGGTTAAGTGGG - Intergenic
1031740093 7:125418690-125418712 TCAGGGAAGGAGGGGAAAGCCGG - Intergenic
1032999726 7:137491181-137491203 TCAGGAGCTGAGGTTAAAGGAGG + Intronic
1035877918 8:3211880-3211902 TCAGGATATGAGGGGCACCCAGG + Intronic
1036959972 8:13233396-13233418 TCATGAAATGAGGGTAAAAATGG - Intronic
1037495066 8:19431649-19431671 TTAGGTTATCAGGGTAATGCTGG + Intronic
1042691579 8:71505530-71505552 TTTGGATATGAGGGGAGAGCAGG - Intronic
1042784835 8:72536463-72536485 CCTGGGTTTGAGGGTAAAGCCGG - Intergenic
1045994174 8:108343218-108343240 TCAGGAAAGTAGGGGAAAGCTGG - Intronic
1046496130 8:115015973-115015995 TTTTGATATGAGGGTAATGCTGG + Intergenic
1048283863 8:133126160-133126182 GCAGGATCAGAGGGTTAAGCTGG + Intronic
1048296385 8:133217740-133217762 TCAGAATATGGGGGTGAACCTGG - Intronic
1051126531 9:13811594-13811616 TCAGGGTGGGAGGGTAAAGTGGG - Intergenic
1055379915 9:75695088-75695110 GCAGGAGAAGAGAGTAAAGCTGG - Intergenic
1057954135 9:99394050-99394072 TCAGAATTCTAGGGTAAAGCAGG + Intergenic
1188422835 X:30010408-30010430 CCTGGACATGAGGGTAAAGTAGG + Intergenic
1189431211 X:40949362-40949384 TCAGGAGATCAGGGACAAGCAGG + Intergenic
1190973324 X:55374422-55374444 TTTTGATATGAGGGTAAGGCTGG + Intergenic
1192981961 X:76353756-76353778 TCAGGAAATTAGGGGAAAGCTGG - Intergenic
1193777537 X:85662126-85662148 CCAGGTTATAAAGGTAAAGCAGG - Intergenic
1195363618 X:104107328-104107350 ACTGGCTATGAGGGTAAAGGAGG - Intronic
1195709911 X:107765405-107765427 TGAGGAGCTGAGGGTATAGCAGG - Intronic