ID: 1121160451

View in Genome Browser
Species Human (GRCh38)
Location 14:91734425-91734447
Sequence CATAAAAAGGATAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 2, 2: 3, 3: 46, 4: 688}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121160451_1121160454 24 Left 1121160451 14:91734425-91734447 CCAGCCTTCTTATCCTTTTTATG 0: 1
1: 2
2: 3
3: 46
4: 688
Right 1121160454 14:91734472-91734494 GTTCAAAGACTAAGATAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121160451 Original CRISPR CATAAAAAGGATAAGAAGGC TGG (reversed) Intronic
900668779 1:3836003-3836025 CATAAAAAAAAAAAAAAGGCCGG + Intronic
902074025 1:13768377-13768399 CTTAAAAAAAAAAAGAAGGCCGG - Intronic
902824245 1:18962062-18962084 CATAAAATGTATAAAGAGGCAGG + Intergenic
902831623 1:19017551-19017573 CATAAAAAGAAGAAGAGGCCGGG + Intergenic
903195322 1:21682478-21682500 CATAGGAAGCATAAGAAAGCTGG - Intronic
904414607 1:30350692-30350714 TATAATAAGCATAAGAAAGCTGG - Intergenic
905289135 1:36909595-36909617 GATAAAAAAGAAAAAAAGGCCGG - Intronic
906026839 1:42681726-42681748 GGTAAAACGGATCAGAAGGCAGG + Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906324838 1:44839023-44839045 AAGAAAAAGTGTAAGAAGGCAGG - Intronic
907483331 1:54759707-54759729 AACAAAAAAGAAAAGAAGGCTGG + Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
908017596 1:59860574-59860596 AATAAAAAGAATAAGTAGCCTGG - Intronic
908778536 1:67666504-67666526 CTTAATAAGGATAATAAGTCTGG + Intergenic
908995405 1:70146608-70146630 CTTAATAAGGTTGAGAAGGCTGG - Intronic
909783093 1:79573956-79573978 CATAAAAGGGTTTAGAAGGTAGG - Intergenic
910074563 1:83262363-83262385 TATATAAAGGATAAGAAAACTGG - Intergenic
910276902 1:85459273-85459295 CATTATAAGACTAAGAAGGCAGG - Intronic
910480544 1:87653938-87653960 AATAAAAAGAAAAAGAAGGCTGG + Intergenic
911101329 1:94098051-94098073 CATAAAAACCATCAGAGGGCCGG - Intronic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912171767 1:107108757-107108779 CATAAAGATAATAAGCAGGCCGG - Intergenic
912596591 1:110884757-110884779 AATAAAAGGGAAAAAAAGGCTGG - Intronic
913032953 1:114930498-114930520 CATTAAAAAGATAAGAAAGGGGG + Intronic
913038540 1:114999984-115000006 CACAAAAAAGCTAAGAAGGAGGG + Intergenic
915416840 1:155748891-155748913 CTTAAAAAGGATAAAAAGAAGGG + Intergenic
915688036 1:157655885-157655907 TATAAAATGAATAAAAAGGCAGG + Intergenic
918345033 1:183599847-183599869 CAAAAAAAGAAAAAGAGGGCAGG - Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918607171 1:186441921-186441943 CTTAAAAAGGGTAAGAGGCCAGG + Intergenic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919335889 1:196232952-196232974 GAAAAAAGGTATAAGAAGGCTGG + Intronic
919627107 1:199922406-199922428 CATAAAAAAGTTAGAAAGGCCGG + Intergenic
920125673 1:203692174-203692196 CAAAAAAAGAAAAAAAAGGCCGG - Intronic
920159052 1:203981379-203981401 CATTAAAAATATTAGAAGGCTGG - Intergenic
920215828 1:204360986-204361008 CATAAACAGGATCAGAAAGATGG + Intronic
920445643 1:206014131-206014153 GATAAAAAGGTTAAGGAGGTGGG + Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
920768712 1:208859100-208859122 CATAAAAAGAAATAGATGGCCGG + Intergenic
921067801 1:211634902-211634924 AATAATAACTATAAGAAGGCTGG + Intergenic
921231808 1:213080859-213080881 CATAATAACGTTAATAAGGCAGG - Intronic
921383125 1:214544961-214544983 CACAAAGAGGTTAAGCAGGCAGG + Intronic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922038609 1:221874025-221874047 CATAGACAGGGTAGGAAGGCAGG + Intergenic
922311360 1:224394789-224394811 CATTAAGAGGATAAGCAGGCGGG - Intronic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923185470 1:231568862-231568884 TACAAAAAAGAAAAGAAGGCTGG - Intronic
923585540 1:235266979-235267001 CATAAAAACCATCAGTAGGCTGG + Intronic
923667355 1:236010594-236010616 CCTAAAAAGCATAAATAGGCTGG - Intronic
923694536 1:236234557-236234579 GAGACAAAGGATAAGAAGCCAGG + Intronic
923799458 1:237193167-237193189 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
923944798 1:238872298-238872320 AATAAAAAGTAAAATAAGGCCGG - Intergenic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924455729 1:244217576-244217598 AATAAACAGGCTAAGAATGCTGG + Intergenic
924745156 1:246825180-246825202 CATTAAAAGACTGAGAAGGCTGG - Intergenic
924850241 1:247821883-247821905 CACAAAAAGGATAAAAAGTAAGG - Intergenic
924925781 1:248678187-248678209 GACAAAAAGGACAATAAGGCAGG + Intergenic
1063468927 10:6268723-6268745 CATAAAGAGGTTAAAGAGGCTGG + Intergenic
1063656988 10:8000411-8000433 CATAAAAAAAAGAAAAAGGCCGG - Intronic
1063945194 10:11169236-11169258 TCTAAAAGGGACAAGAAGGCAGG + Intronic
1064043590 10:11990431-11990453 CTTAAAAAGGGTTAGGAGGCCGG + Intronic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1065053857 10:21823024-21823046 CAGAAAAGGGATAAGAATGCAGG + Intronic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1066131303 10:32396924-32396946 TACAAAAAGAAAAAGAAGGCTGG + Intergenic
1067105975 10:43366640-43366662 CATAAAAAGCACAGCAAGGCTGG + Intergenic
1067411405 10:46068040-46068062 TAGAAAAAGGATATGAAGGAGGG + Intergenic
1068445256 10:57113637-57113659 CATAGAAAGCTTAAGAATGCAGG + Intergenic
1068978481 10:63036085-63036107 TATAAAAATAAAAAGAAGGCAGG + Intergenic
1069009191 10:63352327-63352349 AATAAAAAGGATAAGTAAACTGG + Intronic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1069322158 10:67185420-67185442 GAAAAAAAGGAAAAAAAGGCCGG - Intronic
1069470752 10:68687197-68687219 ATAAAAAAGGATAAGTAGGCCGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070326353 10:75391927-75391949 CATAAAGAGAATATGATGGCAGG + Intergenic
1070957830 10:80475879-80475901 TATAAAAAGGATGGGGAGGCCGG - Intronic
1072027191 10:91472011-91472033 CTTAAAAAAGATAACAAAGCTGG + Intronic
1072234293 10:93439768-93439790 TATAAAAAGCATATGAAGACAGG + Intronic
1072238225 10:93471590-93471612 CCTAAAAACGAAATGAAGGCGGG + Intronic
1072313789 10:94182250-94182272 AATAAAAAAGAAATGAAGGCAGG - Intronic
1072513692 10:96154450-96154472 GAAAAAAAAGAAAAGAAGGCAGG - Intronic
1072765884 10:98094965-98094987 AATTAAAAGGAAAGGAAGGCAGG + Intergenic
1072808558 10:98442802-98442824 CCTAAAAAGTTTAACAAGGCTGG - Intronic
1072839143 10:98751103-98751125 CAAAAACAGGATAAAAAGGTGGG - Intronic
1072907628 10:99469142-99469164 CTGAAAAAGGCTAAGAGGGCAGG - Intergenic
1073145103 10:101275487-101275509 CAAAAAAAGAAAAAAAAGGCTGG + Intergenic
1073447171 10:103588648-103588670 GTTAAAAAGGAGAGGAAGGCCGG + Intronic
1073560485 10:104492211-104492233 AAAAAAAAGAATAATAAGGCTGG - Intergenic
1074345787 10:112684733-112684755 CATAAAAGAGATGAGCAGGCCGG - Intronic
1074879301 10:117641206-117641228 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1074932948 10:118147676-118147698 GATAGAAAGGAGAACAAGGCAGG - Intergenic
1074959337 10:118426331-118426353 AATAAAAAGGAGTAGAAGGTAGG - Intergenic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075305351 10:121362828-121362850 CAAAAAAATGTTAAAAAGGCAGG + Intergenic
1075490701 10:122866200-122866222 CATTAAAAGGATAAAAAAGGAGG - Intronic
1075700533 10:124466751-124466773 CTTAAAAATGATATGCAGGCTGG - Intronic
1076506342 10:130975525-130975547 CATAAAAAGATTAAACAGGCAGG - Intergenic
1076884034 10:133253239-133253261 CAAAAAAAAAAAAAGAAGGCTGG + Intergenic
1077092281 11:784574-784596 CATAAAAAGGAAGGGAAGGTTGG + Intergenic
1077488598 11:2850270-2850292 CATAATATGGACAACAAGGCGGG - Intergenic
1077820947 11:5740043-5740065 AATGTAAAGGATAAGAAGGGAGG - Intronic
1078252886 11:9631696-9631718 CATAAAAAGGAAATACAGGCCGG - Intergenic
1078404189 11:11054937-11054959 CCTAAATAGGACAAAAAGGCAGG + Intergenic
1078485784 11:11722119-11722141 TAAAAAAAGTATAAGTAGGCTGG - Intergenic
1079822491 11:25148303-25148325 GAAAAAAAGGAAAAGAAGGAAGG + Intergenic
1079981118 11:27152392-27152414 AACCAAAAGGATATGAAGGCTGG + Intergenic
1080659311 11:34283212-34283234 CAAAAAAAGAAAAAGATGGCCGG - Intronic
1080740481 11:35059379-35059401 CAGAAAAAGGATTAGAATTCAGG - Intergenic
1080775764 11:35385213-35385235 CATAAAAAGGAGGGGAGGGCAGG - Intronic
1080888433 11:36387771-36387793 CATAAAAGGTCTGAGAAGGCTGG + Intronic
1081150598 11:39625719-39625741 CATAAAAGGGATAAAACAGCAGG + Intergenic
1082007125 11:47425690-47425712 CTTAAAAGGGACAAGAAGACAGG - Intronic
1082669864 11:56022403-56022425 TAAAAAATGTATAAGAAGGCCGG + Intergenic
1083373793 11:62203401-62203423 CAGAAACAGGATATGAAGCCAGG - Intergenic
1083918710 11:65768008-65768030 AAAAAAAAGAAAAAGAAGGCCGG - Intergenic
1084535569 11:69754333-69754355 CATAAAAAGGAAAGAAGGGCTGG - Intergenic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1086230794 11:84567882-84567904 TCTAAAAAGGGTAAGAAGACTGG + Intronic
1086560520 11:88163088-88163110 CATAAAAAGCAGTACAAGGCAGG - Intronic
1086689831 11:89776899-89776921 GATGAAAAGGAAAAAAAGGCCGG - Intergenic
1086716024 11:90063057-90063079 GATGAAAAGGAAAAAAAGGCCGG + Intergenic
1087903381 11:103667861-103667883 CAAAAAAAGGAAAGTAAGGCTGG - Intergenic
1089031820 11:115338770-115338792 CATAAAAGTGATAAGAAGAGGGG + Intronic
1089420465 11:118329612-118329634 TATTAAAAGAATAAGAAGTCAGG + Intergenic
1090641737 11:128735102-128735124 AATAAACTGGAGAAGAAGGCAGG - Intronic
1092324714 12:7517823-7517845 GAAAAAAAGAAAAAGAAGGCTGG + Intergenic
1092451280 12:8604932-8604954 AAAAAAAAGGAAAAAAAGGCGGG + Intronic
1093667962 12:21836888-21836910 AATAAAAAGGACAACATGGCAGG + Intronic
1093697292 12:22175675-22175697 AAAATAAAGGATAAGAGGGCTGG - Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094212948 12:27911230-27911252 TTTAAAAAGGAAAAGATGGCCGG - Intergenic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1095366652 12:41414562-41414584 TATAAAAAGGAAAAGAAAGAAGG + Intronic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1096141567 12:49246845-49246867 CTTAAAAAGTAAAACAAGGCCGG + Intronic
1096151901 12:49319363-49319385 CAAAAAAAGTAAAAGCAGGCTGG + Intergenic
1097028877 12:56077755-56077777 CAAAAAAAGGAAAAAAAGCCAGG + Intergenic
1097270501 12:57771273-57771295 CATAAGAAGCATGAGAAGGTTGG + Intronic
1097420505 12:59372804-59372826 GTTAAAAAGGAAAAGGAGGCCGG - Intergenic
1098441213 12:70520951-70520973 CAAAAAAAGGATTAGAGGGAGGG - Exonic
1098899818 12:76101330-76101352 CAAAAAAAGAAAAACAAGGCAGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1100123848 12:91399450-91399472 CATGTAAAGGCAAAGAAGGCAGG + Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100728511 12:97436638-97436660 CATGAAAAAGATGGGAAGGCTGG + Intergenic
1100979292 12:100152247-100152269 CACAAAAAGGCTAAGGATGCTGG - Intergenic
1101245258 12:102878607-102878629 CATAAAGAGAAAAAGAAGGAGGG + Intronic
1102074930 12:110052190-110052212 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1102249693 12:111378026-111378048 CAAAAAAAAAATAAAAAGGCCGG + Intergenic
1102633214 12:114300170-114300192 CAGAAAAAGGATATCTAGGCTGG - Intergenic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1102837548 12:116079520-116079542 AATAAAATGAATAAAAAGGCTGG - Intronic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103550885 12:121736548-121736570 CTCAAAAAGAAAAAGAAGGCCGG - Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104024977 12:125019152-125019174 GCTAAAAAGGAGTAGAAGGCCGG - Intronic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106442814 13:29793733-29793755 CATAAAACGGATACAAAGTCTGG + Intronic
1106719852 13:32426928-32426950 CTTAAAAGGCAAAAGAAGGCGGG + Intronic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1107249434 13:38340750-38340772 CATAAAAAGAATCAGTAGGATGG - Intergenic
1107722125 13:43259768-43259790 TATCAAAAGGAAAATAAGGCCGG - Intronic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1107890747 13:44912076-44912098 CACAAAAAGGGTAAGAGGGTTGG - Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108568683 13:51728281-51728303 CCTGAAAAGGATATGAAGGAAGG - Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1109176628 13:59165940-59165962 CATTAAAAGGATAAGTAAGTAGG + Intergenic
1109356465 13:61235590-61235612 CATCAAAAAGGTAAAAAGGCCGG + Intergenic
1110609154 13:77469840-77469862 CATAAAAAGGGGATCAAGGCTGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111802979 13:93003203-93003225 CATAAAAACAATAAGAAAGCTGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112350664 13:98630761-98630783 CAAAAAAAAGAAAAAAAGGCTGG - Intergenic
1112573840 13:100618071-100618093 CATAAAAAGGATAAAATACCTGG - Intronic
1112579876 13:100669459-100669481 CATACAAAGGAAAGGAAGGGAGG + Intronic
1112641076 13:101275723-101275745 CACAAAAAGGAAAAGAAACCAGG + Intronic
1114407564 14:22470952-22470974 CATAGAAAGGACGAGAAGGAAGG - Intergenic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1114990249 14:28277808-28277830 CTTAAAAAAAATTAGAAGGCCGG + Intergenic
1115233748 14:31188528-31188550 GATAGAAAGAATAACAAGGCCGG - Intronic
1115324051 14:32116618-32116640 AATAAAAAGCATCAGTAGGCAGG + Intronic
1116636684 14:47404788-47404810 CTTAAAAATGATAGGTAGGCTGG - Intronic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1116884392 14:50205345-50205367 CATAAAAAGTTAAAGCAGGCTGG - Intronic
1117122196 14:52580068-52580090 CAGAAAAAGGTTAACATGGCAGG - Intronic
1117388365 14:55239159-55239181 CATAAAAAGGAGATCCAGGCCGG - Intergenic
1117587427 14:57224764-57224786 CATAAAAAGGAAAAAAAGCTGGG + Intronic
1117996345 14:61481727-61481749 CATAGAAAGGATAAAAAAGATGG - Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118356137 14:65015397-65015419 AAAAAAAAAGATAACAAGGCTGG - Intronic
1118860958 14:69662866-69662888 AATAAAAATGATTGGAAGGCAGG + Intronic
1118901707 14:69991858-69991880 CCTAAAACAGATAAGAAGGCAGG - Intronic
1119216152 14:72870776-72870798 CATTAAAAGGGTAACGAGGCTGG + Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1120518943 14:85503735-85503757 CTTAAAAAGCAAAAGAAGCCGGG + Intergenic
1121046140 14:90789424-90789446 TTAAAAAAGGAAAAGAAGGCAGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121174239 14:91878782-91878804 TATAAAAAGGAAGAGTAGGCTGG - Intronic
1121754316 14:96390802-96390824 AATAAAAAGAACAAGAACGCTGG + Intergenic
1122168247 14:99847816-99847838 AATAATAAGTATAAAAAGGCTGG - Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122671612 14:103377085-103377107 CATAAAGAGGGTAAAAACGCAGG - Intergenic
1122832515 14:104406935-104406957 AATAGAAAGAATGAGAAGGCGGG + Intergenic
1123961905 15:25411670-25411692 CATAAAAAGATTGAGAGGGCAGG - Intronic
1124434397 15:29635137-29635159 CATAAAAACCCTAAGGAGGCCGG - Intergenic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125395027 15:39237343-39237365 CATAGAAAGGATAATCAGACAGG + Intergenic
1125713134 15:41803428-41803450 AAAAAAAAGGTTAAGCAGGCAGG + Intronic
1125849154 15:42887128-42887150 TATAAAGAGGTTTAGAAGGCTGG - Intronic
1126528878 15:49689759-49689781 CCTTAAAGGAATAAGAAGGCTGG + Intergenic
1126650898 15:50920407-50920429 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127184413 15:56463485-56463507 CATAAAAAATAAAAGCAGGCTGG + Intronic
1127534256 15:59875132-59875154 CAAAAAAAGGAAAGGAAGGAAGG - Intergenic
1127603165 15:60559263-60559285 CATAAAAAGGATAAAAACCAGGG - Intronic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1128018348 15:64367842-64367864 CATAAAAAGTGTAATGAGGCTGG - Intronic
1128068397 15:64778050-64778072 CTAAAAAAAGAAAAGAAGGCCGG - Intergenic
1128573866 15:68756202-68756224 GATAAAAAGGAAAAGAAGCTTGG + Intergenic
1129754513 15:78089081-78089103 CACAAAAAGGCTAAGGATGCTGG - Intronic
1130727756 15:86458105-86458127 GATAACAAGGCTCAGAAGGCTGG + Intronic
1131456463 15:92586010-92586032 AATGGAAAGGACAAGAAGGCTGG + Intergenic
1131826815 15:96328625-96328647 CCTAAAGAGGATAAGAAGGATGG - Intronic
1131921637 15:97334435-97334457 GATAAATTGGATAAGAAAGCTGG - Intergenic
1132071611 15:98782071-98782093 CATAAACAGGAGACCAAGGCAGG - Intronic
1132612955 16:826604-826626 CACAAAAAGAATAAGAGGGTCGG + Intergenic
1133084715 16:3353193-3353215 GATGAAAAGAATAAGTAGGCCGG + Intergenic
1133084761 16:3353502-3353524 AAAAAAAAGAATAAGTAGGCCGG + Intergenic
1133476771 16:6130696-6130718 AATAGTAAGGATAAGAAAGCTGG + Intronic
1134267635 16:12705459-12705481 CATAAAAAAGAAAATTAGGCTGG + Intronic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134586007 16:15411655-15411677 AATAACAATTATAAGAAGGCTGG + Intronic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135731303 16:24897248-24897270 CTTAAAAAGGCAAAGGAGGCTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136623386 16:31444935-31444957 TATAAAAAGGATAACCAGGTGGG + Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1137226407 16:46515610-46515632 TATAAAAAGCAGAACAAGGCTGG + Intergenic
1137984351 16:53094933-53094955 AGTAAAAAGGAAAACAAGGCCGG - Intronic
1138320599 16:56107962-56107984 GATTAACAGGATAAGAAAGCAGG + Intergenic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1138587919 16:57983907-57983929 CAAAAAAAGAAAAAAAAGGCTGG - Intronic
1138812540 16:60167607-60167629 CATGAAAAGGATTTGAAGGTGGG + Intergenic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139014397 16:62672393-62672415 CATCAAAAGTGAAAGAAGGCTGG + Intergenic
1139918230 16:70441164-70441186 TATAAAAAAGAAAAGAAGGCTGG + Intergenic
1140168366 16:72577967-72577989 TTTAAAAAGGAAAAAAAGGCTGG + Intergenic
1140302493 16:73771982-73772004 CACAAAAATGATATGAAGGTTGG - Intergenic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1140389711 16:74574943-74574965 CATATAAAGAACAAGAAGCCGGG + Intronic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141386716 16:83628139-83628161 CATAAACAGGATAAGATGGGAGG - Intronic
1141790190 16:86229106-86229128 GTTAAAAAGAATAAGATGGCAGG - Intergenic
1142973540 17:3629432-3629454 CATAAAAAGGATATGCCGGCCGG + Intronic
1142999872 17:3786593-3786615 TATAAAAAGCATAATACGGCCGG + Intronic
1143150478 17:4804878-4804900 CATTGAAAGAAAAAGAAGGCGGG - Intergenic
1145375969 17:22349055-22349077 CATATAAAGGAATAGAAGGCTGG - Intergenic
1145847192 17:28050806-28050828 GATAAAAAGTCAAAGAAGGCCGG + Intronic
1146134149 17:30304094-30304116 CTTAAAAAAGAAAGGAAGGCCGG + Intergenic
1146176831 17:30670473-30670495 CTTAAAAAAAAAAAGAAGGCCGG - Intergenic
1146422254 17:32698381-32698403 CTTAAAAAAGAAAAGAAGGAAGG - Intronic
1147029700 17:37622592-37622614 CATAAAAAGGCTAAGAAACTCGG - Intronic
1147174475 17:38645296-38645318 CAAGAAAAGGATATGAAGACTGG + Intergenic
1147399385 17:40170807-40170829 AATATTAAGGATAAGAAGCCAGG - Exonic
1147814599 17:43199874-43199896 CATAAAAAGGAAAAAAGGGATGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148792147 17:50179385-50179407 AAAAAAAAAGATAAAAAGGCTGG - Intergenic
1148930374 17:51122251-51122273 CATAAAAACAATATGAAGGTTGG + Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1150352573 17:64457358-64457380 CATGAAAAGGATAAACAGACTGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1151054661 17:71017618-71017640 CATAAAAGGCCCAAGAAGGCAGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151263859 17:72938444-72938466 CCTAATAAGGAACAGAAGGCTGG - Intronic
1151614033 17:75196461-75196483 CCTAAAAGGGGTAAGAGGGCCGG + Intergenic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153137725 18:1935686-1935708 CATAACAAGGAAATGAAGGAAGG + Intergenic
1153557351 18:6329447-6329469 TATAAAAAGAAACAGAAGGCTGG - Intronic
1154344935 18:13534038-13534060 CATAGGAAGCATCAGAAGGCAGG - Intronic
1155002074 18:21697367-21697389 TAAAAAAAGGATAAATAGGCTGG - Intronic
1155241657 18:23869756-23869778 AATATAAAGGTTAAAAAGGCAGG + Intronic
1155418435 18:25627136-25627158 GATAAAAAGAATAGAAAGGCTGG - Intergenic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1156641838 18:39110863-39110885 AATAAAATGGATAAGAAAGTAGG + Intergenic
1157048529 18:44132568-44132590 CATAAAAAGTAAAAATAGGCTGG + Intergenic
1157058338 18:44256644-44256666 CCCAAAAAGCATAATAAGGCTGG + Intergenic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1159529921 18:69642577-69642599 AATAAAAATGAAAAAAAGGCAGG - Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161775043 19:6256456-6256478 CAAAAAAAGAAAAAAAAGGCGGG + Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1162059630 19:8086762-8086784 AATAAAAATGAAAATAAGGCTGG - Intronic
1162434532 19:10649413-10649435 AATAAAAACAAAAAGAAGGCTGG - Intergenic
1162776352 19:12982082-12982104 CACAAAAGGGGAAAGAAGGCAGG - Intergenic
1162835079 19:13311385-13311407 CATTAAAAAGAAAAGAAAGCCGG - Intronic
1162844998 19:13385522-13385544 TCTAAAAAAGAAAAGAAGGCCGG - Intronic
1163696540 19:18766741-18766763 AATAAAAAGGATTACAAGGCTGG - Intronic
1163775979 19:19217980-19218002 CAAAAAAATAATAATAAGGCTGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164658367 19:29941059-29941081 CATAAAAAGGAAAAAAAGGGTGG + Intronic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1165598306 19:37030455-37030477 CATATAAAGAAATAGAAGGCCGG - Intronic
1165752093 19:38266377-38266399 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
1166079682 19:40435793-40435815 AATAAAAAGAAAAATAAGGCCGG - Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166605978 19:44143150-44143172 CAAAAATAGTATAAGAGGGCAGG + Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167894654 19:52571105-52571127 AAAAAAAAAGATAAGAAAGCAGG + Intronic
1167904572 19:52648140-52648162 AAAAAAAAAGATAAGAAAGCAGG - Intronic
1168014239 19:53558430-53558452 CATAAAAGGCCTAAGAAGACAGG - Intronic
1168083846 19:54030395-54030417 TATAAAAATTATGAGAAGGCCGG + Intergenic
1168375478 19:55875170-55875192 CATGAAAAAGATAAGAACGGTGG + Intronic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926008666 2:9391879-9391901 CTTAAAAAGAAAAACAAGGCTGG - Intronic
926232594 2:11016158-11016180 AATAAAAAGAATAAGAATGAGGG - Intergenic
926654511 2:15386510-15386532 CGTAAAAATGTAAAGAAGGCTGG - Intronic
927815112 2:26208903-26208925 AATAAAATGGATAAGAAGTCCGG - Intronic
928495402 2:31826557-31826579 CTAAAAAAGGACAAGAAGGAAGG - Intergenic
929531891 2:42757876-42757898 AATAAAAACACTAAGAAGGCTGG - Intergenic
929712501 2:44279294-44279316 CTAAAAAAGGGTGAGAAGGCAGG - Intronic
930565003 2:53007712-53007734 CATAAATAGGACTAGAATGCAGG - Intergenic
931043207 2:58320391-58320413 CATAAAAATGAAAGAAAGGCCGG - Intergenic
931187331 2:59966072-59966094 CAAAAAAAAGATGAGTAGGCCGG + Intergenic
931239296 2:60438389-60438411 GATAAAACTGATCAGAAGGCTGG - Intergenic
931510275 2:62983836-62983858 CATAAAAAGGAGGCAAAGGCCGG - Intronic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
932261928 2:70334213-70334235 CTTGAAAAGGAAAATAAGGCTGG - Intergenic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
932785318 2:74596284-74596306 CATAAAAACAGTAAGATGGCGGG + Intronic
932861499 2:75297428-75297450 CATTTAAAAGAAAAGAAGGCTGG - Intergenic
933869510 2:86551883-86551905 CATAAAAAGGCTTAGAAGCAGGG + Intronic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
934161207 2:89251360-89251382 CAAAAAAAGAATAACAGGGCAGG - Intergenic
934206070 2:89931069-89931091 CAAAAAAAGAATAACAGGGCAGG + Intergenic
934936073 2:98466340-98466362 CTTAAAAAACATAACAAGGCCGG - Intronic
935988270 2:108695502-108695524 TATAAAAAGCGTGAGAAGGCCGG - Intergenic
937503327 2:122507955-122507977 AATTAAAAGGATATTAAGGCTGG + Intergenic
937657444 2:124392703-124392725 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
938143974 2:128819120-128819142 GAAAATAAGGGTAAGAAGGCTGG - Intergenic
938421572 2:131151428-131151450 GGTGAAAAGGATGAGAAGGCTGG - Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
939718695 2:145618991-145619013 TATTAAAATGTTAAGAAGGCAGG - Intergenic
939726901 2:145732019-145732041 AATAATAATAATAAGAAGGCAGG + Intergenic
939846144 2:147248276-147248298 CATAAAAGAGATTAAAAGGCAGG + Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940075854 2:149741351-149741373 CATAAAATGGAGGAGAATGCTGG - Intergenic
940340068 2:152570882-152570904 CATAAAAGTGATAAGAAAACTGG + Intronic
940506792 2:154565616-154565638 CATAGAAGTGAAAAGAAGGCTGG - Intergenic
940566948 2:155377156-155377178 CATAAAAAGGCAAAAAAGGGAGG + Intergenic
940604628 2:155904886-155904908 CATAAGAATGCTAGGAAGGCAGG - Intergenic
940690926 2:156919546-156919568 CAAAAAACAAATAAGAAGGCCGG - Intergenic
941341933 2:164317010-164317032 AATAAAAAGAAAATGAAGGCAGG + Intergenic
941785923 2:169498519-169498541 CTTAGAAAGGTTAAGGAGGCCGG + Intronic
942008812 2:171737712-171737734 AATAAAAAGAAAAACAAGGCTGG - Intronic
942157586 2:173147584-173147606 CAAAAAAAGAAAAAAAAGGCTGG - Intronic
942178973 2:173361746-173361768 GCTAAAAAGCAAAAGAAGGCTGG - Intronic
943026331 2:182633785-182633807 GATTAAAAGGATAACCAGGCTGG + Intergenic
943056148 2:182983101-182983123 CATATAAGGGAGAAGAATGCAGG + Intronic
943977943 2:194507998-194508020 TAAAAAAGGAATAAGAAGGCTGG + Intergenic
944125149 2:196284044-196284066 CATAAAAAGGAAAAGATGGTAGG - Intronic
944181185 2:196896547-196896569 CTTAAAAAATAAAAGAAGGCCGG + Intronic
944400425 2:199319822-199319844 CATAAAAGGGAGAAGATAGCAGG + Intronic
944793282 2:203155414-203155436 CAAAAAAAGGAAAAGAAAGAAGG - Intronic
945423818 2:209673823-209673845 TATAAAAAGGAATAGAAGGTAGG + Intronic
945507021 2:210654132-210654154 GAAAAAAATGATGAGAAGGCAGG - Intronic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946239919 2:218347593-218347615 CATAAAAATGATTAAAGGGCCGG + Intergenic
946282759 2:218678244-218678266 CATAAAAAATAAAAGAAGGTTGG - Intronic
946291657 2:218749983-218750005 CAGAAAAAGGATAAAAAGAGTGG - Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948457328 2:238111221-238111243 CATTCAAAGGATAACTAGGCCGG - Intronic
948483593 2:238265778-238265800 TATAAAGAAGCTAAGAAGGCTGG - Intronic
948774510 2:240276630-240276652 CATAAAAATAAAAAGAAGGAAGG + Intergenic
1169419802 20:5450842-5450864 ATTAAAAAGAAAAAGAAGGCCGG + Intergenic
1169604232 20:7297684-7297706 CATCAAAAGAATAAGTAGGTAGG - Intergenic
1169812386 20:9621288-9621310 AATAAAAAGGAACAGATGGCGGG + Intronic
1169842879 20:9959567-9959589 AATAAATGGGAAAAGAAGGCTGG + Intergenic
1170147075 20:13187451-13187473 TATAAAAAGACAAAGAAGGCCGG + Intergenic
1170334275 20:15250707-15250729 GATCCAAAGGATAAGAAGGGAGG - Intronic
1171511408 20:25687860-25687882 TTTAAAAAGGAAAAGTAGGCTGG - Intronic
1172088807 20:32411935-32411957 CATAAAAAGGACACAAAAGCTGG - Intronic
1172111219 20:32546240-32546262 CAAAAAAAGGAAAAAAAAGCTGG - Intronic
1172690612 20:36786983-36787005 AAAAAAAAGGATAAAAAGGAAGG - Intronic
1172888038 20:38245020-38245042 TAAGAAAAGGATGAGAAGGCCGG - Intronic
1172899385 20:38323179-38323201 CATAAAAAGTATAAAAACACAGG - Intronic
1173071651 20:39774069-39774091 CATGAGAAGGAAAATAAGGCAGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1173975331 20:47182637-47182659 AAAAAAAAGGTTAAGATGGCTGG + Intronic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174492981 20:50915928-50915950 CTTAATAAAGATAAGCAGGCAGG + Intronic
1174629835 20:51946650-51946672 CTTAAAAAGGGACAGAAGGCTGG - Intergenic
1174778562 20:53367865-53367887 TAAAAGAAGAATAAGAAGGCTGG - Intronic
1174871678 20:54188546-54188568 CGTAGAATTGATAAGAAGGCTGG - Intergenic
1175344014 20:58257696-58257718 CTTAAAATGGAAAAGAATGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177525337 21:22283350-22283372 GATAAAAAAGAAAAAAAGGCTGG - Intergenic
1177868515 21:26542211-26542233 CATAAACAGCATAAGAAGGTGGG + Intronic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178267093 21:31153760-31153782 CTTAAAAATCACAAGAAGGCTGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179291283 21:40020356-40020378 CAAAACAAGGAAAAGAAGGAAGG - Intronic
1179393515 21:41015710-41015732 AAAAAAGAGGATAAAAAGGCAGG + Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1181225900 22:21390592-21390614 AAAAAAACGGAAAAGAAGGCCGG - Intergenic
1181252733 22:21544221-21544243 AAAAAAACGGAAAAGAAGGCCGG + Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1182154288 22:28054583-28054605 CATAAAGGGGACAAGATGGCGGG - Intronic
1182174804 22:28273564-28273586 GATAAAAAGGATAAAAAATCCGG + Intronic
1182533706 22:30983304-30983326 TATTAAAAGGTTAAGTAGGCTGG - Intergenic
1182672772 22:32011139-32011161 ACTAAAAAGAAAAAGAAGGCTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183552285 22:38497001-38497023 CTTAAAAAAGTTAAGTAGGCCGG + Intronic
1183964011 22:41430506-41430528 CATAAAAGAGAAAAGAAGCCAGG - Intergenic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184234679 22:43176746-43176768 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
1184569484 22:45312880-45312902 CATAAAAGGCATAAAAGGGCTGG - Intronic
1184794679 22:46725025-46725047 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
949708852 3:6850836-6850858 TATTAAAAAGATAAGAAGGCGGG - Intronic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949947118 3:9199062-9199084 CTTAAAAAGGATGGGAAGGGGGG - Intronic
950350038 3:12340886-12340908 AATAAAAAGGATTAGATGGCTGG + Intronic
950419389 3:12888885-12888907 CATAAAAAGCATTGGGAGGCAGG + Intergenic
950967360 3:17155537-17155559 CCTTAAAAGGCTAAGAATGCTGG + Intergenic
951102953 3:18710507-18710529 GCTAAGAAGAATAAGAAGGCAGG - Intergenic
951619043 3:24580700-24580722 CATAAAATGAGTAGGAAGGCAGG - Intergenic
951729734 3:25797360-25797382 CAAAAACATTATAAGAAGGCAGG - Intergenic
952607375 3:35165573-35165595 GATTAAAAGGATAAAAATGCAGG + Intergenic
953393212 3:42545750-42545772 CATGACAAGGTTAAGAAGGCTGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954020189 3:47733457-47733479 TAAAAAAAGAACAAGAAGGCCGG + Intronic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
954897718 3:53991146-53991168 CTCAAAAAATATAAGAAGGCCGG - Intergenic
955041829 3:55324731-55324753 CACAGAAAGGATAAGCAGCCTGG - Intergenic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
955972636 3:64450987-64451009 CAGAAAAATGATACAAAGGCTGG - Intergenic
956172924 3:66446700-66446722 AATGAAAGGGATAGGAAGGCCGG - Intronic
956423266 3:69107385-69107407 CATAAAAGGAGAAAGAAGGCAGG + Exonic
956546859 3:70413557-70413579 CATAAAAAGAAACTGAAGGCTGG + Intergenic
956713941 3:72061956-72061978 CATAAAAGTGGTAAGAATGCGGG + Intergenic
958031836 3:88120250-88120272 CATAGAAAGAATTAGAATGCTGG - Intronic
958604948 3:96345408-96345430 TATTAAAAGGATAATAAAGCTGG + Intergenic
959200750 3:103243623-103243645 CATAAAAAGGATGATACTGCAGG - Intergenic
959372559 3:105546349-105546371 GTTAAAAAGGATCAAAAGGCAGG - Intronic
960281989 3:115790714-115790736 CAGAACAACAATAAGAAGGCTGG + Intergenic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
961860305 3:129911939-129911961 CATAATTAGGATGGGAAGGCAGG - Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961916811 3:130384473-130384495 CATAAACTGTCTAAGAAGGCAGG + Intronic
963814614 3:149815524-149815546 CATAAAAAGGGGAAGAAAGTTGG + Intronic
964041435 3:152267040-152267062 CACAGAAAGGCTGAGAAGGCTGG + Intronic
964080697 3:152752539-152752561 CATAAAAATGATGTAAAGGCTGG - Intergenic
964093884 3:152908848-152908870 TAATAAAAGAATAAGAAGGCTGG - Intergenic
964351932 3:155811713-155811735 TAAGAAAAGGAAAAGAAGGCCGG + Intergenic
964374545 3:156036088-156036110 GATAAGAAGGAAAACAAGGCTGG - Intergenic
965406524 3:168276074-168276096 CATAAAAAGGATATTCTGGCTGG - Intergenic
966021686 3:175220585-175220607 CATGAAAAGAAAAAGAAGGAGGG - Intronic
966419577 3:179724159-179724181 TAAAAAAATAATAAGAAGGCCGG + Intronic
967238150 3:187408494-187408516 CATCAATAGGATAAGAAGACAGG + Intergenic
968193926 3:196691387-196691409 GATAAAAAGAATAAGGAGGTGGG - Intronic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
970139503 4:12966287-12966309 CATAAACAGAAAATGAAGGCTGG - Intergenic
970324297 4:14907080-14907102 CATAGAATTGGTAAGAAGGCTGG - Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
973066037 4:45794433-45794455 CACAAAAAAGAAAAGAAGGGAGG + Intergenic
973989109 4:56386495-56386517 CTTAAAAAGGAAAAAAAGGCCGG + Intronic
974229019 4:59085076-59085098 CATAAAAAGGCTAAAAATACAGG + Intergenic
974522667 4:63004708-63004730 CATAAGAAGGAAAATATGGCAGG - Intergenic
975368617 4:73557355-73557377 ATTAAATAGGATAAGAAGACTGG + Intergenic
975590173 4:75991686-75991708 CATACAAGGGAAAAGAGGGCTGG + Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975992595 4:80273702-80273724 TTTAAAAAGGAAAAGAAGGAAGG - Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976245416 4:83001853-83001875 AAAAAAAAGGATAGGAAGGAAGG + Intronic
976517738 4:85989665-85989687 TATAAAAAGGATAATAAATCAGG + Intronic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
977399697 4:96516864-96516886 TATTAAAAGGATAACAAGGGGGG + Intergenic
977564637 4:98568558-98568580 CAAAAAAAAGAAAAGAAGTCTGG + Intronic
977910436 4:102528600-102528622 CATAAAAAGTAAAATATGGCTGG + Intronic
978543795 4:109848647-109848669 TATAGAAAGGCTAAGAGGGCAGG + Intronic
978976005 4:114873886-114873908 AATAACAACGCTAAGAAGGCAGG - Intronic
979366047 4:119824782-119824804 TATAAAAATGAAAAAAAGGCTGG - Intergenic
979920785 4:126493317-126493339 CATTAAAAGGCTAAAAAGTCAGG + Intergenic
980031357 4:127835785-127835807 TTTGAAAAGGATAACAAGGCTGG + Exonic
980864294 4:138536355-138536377 CATAAAAGGTAAAAGAAGACAGG - Intergenic
982055559 4:151545671-151545693 ACTAAGAAGGATAAGGAGGCTGG - Intronic
982237132 4:153262081-153262103 AATAAAAAGCCTAAGAAGGTTGG - Intronic
983226846 4:165093664-165093686 CACAAAACTGATAAGGAGGCTGG - Intronic
983983204 4:174024540-174024562 CATTTAAAGGATAAGAATGTAGG - Intergenic
984837624 4:184036398-184036420 AATAAAAATAATAATAAGGCCGG - Intergenic
984876712 4:184375032-184375054 AATAAAAACAATAAGAAGGTAGG - Intergenic
984949400 4:184995572-184995594 TATTAAAAGGAAAAAAAGGCCGG - Intergenic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985051476 4:185996401-185996423 CCTAAAAAGTAAAATAAGGCTGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
988023755 5:25656549-25656571 AATAAAAATGATATGATGGCTGG + Intergenic
988298987 5:29397305-29397327 CATAAAAGTGATGAGAATGCTGG + Intergenic
988723719 5:33904346-33904368 TTTAAAAAGGATTATAAGGCTGG + Intergenic
988910037 5:35830202-35830224 AATAAAAAGAATAAGATGGCTGG - Intergenic
988979198 5:36548105-36548127 CATAAATAGGGTAAAAATGCAGG + Intergenic
989034183 5:37152335-37152357 CATAAAAATAATAATAAGTCGGG - Intronic
989251033 5:39315671-39315693 CATAAAAAGGAAAAGAAACATGG - Intronic
989380328 5:40804056-40804078 AATAAAAAAGTAAAGAAGGCCGG + Intergenic
989636712 5:43543844-43543866 CATTAAAAGGTTAAGAAGTCGGG + Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990151404 5:52822109-52822131 CATATAAAGGATAAAAGGTCAGG - Intronic
990156376 5:52882202-52882224 CAAGAGAAGGATAAGAAGGATGG - Intronic
990656081 5:57956993-57957015 CAATAAAAGGATTAGAAGACAGG - Intergenic
991159253 5:63477523-63477545 CATAAAAGCAATAAGAATGCTGG + Intergenic
992763058 5:79968714-79968736 TATAAACAGCATAAGAAGTCTGG - Intergenic
992821313 5:80499658-80499680 CATCAGAAGCATAAGAATGCAGG - Intronic
992948319 5:81831727-81831749 TATAAAAAAGAAAACAAGGCAGG + Intergenic
993407458 5:87529297-87529319 AATCAAAAGGAAAAAAAGGCTGG + Intergenic
993740822 5:91537348-91537370 CTTCAAAAGGTTAAGTAGGCTGG + Intergenic
993811940 5:92490839-92490861 CTTAAAAAAGATTAGAAGGATGG - Intergenic
993867220 5:93209835-93209857 CACAAAAAGGAAAAGATGCCAGG + Intergenic
994216899 5:97147774-97147796 TATAAAAATGATAAGAAGGTAGG + Intronic
995021216 5:107369343-107369365 CAAATATAGGATAAGAGGGCTGG - Intergenic
995451867 5:112311008-112311030 CAGGAAAAAGATAAGAATGCTGG - Intronic
995506741 5:112868694-112868716 AATAAAAATGTAAAGAAGGCCGG - Exonic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
996570359 5:124927271-124927293 TATAAAATGTATAAGAAAGCAGG + Intergenic
997100586 5:130964547-130964569 CAGAAAAATGATGAGAAGACTGG - Intergenic
997217552 5:132126488-132126510 AATTAAAAGGATTAGAAAGCAGG - Intergenic
997336549 5:133112815-133112837 CATAAAAGAGACAAGAAGGCCGG + Intergenic
997533805 5:134600027-134600049 AAAAAAAAGAAAAAGAAGGCTGG + Intergenic
997567132 5:134896937-134896959 AAAAAAAAGGAAAAAAAGGCTGG - Intronic
997571480 5:134931196-134931218 AAAAAAAAGAAAAAGAAGGCCGG - Intronic
997666539 5:135634113-135634135 CAAAAACAAGGTAAGAAGGCAGG + Intergenic
997775071 5:136596883-136596905 CATAAATAAGAAAAGAGGGCTGG - Intergenic
997977895 5:138450938-138450960 ATTAAAAAGGAAAAAAAGGCCGG - Intergenic
998569626 5:143245599-143245621 GAGAAAGGGGATAAGAAGGCAGG - Intergenic
998866276 5:146506065-146506087 AAAAAAAAGGATAAAAAGGCCGG - Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1003167145 6:3690314-3690336 CATAAAAAGGAAAAGAACAATGG - Intergenic
1003250423 6:4424851-4424873 CAAGAAAAGGGAAAGAAGGCCGG + Intergenic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1003506115 6:6741580-6741602 TATAAATAGGACAAGAAGACAGG - Intergenic
1004052623 6:12101923-12101945 AATAACAAGCATAAGAAAGCTGG + Intronic
1004061071 6:12198637-12198659 CATAATAAGGATGAGAGTGCTGG + Intergenic
1004201296 6:13550340-13550362 AACAAAAAAGATAAGAAGGCTGG - Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005966010 6:30726883-30726905 AAAAAAAAGGATAACTAGGCGGG + Intergenic
1006115511 6:31774168-31774190 AAAAAAAAGGATAAAAAGGATGG + Intronic
1006645059 6:35510050-35510072 AAAAAAAAGAAAAAGAAGGCAGG - Intronic
1008613409 6:53204688-53204710 TATTAAAAGAATAAAAAGGCCGG + Intergenic
1009988685 6:70813791-70813813 CATAAAATGGTTAAGATGGTAGG + Intronic
1010436366 6:75836137-75836159 CATGAAAACACTAAGAAGGCAGG + Intronic
1010839034 6:80625420-80625442 CAAAAGGAGGATAAGAAGGAAGG + Intergenic
1011443267 6:87409507-87409529 AAAAAAAAGGCTAAGCAGGCTGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1015691504 6:135929584-135929606 TATAAAAAGGAAAAGAAAACAGG - Intronic
1015913002 6:138187209-138187231 CTTCAAAAGGATGAGAGGGCCGG - Intronic
1016088658 6:139947334-139947356 CATAAAATGCAAAAGATGGCCGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016617510 6:146069169-146069191 CATAAAAAGCAATAGAATGCTGG - Intronic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017397242 6:154016354-154016376 CACAAAAAGCATAAGAAAGTAGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1019194944 6:170275638-170275660 CACAAAAAAGATAGGCAGGCAGG + Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1020108063 7:5431593-5431615 GATAAAAAGGAAAAAAAGGTGGG - Intronic
1020852141 7:13367582-13367604 CACAAAAAGGATGACAAGGAAGG - Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1021000792 7:15328092-15328114 AATAAAAAAGAAAAGAAGGAAGG - Intronic
1021078096 7:16329824-16329846 CATAAAAAGGAAAAGAATAGAGG + Intronic
1021722258 7:23515840-23515862 AGTAAAAAGGACATGAAGGCTGG - Intronic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022586064 7:31613371-31613393 CATAAAAACAACAAGAACGCTGG - Intronic
1022730274 7:33016373-33016395 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1023275455 7:38514660-38514682 CACAAAACGGAAAAGAAGTCAGG - Intronic
1023541633 7:41272405-41272427 TATAAAAAGGAGTAGAAGCCAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024098814 7:46008015-46008037 AATAACAAGAATAAGTAGGCTGG - Intergenic
1024841165 7:53589301-53589323 CATAAAAAGGCAAAGTAGACAGG - Intergenic
1024912805 7:54465308-54465330 CATACAAACAAAAAGAAGGCAGG - Intergenic
1025064624 7:55842614-55842636 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1025995324 7:66524056-66524078 CTTAAAAAGGGTCAGGAGGCCGG - Intergenic
1026856651 7:73759428-73759450 CAAAAAAAGAAAAAAAAGGCCGG + Intergenic
1027167890 7:75848629-75848651 AATAAAAAATAAAAGAAGGCCGG - Intronic
1027900598 7:84109328-84109350 TATAAAAAAGAGAAGAAGGAAGG + Intronic
1028191776 7:87862148-87862170 CAGAAAAAAGATAAGTAGGTTGG - Intronic
1028613213 7:92735217-92735239 TACAAAAATGATAAGAAGGAAGG - Intronic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028742311 7:94289673-94289695 AATAAAAAGGAGAAGAAGATAGG + Intergenic
1028840306 7:95422620-95422642 CATAAAAAGAAAAAGATGGAAGG + Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029184334 7:98727777-98727799 CCAAAAAAGGAAAAGAAAGCAGG - Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030413211 7:109208514-109208536 CATTAAAAGTATGAAAAGGCAGG + Intergenic
1031419572 7:121534520-121534542 CATGAAAAAAATAAGAAGGAGGG - Intergenic
1031793142 7:126135522-126135544 AATAAAATGGAAAAGAAGCCCGG + Intergenic
1032881129 7:136091703-136091725 CCTAAAAAGGAAAAGAGAGCGGG - Intergenic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033798117 7:144871447-144871469 TATAAAAAGAGAAAGAAGGCTGG - Intergenic
1034230282 7:149520347-149520369 CATAAAAAAGACAAAAGGGCTGG + Intergenic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1036408534 8:8477494-8477516 TCTAAAAAGGAGAAGAAGGCAGG + Intergenic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1038724869 8:30072107-30072129 AATAAAAAAGATAACAAGGCTGG - Intronic
1040420213 8:47232449-47232471 CATCAAAAGGATAATAGGCCAGG + Intergenic
1040479114 8:47807712-47807734 CAAAAAAAAAATAAGTAGGCCGG - Intronic
1040491058 8:47922604-47922626 CTTAAAAATGAAAAGCAGGCTGG - Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040658751 8:49544371-49544393 CATAAAATGCAAAAGAGGGCAGG + Intronic
1040773174 8:51004327-51004349 GATAAAAAAGATAAAGAGGCAGG + Intergenic
1040783024 8:51133509-51133531 CATACTAAGTAAAAGAAGGCAGG + Intergenic
1041238212 8:55826500-55826522 CATAAAATGGATAAAAAGGCTGG + Intergenic
1041247199 8:55899935-55899957 CAGAAAAGGGATGATAAGGCTGG - Intronic
1041498099 8:58509297-58509319 AATAAAATAGATAAAAAGGCTGG - Intergenic
1041720526 8:60971373-60971395 ATTAAAAAGGAAAAGTAGGCCGG - Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1042347792 8:67745795-67745817 GATAAAAAGTATAAAAAGCCAGG + Intronic
1043123296 8:76359047-76359069 CATAAAAATGATAAGCACTCGGG + Intergenic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044068820 8:87729701-87729723 CATCTAAAAGAAAAGAAGGCTGG - Intergenic
1045441014 8:102210757-102210779 AATAAAAATAATAATAAGGCTGG - Intronic
1045451753 8:102333878-102333900 CATAAAAAGGAAAAGAAACTCGG - Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046227395 8:111301509-111301531 CATAAAATTTATATGAAGGCTGG - Intergenic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1047484123 8:125313265-125313287 AAAAGAAAGGATGAGAAGGCAGG + Intronic
1047735548 8:127761936-127761958 CATAAAAAGTCTATGTAGGCAGG + Intergenic
1047739801 8:127797322-127797344 AATAAAAAGCAAAACAAGGCCGG - Intergenic
1047964277 8:130034171-130034193 CATGAAAAGGAAAAACAGGCCGG + Intergenic
1048325937 8:133438951-133438973 CATACAGAGTATAAGAAGCCAGG - Intergenic
1049980905 9:902783-902805 CATAAAAAGGAGCGGAAAGCTGG - Intronic
1050118251 9:2282440-2282462 CAGAAAAAGGATATCTAGGCAGG + Intergenic
1050176439 9:2873875-2873897 CATAAAATAGATAAGAATTCTGG + Intergenic
1050506272 9:6352595-6352617 CATATAATGGATAAGGAGGGTGG - Intergenic
1050692527 9:8243961-8243983 AATAAAAAAGATAAGAAGAAAGG + Intergenic
1050780574 9:9329185-9329207 CAGAAACAGGATAATATGGCTGG + Intronic
1051058927 9:13023386-13023408 CATAAAAGGCAAAAGAAGGGAGG + Intergenic
1051638747 9:19204856-19204878 AATAAAAAAAATAAGGAGGCTGG - Intergenic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052267636 9:26592295-26592317 CATTAAAAGGATTATACGGCTGG - Intergenic
1052474677 9:28943722-28943744 GAAAAAAAGGATAACAGGGCTGG + Intergenic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1053148775 9:35729962-35729984 TAGAAAAAGGATGAGAAGACAGG + Intronic
1053227535 9:36373770-36373792 CAAAAAAAGGCTAGCAAGGCCGG - Intronic
1053421466 9:37982494-37982516 AAAAAAATGGATAAGTAGGCCGG + Intronic
1053566721 9:39260417-39260439 CATCAAAAAGATAACTAGGCTGG + Intronic
1053832503 9:42098275-42098297 CATGAAAAAGATAACTAGGCTGG + Intronic
1054130423 9:61358587-61358609 CATCAAAAAGATAACTAGGCTGG - Intergenic
1054598049 9:67089145-67089167 CATGAAAAAGATAACTAGGCTGG - Intergenic
1055096111 9:72415796-72415818 AATAAAAAGGAAAGGAAGACAGG - Intergenic
1055262431 9:74453048-74453070 CATAAAAATCATAAAAAGGGTGG + Intergenic
1055964391 9:81851301-81851323 CATCAAAAGGATAAGGCGACAGG - Intergenic
1055966416 9:81869314-81869336 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1056171287 9:83987351-83987373 AATAGAAACAATAAGAAGGCAGG - Intronic
1057043122 9:91862025-91862047 TATAAGAAGAAGAAGAAGGCCGG + Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1058071801 9:100608997-100609019 CATGAAGAGAATAAAAAGGCAGG - Intergenic
1058541049 9:106013073-106013095 TTTAAAAAGGAAAAGCAGGCAGG - Intergenic
1058832884 9:108835066-108835088 AATAGAAAGGAGAATAAGGCAGG - Intergenic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059646245 9:116270881-116270903 AATAAGAAGGATATCAAGGCAGG + Intronic
1059914732 9:119086169-119086191 CATAAAAAGGACAAACAAGCAGG + Intergenic
1060124813 9:121033433-121033455 CATAACAATGAAAAGAAGCCAGG + Intronic
1061049944 9:128189325-128189347 CTTAAAAATGATAAGCAGGTAGG - Intronic
1061233313 9:129327598-129327620 AAAAAAAAGGATAAGAGAGCAGG + Intergenic
1061331900 9:129899860-129899882 AATAAAAATGATCAGAAGGAAGG + Intronic
1061332064 9:129901108-129901130 AATAAAAATGACGAGAAGGCCGG + Intronic
1061435664 9:130559844-130559866 CATAATGAGGATACGAAAGCTGG - Intergenic
1061605893 9:131710579-131710601 CATAATATGGGTAAGAATGCAGG + Intronic
1062655112 9:137600142-137600164 AATAAAAAAAAAAAGAAGGCCGG + Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185834947 X:3336806-3336828 AATCAAAAGGAAAATAAGGCAGG + Intronic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1186963796 X:14765428-14765450 CATAAAAAAGACAAGCTGGCTGG - Intergenic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187272671 X:17792934-17792956 AATAAAAAGGCAAAGAAGGAAGG + Intergenic
1187308589 X:18119548-18119570 AAAAAAAAGGAAAAGACGGCAGG + Intergenic
1187592064 X:20727804-20727826 TATAAAGAGGAAAAGAAAGCAGG + Intergenic
1188314591 X:28657655-28657677 CATAAAAAGGCTAAGAATTCTGG + Intronic
1188467736 X:30501245-30501267 CATAAGAAGGATCAGACAGCAGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188780318 X:34275712-34275734 CATAAAGAGAATGGGAAGGCAGG - Intergenic
1189350778 X:40274022-40274044 AATAAAACCCATAAGAAGGCCGG + Intergenic
1189569522 X:42280993-42281015 CATTAAAAGGCCAAGAAAGCTGG - Intergenic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1190834975 X:54092245-54092267 GAAAAAAATGAAAAGAAGGCTGG + Intronic
1191035624 X:56023734-56023756 CATAAAAGCAATAAGAATGCTGG - Intergenic
1192462361 X:71328239-71328261 CAAAAAAATAATAATAAGGCCGG + Intergenic
1192609057 X:72549309-72549331 CATATATAGAATAATAAGGCGGG - Intronic
1193876728 X:86870279-86870301 GTTAAAAAGGAAAGGAAGGCTGG - Intergenic
1194456843 X:94115249-94115271 TATAAAAAGAATAAGGCGGCTGG - Intergenic
1195106133 X:101603143-101603165 CATAAAAATAAAATGAAGGCAGG - Intergenic
1195695563 X:107664363-107664385 CATCAAAAGGAAATGCAGGCGGG - Intergenic
1196397584 X:115281798-115281820 CATTAAAAGAGTAAAAAGGCAGG + Intergenic
1196713271 X:118785864-118785886 AATTAAAAGTAAAAGAAGGCTGG - Intronic
1197038725 X:121908603-121908625 CATCAAAATGAAAAAAAGGCAGG - Intergenic
1197524570 X:127545915-127545937 CATAAAATGCATAATAAGCCAGG + Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1198147739 X:133874454-133874476 CTTAAAAAGGAAAAGTAGGATGG - Intronic
1198162362 X:134020281-134020303 AAACAAAAGGATAAGCAGGCCGG + Intergenic
1198244188 X:134813630-134813652 AATAAAAAGGAAAAGATGCCGGG + Intronic
1199372879 X:147072320-147072342 TATAAAAAGAAAAAGAAAGCAGG - Intergenic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199510490 X:148616311-148616333 CATAAAAATGAAAAGAACCCAGG + Intronic
1199526745 X:148801301-148801323 AATAGAAGGGATAAGGAGGCGGG - Intronic
1199594893 X:149499061-149499083 CATAAAAAGGAATGAAAGGCTGG + Intronic
1199998542 X:153043690-153043712 CATAAAGAGGTGAAGATGGCAGG + Intergenic
1201316903 Y:12656295-12656317 CAAAAACATGAAAAGAAGGCAGG - Intergenic
1201733217 Y:17228413-17228435 CAAAAAAAAGAAAAAAAGGCCGG - Intergenic